Starting /dee2/code/volunteer_pipeline.sh SRR7804227 current disk space = 1540572909568 free memory = 1601319576 SRR7804227 SRAfilesize 5622812eb890e2d00586995473bc058e SRR7804227.sra SRR7804227.sra file validated SRR7804227 is paired end SRR7804227 is conventional basespace SRR7804227 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804227_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.08875 37.0 37.0 37.0 37.0 37.0 2 36.284 37.0 37.0 37.0 37.0 37.0 3 36.352 37.0 37.0 37.0 37.0 37.0 4 36.2885 37.0 37.0 37.0 37.0 37.0 5 36.4505 37.0 37.0 37.0 37.0 37.0 6 36.4795 37.0 37.0 37.0 37.0 37.0 7 36.2385 37.0 37.0 37.0 37.0 37.0 8 36.3775 37.0 37.0 37.0 37.0 37.0 9 36.348 37.0 37.0 37.0 37.0 37.0 10-14 36.4531 37.0 37.0 37.0 37.0 37.0 15-19 36.415800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.3853 37.0 37.0 37.0 37.0 37.0 25-29 36.339 37.0 37.0 37.0 37.0 37.0 30-34 36.332 37.0 37.0 37.0 37.0 37.0 35-39 36.2957 37.0 37.0 37.0 37.0 37.0 40-44 36.2168 37.0 37.0 37.0 37.0 37.0 45-49 36.1493 37.0 37.0 37.0 37.0 37.0 50-54 36.1967 37.0 37.0 37.0 37.0 37.0 55-59 36.0705 37.0 37.0 37.0 37.0 37.0 60-64 36.1032 37.0 37.0 37.0 37.0 37.0 65-69 36.1105 37.0 37.0 37.0 37.0 37.0 70-74 35.9075 37.0 37.0 37.0 37.0 37.0 75-79 35.9726 37.0 37.0 37.0 37.0 37.0 80-84 35.9881 37.0 37.0 37.0 37.0 37.0 85-89 35.8763 37.0 37.0 37.0 37.0 37.0 90-94 35.8376 37.0 37.0 37.0 37.0 37.0 95-99 35.763600000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.7577 37.0 37.0 37.0 37.0 37.0 105-109 35.6914 37.0 37.0 37.0 37.0 37.0 110-114 35.6492 37.0 37.0 37.0 37.0 37.0 115-119 35.5955 37.0 37.0 37.0 37.0 37.0 120-124 35.537 37.0 37.0 37.0 37.0 37.0 125-129 35.518299999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.3038 37.0 37.0 37.0 34.6 37.0 135-139 35.2262 37.0 37.0 37.0 29.8 37.0 140-144 35.184000000000005 37.0 37.0 37.0 29.8 37.0 145-149 35.0657 37.0 37.0 37.0 27.4 37.0 150-151 34.48675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 1.0 24 1.0 25 4.0 26 11.0 27 20.0 28 20.0 29 34.0 30 50.0 31 64.0 32 77.0 33 107.0 34 165.0 35 502.0 36 2716.0 37 225.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.66182000501379 12.158435698169967 11.155678114815744 36.0240661820005 2 26.450000000000003 17.2 32.775 23.575 3 22.825 24.0 23.525 29.65 4 27.725 29.125 19.275000000000002 23.875 5 25.374999999999996 32.125 21.75 20.75 6 21.375 32.5 22.8 23.325000000000003 7 16.7 18.75 42.95 21.6 8 22.025 19.275000000000002 26.85 31.85 9 21.575 18.425 30.625000000000004 29.375 10-14 24.22 25.945 24.11 25.724999999999998 15-19 24.2 25.064999999999998 24.85 25.885 20-24 24.015 25.235000000000003 24.625 26.125 25-29 23.665 24.855 24.995 26.484999999999996 30-34 24.275 24.735 24.635 26.355 35-39 24.555 24.654999999999998 24.68 26.11 40-44 23.865 24.87 24.805 26.46 45-49 23.95 24.48 25.025 26.545 50-54 24.185000000000002 24.94 24.515 26.36 55-59 24.349999999999998 25.195 24.07 26.384999999999998 60-64 24.57 24.68 24.165 26.584999999999997 65-69 23.68 25.27 24.09 26.96 70-74 24.605 24.565 24.205 26.625 75-79 24.279999999999998 25.119999999999997 24.185000000000002 26.415 80-84 24.365000000000002 24.285 24.68 26.669999999999998 85-89 24.705 23.665 24.7 26.93 90-94 24.349999999999998 24.615000000000002 25.069999999999997 25.965 95-99 24.57 23.919999999999998 25.19 26.32 100-104 24.86 24.0 23.955000000000002 27.185 105-109 25.09 24.18 24.044999999999998 26.685 110-114 24.97 24.14 24.285 26.605 115-119 25.085 24.185000000000002 23.915 26.815 120-124 25.055 23.84 24.085 27.02 125-129 25.419999999999998 23.835 24.34 26.405 130-134 25.264999999999997 23.815 24.099999999999998 26.82 135-139 25.52 23.775 23.745 26.96 140-144 25.575 23.66 23.805 26.96 145-149 25.46 23.125 24.19 27.224999999999998 150-151 25.874999999999996 23.674999999999997 23.962500000000002 26.487500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 2.5 26 3.5 27 3.0 28 2.5 29 4.0 30 10.0 31 11.5 32 11.5 33 24.5 34 27.0 35 32.0 36 51.0 37 65.0 38 79.5 39 96.0 40 110.0 41 120.5 42 144.0 43 164.5 44 168.5 45 179.0 46 177.0 47 162.0 48 160.5 49 167.5 50 165.5 51 145.0 52 132.0 53 128.0 54 109.0 55 89.5 56 92.0 57 88.5 58 81.5 59 81.0 60 71.0 61 68.0 62 68.5 63 75.0 64 77.0 65 76.5 66 77.5 67 65.5 68 50.5 69 40.0 70 41.5 71 45.5 72 35.0 73 24.5 74 24.0 75 21.5 76 13.5 77 8.5 78 9.0 79 5.5 80 2.5 81 1.0 82 1.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.54973821989529 91.25 2 4.2408376963350785 8.1 3 0.15706806282722513 0.44999999999999996 4 0.052356020942408384 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.575 0.0 0.0 0.0 0.0 128-129 0.65 0.0 0.0 0.0 0.0 130-131 0.725 0.0 0.0 0.0 0.0 132-133 0.825 0.0 0.0 0.0 0.0 134-135 0.8875 0.0 0.0 0.0 0.0 136-137 0.95 0.0 0.0 0.0 0.0 138-139 1.1124999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATCT 10 0.006830828 145.0 7 >>END_MODULE SRR7804227 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804227_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3155 37.0 37.0 37.0 37.0 37.0 2 35.967 37.0 37.0 37.0 37.0 37.0 3 36.075 37.0 37.0 37.0 37.0 37.0 4 36.2085 37.0 37.0 37.0 37.0 37.0 5 36.3495 37.0 37.0 37.0 37.0 37.0 6 36.1035 37.0 37.0 37.0 37.0 37.0 7 36.086 37.0 37.0 37.0 37.0 37.0 8 36.1085 37.0 37.0 37.0 37.0 37.0 9 36.2925 37.0 37.0 37.0 37.0 37.0 10-14 36.1456 37.0 37.0 37.0 37.0 37.0 15-19 36.076600000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.0536 37.0 37.0 37.0 37.0 37.0 25-29 36.0437 37.0 37.0 37.0 37.0 37.0 30-34 35.9758 37.0 37.0 37.0 37.0 37.0 35-39 35.8179 37.0 37.0 37.0 37.0 37.0 40-44 35.888099999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.7813 37.0 37.0 37.0 37.0 37.0 50-54 35.8146 37.0 37.0 37.0 37.0 37.0 55-59 35.7647 37.0 37.0 37.0 37.0 37.0 60-64 35.6933 37.0 37.0 37.0 37.0 37.0 65-69 35.5245 37.0 37.0 37.0 37.0 37.0 70-74 35.5749 37.0 37.0 37.0 37.0 37.0 75-79 35.505900000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.448 37.0 37.0 37.0 37.0 37.0 85-89 35.3516 37.0 37.0 37.0 34.6 37.0 90-94 35.3709 37.0 37.0 37.0 37.0 37.0 95-99 35.2615 37.0 37.0 37.0 32.2 37.0 100-104 35.1769 37.0 37.0 37.0 27.4 37.0 105-109 35.1622 37.0 37.0 37.0 27.4 37.0 110-114 34.9481 37.0 37.0 37.0 25.0 37.0 115-119 34.9894 37.0 37.0 37.0 25.0 37.0 120-124 34.904799999999994 37.0 37.0 37.0 25.0 37.0 125-129 34.7853 37.0 37.0 37.0 25.0 37.0 130-134 34.7496 37.0 37.0 37.0 25.0 37.0 135-139 34.43169999999999 37.0 37.0 37.0 25.0 37.0 140-144 34.2956 37.0 37.0 37.0 25.0 37.0 145-149 34.1154 37.0 37.0 37.0 25.0 37.0 150-151 33.4825 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 5.0 15 1.0 16 1.0 17 3.0 18 0.0 19 5.0 20 5.0 21 3.0 22 6.0 23 8.0 24 7.0 25 17.0 26 13.0 27 11.0 28 21.0 29 39.0 30 52.0 31 57.0 32 90.0 33 156.0 34 337.0 35 821.0 36 2249.0 37 91.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.224999999999994 13.5 12.5 35.775 2 31.2 18.2 28.249999999999996 22.35 3 23.925 22.175 27.400000000000002 26.5 4 27.375 30.575000000000003 18.075 23.974999999999998 5 28.525 31.900000000000002 16.85 22.725 6 22.825 34.2 18.25 24.725 7 22.3 14.05 36.675000000000004 26.974999999999998 8 23.025000000000002 20.150000000000002 21.25 35.575 9 24.9 21.525 23.549999999999997 30.025000000000002 10-14 26.33 24.625 22.13 26.915 15-19 26.915 24.315 22.305 26.465 20-24 25.825 24.375 22.869999999999997 26.93 25-29 26.424999999999997 24.025 22.515 27.034999999999997 30-34 26.700000000000003 24.375 22.68 26.245 35-39 26.265 24.665 21.985 27.084999999999997 40-44 26.834999999999997 24.115000000000002 22.595000000000002 26.455000000000002 45-49 26.56 24.455 22.42 26.565 50-54 26.97 23.544999999999998 22.665 26.82 55-59 26.995 24.39 22.275 26.340000000000003 60-64 26.91 24.685000000000002 22.36 26.045 65-69 27.065 23.575 22.865 26.495 70-74 26.745 24.135 22.64 26.479999999999997 75-79 27.595 23.52 22.86 26.025 80-84 27.16 23.74 22.91 26.19 85-89 27.560000000000002 23.805 22.685 25.95 90-94 27.185 24.15 22.09 26.575 95-99 27.005000000000003 23.369999999999997 23.105 26.52 100-104 27.060000000000002 23.89 22.705000000000002 26.345000000000002 105-109 27.205000000000002 24.435000000000002 22.439999999999998 25.919999999999998 110-114 27.560000000000002 24.165 22.695 25.580000000000002 115-119 27.694999999999997 23.549999999999997 22.8 25.955000000000002 120-124 27.365000000000002 24.005000000000003 23.0 25.629999999999995 125-129 27.49 23.785 22.650000000000002 26.075 130-134 27.425 24.03 23.01 25.535000000000004 135-139 27.175 24.654999999999998 22.720000000000002 25.45 140-144 28.065 24.044999999999998 22.42 25.47 145-149 28.005000000000003 24.560000000000002 22.134999999999998 25.3 150-151 27.962500000000002 24.762500000000003 22.400000000000002 24.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 1.0 25 0.5 26 1.0 27 5.5 28 6.0 29 3.0 30 5.5 31 8.5 32 9.0 33 10.5 34 12.5 35 15.5 36 28.5 37 42.0 38 55.5 39 69.5 40 80.0 41 94.5 42 113.0 43 126.0 44 132.5 45 139.5 46 149.0 47 153.5 48 157.0 49 152.0 50 140.5 51 132.5 52 121.0 53 112.0 54 106.0 55 101.0 56 93.5 57 107.0 58 120.0 59 112.0 60 107.5 61 94.0 62 98.0 63 103.0 64 95.5 65 86.5 66 89.0 67 95.0 68 86.5 69 77.5 70 64.5 71 60.0 72 55.0 73 44.0 74 36.0 75 28.5 76 19.5 77 13.5 78 7.5 79 3.5 80 1.5 81 2.0 82 2.0 83 1.5 84 1.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 95.27330340639028 90.2 2 4.198574069184051 7.95 3 0.29046738843411674 0.8250000000000001 4 0.18484288354898337 0.7000000000000001 5 0.0 0.0 6 0.026406126221283337 0.15 7 0.026406126221283337 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCA 7 0.17500000000000002 No Hit CTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.575 0.0 0.0 0.0 0.0 128-129 0.65 0.0 0.0 0.0 0.0 130-131 0.725 0.0 0.0 0.0 0.0 132-133 0.825 0.0 0.0 0.0 0.0 134-135 0.8875 0.0 0.0 0.0 0.0 136-137 0.95 0.0 0.0 0.0 0.0 138-139 1.1124999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584504 spots for SRR7804227.sra Written 1584504 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra Read 1584496 spots for SRR7804227.sra Written 1584496 spots for SRR7804227.sra SRR ids: ['SRR7804227.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ycskbiro SRR7804227.sra spots: 31689928 blocks: [[1, 1584496], [1584497, 3168992], [3168993, 4753488], [4753489, 6337984], [6337985, 7922480], [7922481, 9506976], [9506977, 11091472], [11091473, 12675968], [12675969, 14260464], [14260465, 15844960], [15844961, 17429456], [17429457, 19013952], [19013953, 20598448], [20598449, 22182944], [22182945, 23767440], [23767441, 25351936], [25351937, 26936432], [26936433, 28520928], [28520929, 30105424], [30105425, 31689928]] SRR7804227 file size 10716976 SRR7804227 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804227 SRR7804227_1.fastq SRR7804227_2.fastq Input file: SRR7804227_1.fastq Paired file: SRR7804227_2.fastq trimmed: SRR7804227-trimmed-pair1.fastq, SRR7804227-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:31:50 2024 >> started Sat Dec 7 18:32:24 2024 >> done (33.338s) 31689928 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 965 ( 0.00%) empty read pairs filtered out after trimming by size control 31688868 (100.00%) read pairs available; of these: 600603 ( 1.90%) trimmed read pairs available after processing 31088265 (98.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 18 0.00% 20 12 0.00% 21 21 0.00% 22 32 0.00% 23 13 0.00% 24 43 0.00% 25 29 0.00% 26 37 0.00% 27 26 0.00% 28 39 0.00% 29 53 0.00% 30 43 0.00% 31 40 0.00% 32 60 0.00% 33 65 0.00% 34 36 0.00% 35 46 0.00% 36 42 0.00% 37 67 0.00% 38 82 0.00% 39 56 0.00% 40 63 0.00% 41 64 0.00% 42 78 0.00% 43 63 0.00% 44 74 0.00% 45 77 0.00% 46 63 0.00% 47 58 0.00% 48 81 0.00% 49 71 0.00% 50 83 0.00% 51 75 0.00% 52 84 0.00% 53 97 0.00% 54 110 0.00% 55 114 0.00% 56 119 0.00% 57 106 0.00% 58 84 0.00% 59 94 0.00% 60 91 0.00% 61 133 0.00% 62 115 0.00% 63 118 0.00% 64 99 0.00% 65 135 0.00% 66 137 0.00% 67 134 0.00% 68 136 0.00% 69 171 0.00% 70 142 0.00% 71 175 0.00% 72 200 0.00% 73 181 0.00% 74 219 0.00% 75 223 0.00% 76 234 0.00% 77 232 0.00% 78 228 0.00% 79 321 0.00% 80 323 0.00% 81 361 0.00% 82 385 0.00% 83 456 0.00% 84 479 0.00% 85 495 0.00% 86 566 0.00% 87 576 0.00% 88 698 0.00% 89 766 0.00% 90 777 0.00% 91 889 0.00% 92 1019 0.00% 93 1091 0.00% 94 1238 0.00% 95 1386 0.00% 96 1460 0.00% 97 1652 0.01% 98 1751 0.01% 99 1859 0.01% 100 2007 0.01% 101 2320 0.01% 102 2337 0.01% 103 2595 0.01% 104 2930 0.01% 105 3171 0.01% 106 3424 0.01% 107 3608 0.01% 108 3745 0.01% 109 4021 0.01% 110 4282 0.01% 111 4534 0.01% 112 4785 0.02% 113 5182 0.02% 114 5478 0.02% 115 6042 0.02% 116 6241 0.02% 117 6629 0.02% 118 6777 0.02% 119 7076 0.02% 120 7442 0.02% 121 7927 0.03% 122 8431 0.03% 123 8729 0.03% 124 9533 0.03% 125 9789 0.03% 126 10363 0.03% 127 10786 0.03% 128 11097 0.04% 129 11647 0.04% 130 11935 0.04% 131 12583 0.04% 132 13492 0.04% 133 13913 0.04% 134 14706 0.05% 135 15394 0.05% 136 16051 0.05% 137 16603 0.05% 138 17015 0.05% 139 17537 0.06% 140 18208 0.06% 141 18572 0.06% 142 19455 0.06% 143 20334 0.06% 144 21256 0.07% 145 22499 0.07% 146 23385 0.07% 147 24201 0.08% 148 25136 0.08% 149 25140 0.08% 150 26082 0.08% 151 31088265 98.10% 31688868 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=18 prefix-density=0.89 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=16.45 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.2 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=23 prefix-density=0.64 prefix-fanout=2.5 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=145.43 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.6 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804227 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:33:05 Started mapping on | Dec 07 18:33:05 Finished on | Dec 07 18:36:55 Mapping speed, Million of reads per hour | 496.00 Number of input reads | 31688868 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 30035878 Uniquely mapped reads % | 94.78% Average mapped length | 300.19 Number of splices: Total | 31715675 Number of splices: Annotated (sjdb) | 29925221 Number of splices: GT/AG | 31274501 Number of splices: GC/AG | 388896 Number of splices: AT/AC | 10516 Number of splices: Non-canonical | 41762 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.65 Insertion rate per base | 0.01% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310403 % of reads mapped to multiple loci | 0.98% Number of reads mapped to too many loci | 18518 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.75% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1342587 1342587 1342587 N_multimapping 310403 310403 310403 N_noFeature 817064 29082973 1079627 N_ambiguous 834387 5445 145307 UnstrandedReadsAssigned:28384427 PositiveStrandReadsAssigned:947460 NegativeStrandReadsAssigned:28810944 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804227 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804227-trimmed-pair1.fastq SRR7804227-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,688,868 reads, 29,033,751 reads pseudoaligned [quant] estimated average fragment length: 345.463 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52973 SRR7804227.ke.tsv 35125 SRR7804227.se.tsv 88098 total ==> SRR7804227.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 593.043 0 0 PNS24247 1044 699.537 87.2047 5.42759 PNS24249 1928 1583.54 111.125 3.05535 PNS24246 1044 699.537 87.2047 5.42759 PNS24248 1044 699.537 87.2047 5.42759 PNS24244 1471 1126.54 148.261 5.73007 PNS24243 293 68.7271 0 0 KQK14069 1603 1258.54 2349.62 81.2848 KQK14071 474 181.743 62.1102 14.8793 ==> SRR7804227.se.tsv <== BRADI_1g14170v3 2923 BRADI_1g53295v3 172 BRADI_1g59795v3 1220 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 672 BRADI_1g74790v3 328 BRADI_1g09890v3 2 BRADI_1g77505v3 380 BRADI_1g48960v3 0 SRR7804227 completed mapping pipeline successfully