Starting /dee2/code/volunteer_pipeline.sh SRR7804228 current disk space = 1540518068224 free memory = 1410910848 SRR7804228 SRAfilesize b84bbc2ac916db0244920350caee3f1f SRR7804228.sra SRR7804228.sra file validated SRR7804228 is paired end SRR7804228 is conventional basespace SRR7804228 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804228_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2595 37.0 37.0 37.0 37.0 37.0 2 36.1715 37.0 37.0 37.0 37.0 37.0 3 36.368 37.0 37.0 37.0 37.0 37.0 4 36.448 37.0 37.0 37.0 37.0 37.0 5 36.5095 37.0 37.0 37.0 37.0 37.0 6 36.4735 37.0 37.0 37.0 37.0 37.0 7 36.2915 37.0 37.0 37.0 37.0 37.0 8 36.4245 37.0 37.0 37.0 37.0 37.0 9 36.399 37.0 37.0 37.0 37.0 37.0 10-14 36.4976 37.0 37.0 37.0 37.0 37.0 15-19 36.4952 37.0 37.0 37.0 37.0 37.0 20-24 36.4697 37.0 37.0 37.0 37.0 37.0 25-29 36.3909 37.0 37.0 37.0 37.0 37.0 30-34 36.3729 37.0 37.0 37.0 37.0 37.0 35-39 36.3127 37.0 37.0 37.0 37.0 37.0 40-44 36.298700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.1923 37.0 37.0 37.0 37.0 37.0 50-54 36.208999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.1845 37.0 37.0 37.0 37.0 37.0 60-64 36.2154 37.0 37.0 37.0 37.0 37.0 65-69 36.135299999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.108999999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.0209 37.0 37.0 37.0 37.0 37.0 80-84 36.0797 37.0 37.0 37.0 37.0 37.0 85-89 35.994099999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.933400000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.811400000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.869800000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.814099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.787400000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6693 37.0 37.0 37.0 37.0 37.0 120-124 35.5517 37.0 37.0 37.0 37.0 37.0 125-129 35.6102 37.0 37.0 37.0 37.0 37.0 130-134 35.4861 37.0 37.0 37.0 37.0 37.0 135-139 35.334999999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.3616 37.0 37.0 37.0 32.2 37.0 145-149 35.1529 37.0 37.0 37.0 29.8 37.0 150-151 34.597 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 4.0 23 0.0 24 5.0 25 5.0 26 12.0 27 11.0 28 18.0 29 25.0 30 46.0 31 48.0 32 62.0 33 100.0 34 140.0 35 485.0 36 2814.0 37 223.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.827655310621246 12.575150300601202 11.297595190380761 37.29959919839679 2 24.725 17.424999999999997 35.099999999999994 22.75 3 23.175 25.025 22.525000000000002 29.275000000000002 4 27.425 29.975 19.625 22.975 5 26.0 32.125 21.65 20.225 6 20.825 33.475 22.675 23.025000000000002 7 16.3 20.325 41.225 22.15 8 20.7 19.85 28.199999999999996 31.25 9 21.325 18.9 31.25 28.525 10-14 22.994999999999997 26.484999999999996 24.169999999999998 26.35 15-19 23.175 24.765 25.845000000000002 26.215 20-24 23.95 25.6 24.515 25.935000000000002 25-29 23.835 25.605 24.465 26.095000000000002 30-34 23.325000000000003 24.795 25.330000000000002 26.55 35-39 23.080000000000002 24.975 25.535000000000004 26.41 40-44 23.305 24.865000000000002 25.330000000000002 26.5 45-49 23.849999999999998 25.39 24.505 26.255 50-54 23.064999999999998 25.35 24.765 26.82 55-59 24.044999999999998 25.495 23.849999999999998 26.61 60-64 24.305 24.82 24.18 26.695 65-69 24.0 24.37 24.91 26.72 70-74 24.375 24.709999999999997 24.365000000000002 26.55 75-79 24.175 24.77 24.654999999999998 26.400000000000002 80-84 23.765 24.715 24.445 27.075 85-89 23.16 24.36 25.330000000000002 27.150000000000002 90-94 24.085 24.29 24.425 27.200000000000003 95-99 23.925 24.779999999999998 24.795 26.5 100-104 24.295 24.455 24.82 26.43 105-109 24.235 24.060000000000002 24.834999999999997 26.87 110-114 24.615000000000002 24.645 23.9 26.840000000000003 115-119 24.65 24.46 24.19 26.700000000000003 120-124 23.794999999999998 24.285 24.42 27.500000000000004 125-129 24.759999999999998 24.165 24.529999999999998 26.545 130-134 24.815 24.4 24.375 26.41 135-139 24.865000000000002 24.435000000000002 24.104999999999997 26.595000000000002 140-144 25.119999999999997 23.7 24.33 26.85 145-149 24.6 23.97 24.415 27.015 150-151 25.587500000000002 23.1625 24.0125 27.237499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.0 26 2.0 27 3.5 28 2.5 29 2.5 30 7.0 31 11.0 32 16.5 33 22.0 34 25.5 35 34.5 36 58.0 37 77.0 38 76.5 39 94.5 40 115.0 41 129.5 42 162.5 43 171.5 44 172.5 45 177.0 46 179.0 47 185.0 48 169.5 49 148.5 50 135.5 51 134.5 52 130.5 53 119.0 54 119.0 55 122.5 56 110.0 57 98.0 58 90.0 59 81.0 60 75.0 61 71.0 62 66.5 63 62.5 64 66.5 65 61.5 66 54.5 67 56.5 68 50.5 69 43.5 70 39.0 71 38.0 72 34.0 73 27.0 74 24.0 75 15.0 76 8.5 77 6.5 78 5.5 79 2.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 95.05132929718347 90.275 2 4.632798104764412 8.799999999999999 3 0.2895498815477757 0.8250000000000001 4 0.026322716504343247 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.16249999999999998 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.7125 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.9125 0.0 0.0 0.0 0.0 132-133 1.0 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.2875 0.0 0.0 0.0 0.0 138-139 1.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGCA 10 0.006830828 145.0 4 GGCACTA 10 0.006830828 145.0 2 TCAGCAT 10 0.006830828 145.0 8 GTCTTGC 10 0.006830828 145.0 8 CTTACCA 10 0.006830828 145.0 1 TCTTGCT 10 0.006830828 145.0 9 AGTCTTG 10 0.006830828 145.0 7 CTTGAAA 10 0.006830828 145.0 145 >>END_MODULE SRR7804228 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804228_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.93 37.0 37.0 37.0 37.0 37.0 2 35.693 37.0 37.0 37.0 37.0 37.0 3 35.8465 37.0 37.0 37.0 37.0 37.0 4 35.839 37.0 37.0 37.0 37.0 37.0 5 35.982 37.0 37.0 37.0 37.0 37.0 6 35.7105 37.0 37.0 37.0 37.0 37.0 7 35.8905 37.0 37.0 37.0 37.0 37.0 8 35.872 37.0 37.0 37.0 37.0 37.0 9 35.8755 37.0 37.0 37.0 37.0 37.0 10-14 35.790099999999995 37.0 37.0 37.0 37.0 37.0 15-19 35.828700000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.6828 37.0 37.0 37.0 37.0 37.0 25-29 35.644 37.0 37.0 37.0 37.0 37.0 30-34 35.6341 37.0 37.0 37.0 37.0 37.0 35-39 35.5195 37.0 37.0 37.0 37.0 37.0 40-44 35.5149 37.0 37.0 37.0 37.0 37.0 45-49 35.4589 37.0 37.0 37.0 37.0 37.0 50-54 35.463300000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.3858 37.0 37.0 37.0 37.0 37.0 60-64 35.2162 37.0 37.0 37.0 27.4 37.0 65-69 35.1646 37.0 37.0 37.0 29.8 37.0 70-74 35.1459 37.0 37.0 37.0 25.0 37.0 75-79 35.1759 37.0 37.0 37.0 29.8 37.0 80-84 35.1005 37.0 37.0 37.0 25.0 37.0 85-89 35.0055 37.0 37.0 37.0 25.0 37.0 90-94 34.9026 37.0 37.0 37.0 25.0 37.0 95-99 34.8224 37.0 37.0 37.0 25.0 37.0 100-104 34.795100000000005 37.0 37.0 37.0 25.0 37.0 105-109 34.6439 37.0 37.0 37.0 25.0 37.0 110-114 34.53340000000001 37.0 37.0 37.0 25.0 37.0 115-119 34.434599999999996 37.0 37.0 37.0 25.0 37.0 120-124 34.4434 37.0 37.0 37.0 25.0 37.0 125-129 34.3701 37.0 37.0 37.0 25.0 37.0 130-134 34.2933 37.0 37.0 37.0 25.0 37.0 135-139 34.0807 37.0 37.0 37.0 25.0 37.0 140-144 33.880599999999994 37.0 37.0 37.0 25.0 37.0 145-149 33.874399999999994 37.0 37.0 37.0 25.0 37.0 150-151 33.174499999999995 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 7.0 14 6.0 15 8.0 16 3.0 17 2.0 18 1.0 19 3.0 20 3.0 21 13.0 22 12.0 23 9.0 24 10.0 25 12.0 26 12.0 27 32.0 28 36.0 29 42.0 30 62.0 31 79.0 32 117.0 33 206.0 34 380.0 35 992.0 36 1903.0 37 50.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.5 12.0 14.6 36.9 2 32.324999999999996 17.599999999999998 29.525000000000002 20.549999999999997 3 26.400000000000002 21.25 27.725 24.625 4 28.499999999999996 29.575000000000003 17.325 24.6 5 29.5 31.324999999999996 17.1 22.075 6 23.225 33.925 18.725 24.125 7 22.125 15.75 35.225 26.900000000000002 8 22.825 22.025 20.95 34.2 9 25.124999999999996 21.925 23.175 29.775000000000002 10-14 26.8 25.285000000000004 21.945 25.97 15-19 26.87 24.45 22.785 25.895000000000003 20-24 26.5 24.65 23.169999999999998 25.679999999999996 25-29 26.68 24.505 22.625 26.19 30-34 27.125 24.15 23.52 25.205 35-39 27.169999999999998 24.65 22.855 25.324999999999996 40-44 27.015 24.884999999999998 22.675 25.424999999999997 45-49 26.505000000000003 23.875 23.47 26.150000000000002 50-54 26.235000000000003 24.709999999999997 23.165 25.89 55-59 27.155 23.555 23.919999999999998 25.369999999999997 60-64 27.279999999999998 24.13 23.044999999999998 25.545 65-69 26.525 24.27 23.66 25.545 70-74 26.445 24.19 23.400000000000002 25.965 75-79 26.895000000000003 23.745 23.830000000000002 25.53 80-84 27.250000000000004 24.08 23.79 24.88 85-89 27.355 24.0 23.419999999999998 25.224999999999998 90-94 27.034999999999997 24.165 23.345 25.455 95-99 26.895000000000003 24.5 23.755000000000003 24.85 100-104 27.35 24.27 22.919999999999998 25.46 105-109 27.310000000000002 24.19 23.085 25.415 110-114 27.405 25.21 22.53 24.855 115-119 26.625 24.740000000000002 23.29 25.345000000000002 120-124 26.884999999999998 24.38 23.215 25.52 125-129 27.07 24.575 23.200000000000003 25.155 130-134 27.425 24.83 23.26 24.485 135-139 27.18 25.019999999999996 23.265 24.535 140-144 27.834999999999997 24.485 23.355 24.325 145-149 27.735 24.905 23.145 24.215 150-151 26.700000000000003 24.462500000000002 23.7375 25.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.0 13 1.0 14 1.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 2.0 26 1.5 27 1.0 28 4.0 29 3.0 30 6.5 31 13.5 32 12.0 33 13.0 34 21.5 35 31.5 36 37.0 37 48.0 38 67.5 39 83.5 40 92.0 41 105.5 42 117.5 43 134.0 44 158.5 45 168.0 46 164.5 47 155.0 48 142.5 49 138.0 50 140.5 51 127.0 52 117.0 53 110.0 54 114.5 55 113.5 56 96.5 57 93.5 58 84.0 59 82.0 60 85.0 61 86.0 62 91.0 63 91.5 64 85.0 65 83.0 66 86.5 67 83.0 68 81.0 69 77.0 70 59.5 71 52.0 72 53.5 73 40.0 74 29.5 75 29.0 76 20.5 77 12.5 78 13.0 79 10.0 80 4.0 81 3.5 82 3.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 1.0 94 0.5 95 1.0 96 1.0 97 0.0 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.90361763929232 89.85 2 4.673884341167151 8.85 3 0.36968576709796674 1.05 4 0.026406126221283337 0.1 5 0.0 0.0 6 0.026406126221283337 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.30000000000000004 0.0 0.0 0.0 0.0 118-119 0.3375 0.0 0.0 0.0 0.0 120-121 0.44999999999999996 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.7749999999999999 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 0.9874999999999999 0.0 0.0 0.0 0.0 132-133 1.0750000000000002 0.0 0.0 0.0 0.0 134-135 1.1625 0.0 0.0 0.0 0.0 136-137 1.3624999999999998 0.0 0.0 0.0 0.0 138-139 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGGTG 10 0.006830828 145.0 2 GGCTTCA 10 0.006830828 145.0 8 >>END_MODULE Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700649 spots for SRR7804228.sra Written 1700649 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra Read 1700647 spots for SRR7804228.sra Written 1700647 spots for SRR7804228.sra SRR ids: ['SRR7804228.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d04j4tsz SRR7804228.sra spots: 34012942 blocks: [[1, 1700647], [1700648, 3401294], [3401295, 5101941], [5101942, 6802588], [6802589, 8503235], [8503236, 10203882], [10203883, 11904529], [11904530, 13605176], [13605177, 15305823], [15305824, 17006470], [17006471, 18707117], [18707118, 20407764], [20407765, 22108411], [22108412, 23809058], [23809059, 25509705], [25509706, 27210352], [27210353, 28910999], [28911000, 30611646], [30611647, 32312293], [32312294, 34012942]] SRR7804228 file size 11504169 SRR7804228 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804228 SRR7804228_1.fastq SRR7804228_2.fastq Input file: SRR7804228_1.fastq Paired file: SRR7804228_2.fastq trimmed: SRR7804228-trimmed-pair1.fastq, SRR7804228-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:37:47 2024 >> started Sat Dec 7 18:38:33 2024 >> done (45.494s) 34012942 read pairs processed; of these: 92 ( 0.00%) short read pairs filtered out after trimming by size control 1424 ( 0.00%) empty read pairs filtered out after trimming by size control 34011426 (100.00%) read pairs available; of these: 811416 ( 2.39%) trimmed read pairs available after processing 33200010 (97.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 15 0.00% 20 19 0.00% 21 16 0.00% 22 23 0.00% 23 22 0.00% 24 35 0.00% 25 25 0.00% 26 31 0.00% 27 39 0.00% 28 39 0.00% 29 41 0.00% 30 48 0.00% 31 41 0.00% 32 49 0.00% 33 57 0.00% 34 62 0.00% 35 56 0.00% 36 54 0.00% 37 59 0.00% 38 56 0.00% 39 48 0.00% 40 58 0.00% 41 53 0.00% 42 65 0.00% 43 69 0.00% 44 66 0.00% 45 76 0.00% 46 74 0.00% 47 78 0.00% 48 76 0.00% 49 78 0.00% 50 87 0.00% 51 59 0.00% 52 86 0.00% 53 89 0.00% 54 86 0.00% 55 105 0.00% 56 89 0.00% 57 99 0.00% 58 104 0.00% 59 113 0.00% 60 97 0.00% 61 105 0.00% 62 116 0.00% 63 114 0.00% 64 121 0.00% 65 114 0.00% 66 137 0.00% 67 116 0.00% 68 143 0.00% 69 145 0.00% 70 167 0.00% 71 191 0.00% 72 189 0.00% 73 211 0.00% 74 185 0.00% 75 234 0.00% 76 261 0.00% 77 300 0.00% 78 288 0.00% 79 357 0.00% 80 348 0.00% 81 411 0.00% 82 485 0.00% 83 487 0.00% 84 508 0.00% 85 655 0.00% 86 683 0.00% 87 736 0.00% 88 822 0.00% 89 839 0.00% 90 1020 0.00% 91 1174 0.00% 92 1263 0.00% 93 1404 0.00% 94 1534 0.00% 95 1774 0.01% 96 1908 0.01% 97 2094 0.01% 98 2294 0.01% 99 2425 0.01% 100 2668 0.01% 101 2809 0.01% 102 3155 0.01% 103 3517 0.01% 104 3714 0.01% 105 4053 0.01% 106 4345 0.01% 107 4615 0.01% 108 4965 0.01% 109 5154 0.02% 110 5396 0.02% 111 5930 0.02% 112 6521 0.02% 113 7048 0.02% 114 7349 0.02% 115 7751 0.02% 116 8367 0.02% 117 8691 0.03% 118 9349 0.03% 119 9627 0.03% 120 10106 0.03% 121 10782 0.03% 122 11542 0.03% 123 12170 0.04% 124 12655 0.04% 125 13546 0.04% 126 14205 0.04% 127 14565 0.04% 128 15106 0.04% 129 16056 0.05% 130 16600 0.05% 131 17317 0.05% 132 18061 0.05% 133 19110 0.06% 134 20423 0.06% 135 20886 0.06% 136 22127 0.07% 137 22835 0.07% 138 22810 0.07% 139 24134 0.07% 140 24924 0.07% 141 25799 0.08% 142 27035 0.08% 143 27914 0.08% 144 29085 0.09% 145 30340 0.09% 146 31037 0.09% 147 32410 0.10% 148 33774 0.10% 149 33985 0.10% 150 36136 0.11% 151 33200010 97.61% 34011426 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=32 prefix-density=0.36 prefix-fanout=2.1 sequence=GGGTACTCCTTCTTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=54.51 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=6.9 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=29 prefix-density=0.48 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=85.47 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=6.1 sequence=GTGAAGAAGGTGGAGAACAAGGTGTGAGCAAGTGTAAGG SRR7804228 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:40:23 Started mapping on | Dec 07 18:40:23 Finished on | Dec 07 18:47:09 Mapping speed, Million of reads per hour | 301.58 Number of input reads | 34011426 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 30994298 Uniquely mapped reads % | 91.13% Average mapped length | 299.90 Number of splices: Total | 31768893 Number of splices: Annotated (sjdb) | 29680880 Number of splices: GT/AG | 31336924 Number of splices: GC/AG | 370356 Number of splices: AT/AC | 14342 Number of splices: Non-canonical | 47271 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 2.73 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 558919 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 49728 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.83% % of reads unmapped: other | 1.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2458209 2458209 2458209 N_multimapping 558919 558919 558919 N_noFeature 1385743 29831235 1837340 N_ambiguous 882077 7022 170990 UnstrandedReadsAssigned:28726478 PositiveStrandReadsAssigned:1156041 NegativeStrandReadsAssigned:28985968 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804228 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804228-trimmed-pair1.fastq SRR7804228-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,011,426 reads, 29,467,957 reads pseudoaligned [quant] estimated average fragment length: 334.394 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR7804228.ke.tsv 35125 SRR7804228.se.tsv 88098 total ==> SRR7804228.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 603.966 68.457 4.67148 PNS24247 1044 710.606 79.9705 4.63821 PNS24249 1928 1594.61 248.21 6.41527 PNS24246 1044 710.606 79.9705 4.63821 PNS24248 1044 710.606 79.9705 4.63821 PNS24244 1471 1137.61 110.422 4.00048 PNS24243 293 71.3443 0 0 KQK14069 1603 1269.61 573.202 18.6075 KQK14071 474 189.789 9.04166 1.96348 ==> SRR7804228.se.tsv <== BRADI_1g14170v3 617 BRADI_1g53295v3 2537 BRADI_1g59795v3 1169 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 838 BRADI_1g74790v3 966 BRADI_1g09890v3 0 BRADI_1g77505v3 470 BRADI_1g48960v3 0 SRR7804228 completed mapping pipeline successfully