Starting /dee2/code/volunteer_pipeline.sh SRR7804229 current disk space = 1540514516992 free memory = 1411698864 SRR7804229 SRAfilesize 5a9af4304cc2b48da42304e9f88f8be8 SRR7804229.sra SRR7804229.sra file validated SRR7804229 is paired end SRR7804229 is conventional basespace SRR7804229 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804229_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.098 37.0 37.0 37.0 37.0 37.0 2 36.142 37.0 37.0 37.0 37.0 37.0 3 36.365 37.0 37.0 37.0 37.0 37.0 4 36.4615 37.0 37.0 37.0 37.0 37.0 5 36.4525 37.0 37.0 37.0 37.0 37.0 6 36.5175 37.0 37.0 37.0 37.0 37.0 7 36.243 37.0 37.0 37.0 37.0 37.0 8 36.47 37.0 37.0 37.0 37.0 37.0 9 36.4425 37.0 37.0 37.0 37.0 37.0 10-14 36.4771 37.0 37.0 37.0 37.0 37.0 15-19 36.426500000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4568 37.0 37.0 37.0 37.0 37.0 25-29 36.3613 37.0 37.0 37.0 37.0 37.0 30-34 36.3804 37.0 37.0 37.0 37.0 37.0 35-39 36.3482 37.0 37.0 37.0 37.0 37.0 40-44 36.2804 37.0 37.0 37.0 37.0 37.0 45-49 36.19070000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.197 37.0 37.0 37.0 37.0 37.0 55-59 36.151 37.0 37.0 37.0 37.0 37.0 60-64 36.1648 37.0 37.0 37.0 37.0 37.0 65-69 36.1499 37.0 37.0 37.0 37.0 37.0 70-74 35.9907 37.0 37.0 37.0 37.0 37.0 75-79 36.0116 37.0 37.0 37.0 37.0 37.0 80-84 35.9849 37.0 37.0 37.0 37.0 37.0 85-89 35.898900000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.8792 37.0 37.0 37.0 37.0 37.0 95-99 35.7517 37.0 37.0 37.0 37.0 37.0 100-104 35.6849 37.0 37.0 37.0 37.0 37.0 105-109 35.6606 37.0 37.0 37.0 37.0 37.0 110-114 35.7519 37.0 37.0 37.0 37.0 37.0 115-119 35.571999999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.4883 37.0 37.0 37.0 37.0 37.0 125-129 35.490300000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.3021 37.0 37.0 37.0 32.2 37.0 135-139 35.2518 37.0 37.0 37.0 32.2 37.0 140-144 35.282799999999995 37.0 37.0 37.0 32.2 37.0 145-149 35.0644 37.0 37.0 37.0 25.0 37.0 150-151 34.560249999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 0.0 24 4.0 25 2.0 26 6.0 27 13.0 28 21.0 29 32.0 30 50.0 31 61.0 32 78.0 33 103.0 34 186.0 35 492.0 36 2725.0 37 224.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.39136979427998 12.393376818866031 10.737581535373808 36.47767185148018 2 24.8 16.5 33.800000000000004 24.9 3 22.775000000000002 22.8 24.3 30.125 4 27.05 28.999999999999996 19.35 24.6 5 25.5 31.2 23.0 20.3 6 21.825 30.8 23.275000000000002 24.099999999999998 7 17.05 19.45 42.0 21.5 8 19.675 19.900000000000002 28.925 31.5 9 20.3 20.9 29.599999999999998 29.2 10-14 22.935 25.94 24.745 26.38 15-19 23.27 24.555 25.545 26.63 20-24 23.945 23.705000000000002 25.665 26.685 25-29 23.49 24.154999999999998 25.629999999999995 26.724999999999998 30-34 23.674999999999997 24.685000000000002 25.385 26.255 35-39 23.805 24.169999999999998 24.975 27.05 40-44 23.61 24.91 25.115 26.365 45-49 23.745 24.29 25.195 26.77 50-54 23.595 24.215 25.525 26.665 55-59 23.875 24.02 24.8 27.305 60-64 23.585 24.335 24.93 27.150000000000002 65-69 23.59 24.59 25.055 26.765 70-74 24.205 24.21 24.93 26.655 75-79 23.375 24.245 25.435000000000002 26.945000000000004 80-84 23.845 23.915 25.105 27.134999999999998 85-89 24.41 24.4 24.355 26.834999999999997 90-94 24.310000000000002 24.62 24.455 26.615 95-99 24.065 24.235 24.735 26.965 100-104 24.240000000000002 24.04 25.195 26.525 105-109 24.525 23.875 25.155 26.445 110-114 24.385 23.835 24.675 27.105 115-119 24.18 23.755000000000003 25.105 26.96 120-124 24.215 23.625 25.130000000000003 27.029999999999998 125-129 23.635 24.415 24.65 27.3 130-134 24.88 23.69 24.755 26.674999999999997 135-139 24.654999999999998 23.875 25.0 26.47 140-144 24.695 24.11 24.4 26.795 145-149 24.465 23.435 24.87 27.229999999999997 150-151 24.925 23.7875 24.3875 26.900000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.5 16 2.0 17 1.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 3.0 25 2.5 26 2.0 27 3.5 28 3.0 29 4.5 30 9.5 31 13.0 32 11.0 33 15.0 34 22.5 35 28.0 36 39.5 37 57.5 38 79.5 39 88.0 40 107.5 41 126.0 42 136.5 43 163.5 44 168.0 45 161.5 46 168.0 47 170.0 48 163.0 49 170.0 50 162.0 51 135.5 52 130.0 53 138.0 54 142.0 55 141.5 56 137.5 57 119.0 58 99.5 59 97.0 60 90.5 61 73.5 62 61.5 63 56.0 64 55.5 65 51.5 66 45.5 67 48.5 68 46.5 69 44.0 70 40.5 71 33.0 72 28.0 73 21.0 74 21.0 75 21.5 76 15.0 77 6.5 78 4.5 79 4.5 80 3.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.525 #Duplication Level Percentage of deduplicated Percentage of total 1 94.78973816450674 89.60000000000001 2 4.760645331922772 9.0 3 0.3173763554615181 0.8999999999999999 4 0.13224014810896587 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.325 0.0 0.0 0.0 0.0 126-127 0.375 0.0 0.0 0.0 0.0 128-129 0.44999999999999996 0.0 0.0 0.0 0.0 130-131 0.5375 0.0 0.0 0.0 0.0 132-133 0.6 0.0 0.0 0.0 0.0 134-135 0.65 0.0 0.0 0.0 0.0 136-137 0.775 0.0 0.0 0.0 0.0 138-139 0.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGCTG 10 0.006830828 145.0 2 >>END_MODULE SRR7804229 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804229_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.232 37.0 37.0 37.0 37.0 37.0 2 35.9165 37.0 37.0 37.0 37.0 37.0 3 36.037 37.0 37.0 37.0 37.0 37.0 4 36.0995 37.0 37.0 37.0 37.0 37.0 5 36.199 37.0 37.0 37.0 37.0 37.0 6 35.958 37.0 37.0 37.0 37.0 37.0 7 35.988 37.0 37.0 37.0 37.0 37.0 8 36.17 37.0 37.0 37.0 37.0 37.0 9 36.1385 37.0 37.0 37.0 37.0 37.0 10-14 36.0529 37.0 37.0 37.0 37.0 37.0 15-19 35.9837 37.0 37.0 37.0 37.0 37.0 20-24 35.936099999999996 37.0 37.0 37.0 37.0 37.0 25-29 35.86 37.0 37.0 37.0 37.0 37.0 30-34 35.830200000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.7519 37.0 37.0 37.0 37.0 37.0 40-44 35.8 37.0 37.0 37.0 37.0 37.0 45-49 35.689499999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.668 37.0 37.0 37.0 37.0 37.0 55-59 35.6041 37.0 37.0 37.0 37.0 37.0 60-64 35.499700000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.474000000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.417699999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.395300000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.312900000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.278499999999994 37.0 37.0 37.0 34.6 37.0 90-94 35.1249 37.0 37.0 37.0 25.0 37.0 95-99 35.1038 37.0 37.0 37.0 25.0 37.0 100-104 35.0466 37.0 37.0 37.0 25.0 37.0 105-109 34.978500000000004 37.0 37.0 37.0 25.0 37.0 110-114 34.834799999999994 37.0 37.0 37.0 25.0 37.0 115-119 34.8284 37.0 37.0 37.0 25.0 37.0 120-124 34.763600000000004 37.0 37.0 37.0 25.0 37.0 125-129 34.742 37.0 37.0 37.0 25.0 37.0 130-134 34.5798 37.0 37.0 37.0 25.0 37.0 135-139 34.3863 37.0 37.0 37.0 25.0 37.0 140-144 34.2744 37.0 37.0 37.0 25.0 37.0 145-149 34.169500000000006 37.0 37.0 37.0 25.0 37.0 150-151 33.41475 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 4.0 15 6.0 16 8.0 17 0.0 18 0.0 19 1.0 20 3.0 21 3.0 22 5.0 23 7.0 24 7.0 25 10.0 26 16.0 27 23.0 28 31.0 29 35.0 30 53.0 31 66.0 32 98.0 33 204.0 34 340.0 35 845.0 36 2159.0 37 73.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.4 14.75 12.3 33.550000000000004 2 29.65 20.525 27.075 22.75 3 25.224999999999998 23.875 26.0 24.9 4 26.950000000000003 32.225 17.575 23.25 5 28.65 32.324999999999996 17.7 21.325 6 22.400000000000002 35.449999999999996 18.475 23.674999999999997 7 22.45 15.675 35.675000000000004 26.200000000000003 8 23.35 20.9 21.9 33.85 9 24.825 21.25 24.95 28.975 10-14 26.61 25.324999999999996 22.24 25.825 15-19 26.5 25.174999999999997 22.935 25.39 20-24 26.740000000000002 24.545 22.34 26.375 25-29 26.815 24.77 22.795 25.619999999999997 30-34 27.534999999999997 25.245 22.09 25.130000000000003 35-39 26.76 25.56 22.845 24.834999999999997 40-44 27.115000000000002 24.52 23.035 25.330000000000002 45-49 27.465 24.62 22.485 25.430000000000003 50-54 26.955000000000002 24.19 22.830000000000002 26.025 55-59 27.655 24.335 23.14 24.87 60-64 27.24 25.14 22.31 25.31 65-69 27.495000000000005 24.625 22.925 24.955 70-74 27.355 24.025 23.355 25.264999999999997 75-79 27.105 23.835 23.61 25.45 80-84 27.195000000000004 25.130000000000003 22.71 24.965 85-89 27.455000000000002 24.610000000000003 22.805 25.130000000000003 90-94 27.26 24.945 22.985 24.81 95-99 26.75 24.415 23.745 25.09 100-104 27.305 25.105 22.134999999999998 25.455 105-109 27.405 25.290000000000003 22.439999999999998 24.865000000000002 110-114 27.105 25.09 22.435 25.369999999999997 115-119 27.32 24.77 22.45 25.46 120-124 26.965 24.955 22.67 25.41 125-129 27.384999999999998 24.825 22.650000000000002 25.14 130-134 28.110000000000003 24.695 22.939999999999998 24.255 135-139 27.21 24.865000000000002 23.25 24.675 140-144 27.810000000000002 24.79 23.235 24.165 145-149 27.42 25.419999999999998 22.89 24.27 150-151 27.8625 24.9875 22.7625 24.3875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 1.5 26 1.5 27 2.0 28 3.5 29 2.5 30 5.5 31 11.5 32 11.0 33 13.5 34 23.5 35 32.5 36 35.0 37 44.0 38 58.5 39 73.0 40 82.5 41 105.0 42 123.5 43 141.0 44 143.5 45 127.5 46 141.0 47 153.5 48 153.5 49 145.0 50 133.5 51 132.0 52 128.0 53 126.0 54 134.0 55 135.0 56 130.5 57 122.0 58 115.5 59 117.5 60 110.5 61 102.0 62 101.5 63 86.5 64 67.5 65 72.5 66 70.0 67 60.0 68 60.0 69 52.5 70 50.0 71 52.0 72 50.0 73 40.5 74 28.5 75 25.5 76 19.5 77 10.5 78 8.0 79 5.5 80 2.5 81 1.5 82 1.0 83 1.0 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.425 #Duplication Level Percentage of deduplicated Percentage of total 1 94.40727856569441 88.2 2 4.87021675140487 9.1 3 0.42815092320042814 1.2 4 0.10703773080010703 0.4 5 0.05351886540005352 0.25 6 0.08027829810008028 0.44999999999999996 7 0.0 0.0 8 0.05351886540005352 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGG 8 0.2 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 8 0.2 No Hit GCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGGAACG 6 0.15 No Hit CGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGGAACGCGGACACAGGT 6 0.15 No Hit CTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATG 6 0.15 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit GCAAAAGCCACAAGCCAAGAACCAACCAATACTTGCTCATCCGTTCGTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.32499999999999996 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.375 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.425 0.0 0.0 0.0 0.0 128-129 0.5 0.0 0.0 0.0 0.0 130-131 0.5875 0.0 0.0 0.0 0.0 132-133 0.65 0.0 0.0 0.0 0.0 134-135 0.7 0.0 0.0 0.0 0.0 136-137 0.825 0.0 0.0 0.0 0.0 138-139 0.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655917 spots for SRR7804229.sra Written 1655917 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra Read 1655902 spots for SRR7804229.sra Written 1655902 spots for SRR7804229.sra SRR ids: ['SRR7804229.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r3k71wy9 SRR7804229.sra spots: 33118055 blocks: [[1, 1655902], [1655903, 3311804], [3311805, 4967706], [4967707, 6623608], [6623609, 8279510], [8279511, 9935412], [9935413, 11591314], [11591315, 13247216], [13247217, 14903118], [14903119, 16559020], [16559021, 18214922], [18214923, 19870824], [19870825, 21526726], [21526727, 23182628], [23182629, 24838530], [24838531, 26494432], [26494433, 28150334], [28150335, 29806236], [29806237, 31462138], [31462139, 33118055]] SRR7804229 file size 11200921 SRR7804229 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804229 SRR7804229_1.fastq SRR7804229_2.fastq Input file: SRR7804229_1.fastq Paired file: SRR7804229_2.fastq trimmed: SRR7804229-trimmed-pair1.fastq, SRR7804229-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:38:41 2024 >> started Sat Dec 7 18:39:36 2024 >> done (54.809s) 33118055 read pairs processed; of these: 115 ( 0.00%) short read pairs filtered out after trimming by size control 723 ( 0.00%) empty read pairs filtered out after trimming by size control 33117217 (100.00%) read pairs available; of these: 617412 ( 1.86%) trimmed read pairs available after processing 32499805 (98.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 24 0.00% 20 20 0.00% 21 37 0.00% 22 34 0.00% 23 34 0.00% 24 56 0.00% 25 54 0.00% 26 42 0.00% 27 68 0.00% 28 90 0.00% 29 60 0.00% 30 80 0.00% 31 95 0.00% 32 129 0.00% 33 100 0.00% 34 80 0.00% 35 106 0.00% 36 92 0.00% 37 120 0.00% 38 131 0.00% 39 138 0.00% 40 111 0.00% 41 106 0.00% 42 111 0.00% 43 139 0.00% 44 112 0.00% 45 137 0.00% 46 183 0.00% 47 133 0.00% 48 142 0.00% 49 138 0.00% 50 167 0.00% 51 136 0.00% 52 169 0.00% 53 175 0.00% 54 171 0.00% 55 215 0.00% 56 182 0.00% 57 201 0.00% 58 165 0.00% 59 208 0.00% 60 233 0.00% 61 206 0.00% 62 215 0.00% 63 191 0.00% 64 207 0.00% 65 212 0.00% 66 221 0.00% 67 227 0.00% 68 257 0.00% 69 214 0.00% 70 253 0.00% 71 296 0.00% 72 278 0.00% 73 317 0.00% 74 289 0.00% 75 280 0.00% 76 352 0.00% 77 329 0.00% 78 353 0.00% 79 463 0.00% 80 424 0.00% 81 388 0.00% 82 451 0.00% 83 508 0.00% 84 496 0.00% 85 601 0.00% 86 626 0.00% 87 649 0.00% 88 742 0.00% 89 737 0.00% 90 816 0.00% 91 889 0.00% 92 995 0.00% 93 1084 0.00% 94 1268 0.00% 95 1361 0.00% 96 1390 0.00% 97 1616 0.00% 98 1707 0.01% 99 1901 0.01% 100 1959 0.01% 101 2072 0.01% 102 2316 0.01% 103 2447 0.01% 104 2709 0.01% 105 3024 0.01% 106 3264 0.01% 107 3418 0.01% 108 3642 0.01% 109 3947 0.01% 110 4079 0.01% 111 4441 0.01% 112 4720 0.01% 113 5051 0.02% 114 5409 0.02% 115 5795 0.02% 116 6209 0.02% 117 6495 0.02% 118 6798 0.02% 119 7073 0.02% 120 7632 0.02% 121 7900 0.02% 122 8353 0.03% 123 8925 0.03% 124 9431 0.03% 125 10028 0.03% 126 10583 0.03% 127 10774 0.03% 128 11331 0.03% 129 11681 0.04% 130 12189 0.04% 131 12600 0.04% 132 13629 0.04% 133 14003 0.04% 134 14800 0.04% 135 15654 0.05% 136 16506 0.05% 137 17099 0.05% 138 17723 0.05% 139 18213 0.05% 140 18782 0.06% 141 19369 0.06% 142 20239 0.06% 143 21508 0.06% 144 22229 0.07% 145 23670 0.07% 146 23857 0.07% 147 24883 0.08% 148 25773 0.08% 149 26349 0.08% 150 28088 0.08% 151 32499805 98.14% 33117217 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=31 prefix-density=0.36 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=140.66 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=6.4 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=15 prefix-density=0.47 prefix-fanout=3.0 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.14 sequence-density-rank=15 fanout-score=110.33 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=20.7 sequence=CGCCGCCGCCGTCG SRR7804229 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:40:57 Started mapping on | Dec 07 18:40:57 Finished on | Dec 07 18:45:23 Mapping speed, Million of reads per hour | 448.20 Number of input reads | 33117217 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 29239959 Uniquely mapped reads % | 88.29% Average mapped length | 300.19 Number of splices: Total | 27245695 Number of splices: Annotated (sjdb) | 25582775 Number of splices: GT/AG | 26884863 Number of splices: GC/AG | 311031 Number of splices: AT/AC | 10415 Number of splices: Non-canonical | 39386 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2213524 % of reads mapped to multiple loci | 6.68% Number of reads mapped to too many loci | 16382 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.62% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1663734 1663734 1663734 N_multimapping 2213524 2213524 2213524 N_noFeature 2959102 28392866 3199935 N_ambiguous 729499 15779 120573 UnstrandedReadsAssigned:25551358 PositiveStrandReadsAssigned:831314 NegativeStrandReadsAssigned:25919451 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804229 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804229-trimmed-pair1.fastq SRR7804229-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,117,217 reads, 27,322,888 reads pseudoaligned [quant] estimated average fragment length: 347.393 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR7804229.ke.tsv 35125 SRR7804229.se.tsv 88098 total ==> SRR7804229.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 591.104 0 0 PNS24247 1044 697.607 76.2086 4.41036 PNS24249 1928 1581.61 169.232 4.31981 PNS24246 1044 697.607 76.2086 4.41036 PNS24248 1044 697.607 76.2086 4.41036 PNS24244 1471 1124.61 138.142 4.95914 PNS24243 293 68.7776 0 0 KQK14069 1603 1256.61 625.762 20.1044 KQK14071 474 182.768 6.83185 1.50911 ==> SRR7804229.se.tsv <== BRADI_1g14170v3 670 BRADI_1g53295v3 19 BRADI_1g59795v3 508 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 416 BRADI_1g74790v3 2156 BRADI_1g09890v3 0 BRADI_1g77505v3 157 BRADI_1g48960v3 0 SRR7804229 completed mapping pipeline successfully