Starting /dee2/code/volunteer_pipeline.sh SRR7804230 current disk space = 1540503969792 free memory = 1445424180 SRR7804230 SRAfilesize f9a2f39349004a6f09f5924345639e38 SRR7804230.sra SRR7804230.sra file validated SRR7804230 is paired end SRR7804230 is conventional basespace SRR7804230 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804230_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.12325 37.0 37.0 37.0 37.0 37.0 2 36.244 37.0 37.0 37.0 37.0 37.0 3 36.326 37.0 37.0 37.0 37.0 37.0 4 36.3495 37.0 37.0 37.0 37.0 37.0 5 36.4565 37.0 37.0 37.0 37.0 37.0 6 36.476 37.0 37.0 37.0 37.0 37.0 7 36.2845 37.0 37.0 37.0 37.0 37.0 8 36.3945 37.0 37.0 37.0 37.0 37.0 9 36.412 37.0 37.0 37.0 37.0 37.0 10-14 36.4276 37.0 37.0 37.0 37.0 37.0 15-19 36.425599999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4157 37.0 37.0 37.0 37.0 37.0 25-29 36.353300000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.305899999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.299499999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.2892 37.0 37.0 37.0 37.0 37.0 45-49 36.1931 37.0 37.0 37.0 37.0 37.0 50-54 36.2054 37.0 37.0 37.0 37.0 37.0 55-59 36.138999999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.1365 37.0 37.0 37.0 37.0 37.0 65-69 36.0882 37.0 37.0 37.0 37.0 37.0 70-74 35.9782 37.0 37.0 37.0 37.0 37.0 75-79 36.057 37.0 37.0 37.0 37.0 37.0 80-84 36.0354 37.0 37.0 37.0 37.0 37.0 85-89 35.950300000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.861799999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.7937 37.0 37.0 37.0 37.0 37.0 100-104 35.76370000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.7028 37.0 37.0 37.0 37.0 37.0 110-114 35.793600000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6014 37.0 37.0 37.0 37.0 37.0 120-124 35.51519999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.568 37.0 37.0 37.0 37.0 37.0 130-134 35.356300000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.2213 37.0 37.0 37.0 29.8 37.0 140-144 35.2758 37.0 37.0 37.0 29.8 37.0 145-149 35.01369999999999 37.0 37.0 37.0 25.0 37.0 150-151 34.4275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 9.0 26 10.0 27 14.0 28 18.0 29 38.0 30 35.0 31 63.0 32 86.0 33 98.0 34 192.0 35 472.0 36 2725.0 37 237.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.017055430147984 12.39026837220968 11.136192626034612 40.45648357160773 2 25.224999999999998 18.025 34.475 22.275 3 23.75 24.325 23.7 28.225 4 25.324999999999996 32.1 17.675 24.9 5 26.05 32.775 21.025 20.150000000000002 6 21.5 32.925 21.575 24.0 7 15.4 20.724999999999998 43.075 20.8 8 22.025 20.05 26.125 31.8 9 21.45 19.7 30.525000000000002 28.325 10-14 23.185 26.450000000000003 24.955 25.41 15-19 23.48 25.28 25.619999999999997 25.619999999999997 20-24 23.315 25.71 24.975 26.0 25-29 23.335 25.45 25.085 26.13 30-34 23.225 25.25 25.319999999999997 26.205000000000002 35-39 23.35 25.480000000000004 24.945 26.224999999999998 40-44 23.625 25.385 24.33 26.66 45-49 24.279999999999998 24.825 24.985 25.91 50-54 24.025 24.945 25.28 25.75 55-59 23.855 25.285000000000004 23.94 26.919999999999998 60-64 23.965 24.555 24.775 26.705000000000002 65-69 23.695 25.705 24.44 26.16 70-74 23.56 25.295 24.66 26.484999999999996 75-79 23.72 24.89 24.665 26.724999999999998 80-84 24.185000000000002 24.884999999999998 24.335 26.595000000000002 85-89 24.175 24.725 24.560000000000002 26.540000000000003 90-94 23.945 25.040000000000003 24.735 26.279999999999998 95-99 24.095 24.685000000000002 24.709999999999997 26.51 100-104 24.169999999999998 25.180000000000003 24.39 26.26 105-109 24.54 24.445 24.605 26.41 110-114 24.27 24.15 24.79 26.790000000000003 115-119 24.37 24.855 23.86 26.915 120-124 25.124999999999996 24.375 23.785 26.715 125-129 25.074999999999996 24.905 23.56 26.46 130-134 24.57 24.37 24.490000000000002 26.57 135-139 24.675 24.385 24.09 26.85 140-144 25.230000000000004 24.46 23.79 26.52 145-149 24.755 24.55 24.21 26.484999999999996 150-151 25.275 24.0375 24.0625 26.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 3.0 28 3.0 29 4.5 30 8.0 31 10.5 32 17.0 33 23.5 34 24.0 35 33.5 36 47.0 37 56.5 38 74.0 39 92.5 40 109.5 41 118.0 42 140.0 43 171.5 44 175.5 45 194.5 46 210.5 47 199.5 48 186.0 49 183.5 50 182.5 51 159.0 52 139.5 53 125.5 54 113.5 55 104.0 56 99.0 57 87.5 58 78.0 59 78.5 60 65.5 61 54.0 62 56.5 63 63.0 64 68.5 65 66.0 66 58.0 67 56.5 68 50.0 69 37.5 70 28.5 71 26.5 72 29.5 73 26.0 74 18.5 75 12.5 76 9.0 77 7.0 78 4.0 79 2.0 80 1.0 81 1.5 82 1.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.825 #Duplication Level Percentage of deduplicated Percentage of total 1 95.98225932689799 91.975 2 3.7046699713018523 7.1 3 0.2869814766501435 0.8250000000000001 4 0.026089225150013044 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.775 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.2999999999999998 0.0 0.0 0.0 0.0 136-137 1.3875000000000002 0.0 0.0 0.0 0.0 138-139 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGGAA 10 0.006830828 145.0 5 >>END_MODULE SRR7804230 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804230_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.151 37.0 37.0 37.0 37.0 37.0 2 35.753 37.0 37.0 37.0 37.0 37.0 3 36.017 37.0 37.0 37.0 37.0 37.0 4 36.1125 37.0 37.0 37.0 37.0 37.0 5 36.1745 37.0 37.0 37.0 37.0 37.0 6 35.9585 37.0 37.0 37.0 37.0 37.0 7 36.0205 37.0 37.0 37.0 37.0 37.0 8 36.192 37.0 37.0 37.0 37.0 37.0 9 36.0685 37.0 37.0 37.0 37.0 37.0 10-14 36.049 37.0 37.0 37.0 37.0 37.0 15-19 36.006299999999996 37.0 37.0 37.0 37.0 37.0 20-24 35.9654 37.0 37.0 37.0 37.0 37.0 25-29 35.8915 37.0 37.0 37.0 37.0 37.0 30-34 35.88629999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.7837 37.0 37.0 37.0 37.0 37.0 40-44 35.7334 37.0 37.0 37.0 37.0 37.0 45-49 35.706599999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.623599999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.6104 37.0 37.0 37.0 37.0 37.0 60-64 35.506899999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.4745 37.0 37.0 37.0 37.0 37.0 70-74 35.3829 37.0 37.0 37.0 37.0 37.0 75-79 35.4333 37.0 37.0 37.0 37.0 37.0 80-84 35.31609999999999 37.0 37.0 37.0 34.6 37.0 85-89 35.30499999999999 37.0 37.0 37.0 34.6 37.0 90-94 35.246399999999994 37.0 37.0 37.0 32.2 37.0 95-99 35.083600000000004 37.0 37.0 37.0 25.0 37.0 100-104 35.093599999999995 37.0 37.0 37.0 25.0 37.0 105-109 35.1134 37.0 37.0 37.0 25.0 37.0 110-114 34.9393 37.0 37.0 37.0 25.0 37.0 115-119 34.8101 37.0 37.0 37.0 25.0 37.0 120-124 34.78660000000001 37.0 37.0 37.0 25.0 37.0 125-129 34.696799999999996 37.0 37.0 37.0 25.0 37.0 130-134 34.6549 37.0 37.0 37.0 25.0 37.0 135-139 34.3501 37.0 37.0 37.0 25.0 37.0 140-144 34.1976 37.0 37.0 37.0 25.0 37.0 145-149 34.0678 37.0 37.0 37.0 25.0 37.0 150-151 33.542 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 4.0 15 1.0 16 4.0 17 3.0 18 1.0 19 2.0 20 3.0 21 5.0 22 6.0 23 11.0 24 6.0 25 10.0 26 14.0 27 21.0 28 22.0 29 40.0 30 49.0 31 70.0 32 117.0 33 179.0 34 338.0 35 910.0 36 2109.0 37 72.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.699999999999996 11.35 13.975000000000001 38.975 2 29.549999999999997 17.325 29.9 23.225 3 24.8 21.55 27.750000000000004 25.900000000000002 4 28.075 29.575000000000003 16.35 26.0 5 28.475 31.8 17.825 21.9 6 21.775 32.525 20.349999999999998 25.35 7 20.875 14.025000000000002 37.15 27.950000000000003 8 23.875 19.15 22.45 34.525 9 24.65 19.400000000000002 24.4 31.55 10-14 25.595000000000002 24.865000000000002 22.314999999999998 27.224999999999998 15-19 26.935 23.93 22.52 26.615 20-24 25.705 24.55 22.985 26.76 25-29 26.965 23.544999999999998 22.895 26.595000000000002 30-34 26.345000000000002 23.669999999999998 23.09 26.895000000000003 35-39 26.185000000000002 23.925 23.169999999999998 26.72 40-44 26.5 24.01 23.125 26.365 45-49 26.640000000000004 23.82 23.035 26.505000000000003 50-54 26.25 23.945 23.78 26.025 55-59 26.33 24.205 23.115 26.35 60-64 26.995 23.905 23.49 25.61 65-69 26.77 24.34 23.369999999999997 25.52 70-74 27.365000000000002 24.08 22.99 25.564999999999998 75-79 26.965 23.69 24.125 25.22 80-84 27.61 24.145 23.11 25.135 85-89 27.35 23.400000000000002 23.57 25.679999999999996 90-94 26.974999999999998 23.845 23.25 25.929999999999996 95-99 27.495000000000005 24.13 22.795 25.580000000000002 100-104 27.43 23.95 23.135 25.485000000000003 105-109 26.919999999999998 23.89 23.3 25.89 110-114 27.33 24.545 23.24 24.884999999999998 115-119 27.125 24.91 23.025000000000002 24.94 120-124 26.935 24.45 23.505000000000003 25.11 125-129 27.655 24.099999999999998 22.994999999999997 25.25 130-134 27.51 24.12 23.46 24.91 135-139 26.875 24.955 23.415 24.755 140-144 26.784999999999997 24.495 23.66 25.06 145-149 26.889999999999997 24.515 23.200000000000003 25.395 150-151 27.6375 24.375 23.5125 24.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 1.0 9 1.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 0.5 26 1.0 27 1.5 28 1.0 29 0.5 30 2.5 31 8.5 32 12.0 33 11.0 34 13.5 35 19.5 36 27.0 37 37.5 38 49.5 39 75.0 40 88.5 41 93.0 42 109.5 43 126.0 44 147.5 45 154.5 46 159.0 47 165.5 48 154.0 49 148.0 50 153.0 51 150.5 52 140.0 53 136.5 54 123.0 55 99.5 56 94.5 57 103.0 58 108.0 59 104.5 60 94.5 61 76.5 62 80.0 63 94.0 64 92.5 65 95.0 66 88.5 67 80.5 68 79.0 69 72.0 70 60.5 71 51.5 72 44.0 73 34.0 74 28.5 75 21.5 76 19.5 77 17.5 78 13.0 79 10.0 80 5.0 81 1.5 82 2.0 83 2.5 84 1.0 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.64075630252101 91.05 2 3.91281512605042 7.449999999999999 3 0.34138655462184875 0.975 4 0.052521008403361345 0.2 5 0.0 0.0 6 0.026260504201680673 0.15 7 0.026260504201680673 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 7 0.17500000000000002 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.775 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.3624999999999998 0.0 0.0 0.0 0.0 138-139 1.4500000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCAGC 10 0.006830828 145.0 1 CCTCCTC 10 0.006830828 145.0 7 >>END_MODULE Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572329 spots for SRR7804230.sra Written 1572329 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra Read 1572324 spots for SRR7804230.sra Written 1572324 spots for SRR7804230.sra SRR ids: ['SRR7804230.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d15ib1mw SRR7804230.sra spots: 31446485 blocks: [[1, 1572324], [1572325, 3144648], [3144649, 4716972], [4716973, 6289296], [6289297, 7861620], [7861621, 9433944], [9433945, 11006268], [11006269, 12578592], [12578593, 14150916], [14150917, 15723240], [15723241, 17295564], [17295565, 18867888], [18867889, 20440212], [20440213, 22012536], [22012537, 23584860], [23584861, 25157184], [25157185, 26729508], [26729509, 28301832], [28301833, 29874156], [29874157, 31446485]] SRR7804230 file size 10634481 SRR7804230 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804230 SRR7804230_1.fastq SRR7804230_2.fastq Input file: SRR7804230_1.fastq Paired file: SRR7804230_2.fastq trimmed: SRR7804230-trimmed-pair1.fastq, SRR7804230-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:40:47 2024 >> started Sat Dec 7 18:41:34 2024 >> done (46.615s) 31446485 read pairs processed; of these: 78 ( 0.00%) short read pairs filtered out after trimming by size control 892 ( 0.00%) empty read pairs filtered out after trimming by size control 31445515 (100.00%) read pairs available; of these: 709787 ( 2.26%) trimmed read pairs available after processing 30735728 (97.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 13 0.00% 20 12 0.00% 21 16 0.00% 22 14 0.00% 23 23 0.00% 24 25 0.00% 25 42 0.00% 26 34 0.00% 27 33 0.00% 28 52 0.00% 29 45 0.00% 30 45 0.00% 31 56 0.00% 32 58 0.00% 33 45 0.00% 34 43 0.00% 35 61 0.00% 36 62 0.00% 37 65 0.00% 38 78 0.00% 39 72 0.00% 40 52 0.00% 41 57 0.00% 42 83 0.00% 43 82 0.00% 44 63 0.00% 45 62 0.00% 46 94 0.00% 47 88 0.00% 48 98 0.00% 49 104 0.00% 50 79 0.00% 51 69 0.00% 52 94 0.00% 53 82 0.00% 54 130 0.00% 55 106 0.00% 56 128 0.00% 57 128 0.00% 58 92 0.00% 59 112 0.00% 60 135 0.00% 61 133 0.00% 62 134 0.00% 63 132 0.00% 64 147 0.00% 65 148 0.00% 66 135 0.00% 67 163 0.00% 68 164 0.00% 69 156 0.00% 70 204 0.00% 71 217 0.00% 72 206 0.00% 73 262 0.00% 74 224 0.00% 75 249 0.00% 76 281 0.00% 77 302 0.00% 78 323 0.00% 79 369 0.00% 80 311 0.00% 81 405 0.00% 82 451 0.00% 83 487 0.00% 84 560 0.00% 85 615 0.00% 86 677 0.00% 87 748 0.00% 88 755 0.00% 89 854 0.00% 90 936 0.00% 91 1121 0.00% 92 1207 0.00% 93 1402 0.00% 94 1470 0.00% 95 1629 0.01% 96 1760 0.01% 97 1853 0.01% 98 2096 0.01% 99 2218 0.01% 100 2298 0.01% 101 2701 0.01% 102 3004 0.01% 103 3042 0.01% 104 3448 0.01% 105 3714 0.01% 106 3958 0.01% 107 4048 0.01% 108 4321 0.01% 109 4649 0.01% 110 4949 0.02% 111 5210 0.02% 112 5772 0.02% 113 6257 0.02% 114 6444 0.02% 115 7001 0.02% 116 7354 0.02% 117 7683 0.02% 118 7975 0.03% 119 8466 0.03% 120 8803 0.03% 121 9500 0.03% 122 9921 0.03% 123 10542 0.03% 124 11337 0.04% 125 11842 0.04% 126 12421 0.04% 127 12805 0.04% 128 13551 0.04% 129 13957 0.04% 130 14521 0.05% 131 14858 0.05% 132 15490 0.05% 133 16524 0.05% 134 17403 0.06% 135 18079 0.06% 136 19112 0.06% 137 19701 0.06% 138 20539 0.07% 139 20759 0.07% 140 21329 0.07% 141 22066 0.07% 142 23111 0.07% 143 23791 0.08% 144 25086 0.08% 145 26214 0.08% 146 27307 0.09% 147 28118 0.09% 148 29475 0.09% 149 29753 0.09% 150 31223 0.10% 151 30735728 97.74% 31445515 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=30 prefix-density=0.31 prefix-fanout=3.1 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=103.39 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=16.9 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=26 prefix-density=0.84 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=769.97 fanout-score-rank=1 prefix-density=1.12 prefix-fanout=20.5 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804230 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:42:40 Started mapping on | Dec 07 18:42:40 Finished on | Dec 07 18:49:32 Mapping speed, Million of reads per hour | 274.77 Number of input reads | 31445515 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 28699343 Uniquely mapped reads % | 91.27% Average mapped length | 300.05 Number of splices: Total | 28437456 Number of splices: Annotated (sjdb) | 26635028 Number of splices: GT/AG | 28060216 Number of splices: GC/AG | 316001 Number of splices: AT/AC | 19699 Number of splices: Non-canonical | 41540 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 2.84 Insertion rate per base | 0.01% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404290 % of reads mapped to multiple loci | 1.29% Number of reads mapped to too many loci | 62048 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.62% % of reads unmapped: other | 1.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2341882 2341882 2341882 N_multimapping 404290 404290 404290 N_noFeature 723566 27897779 1019622 N_ambiguous 608831 5258 106951 UnstrandedReadsAssigned:27366946 PositiveStrandReadsAssigned:796306 NegativeStrandReadsAssigned:27572770 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804230 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804230-trimmed-pair1.fastq SRR7804230-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,445,515 reads, 27,981,480 reads pseudoaligned [quant] estimated average fragment length: 332.099 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 SRR7804230.ke.tsv 35125 SRR7804230.se.tsv 88098 total ==> SRR7804230.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 606.095 0 0 PNS24247 1044 712.901 110.74 6.90832 PNS24249 1928 1596.9 265.177 7.38507 PNS24246 1044 712.901 110.74 6.90832 PNS24248 1044 712.901 110.74 6.90832 PNS24244 1471 1139.9 161.603 6.30489 PNS24243 293 70.0251 0 0 KQK14069 1603 1271.9 16682.7 583.323 KQK14071 474 188.513 111.418 26.2853 ==> SRR7804230.se.tsv <== BRADI_1g14170v3 17320 BRADI_1g53295v3 193 BRADI_1g59795v3 509 BRADI_1g07683v3 0 BRADI_1g00485v3 35 BRADI_1g20270v3 1517 BRADI_1g74790v3 226 BRADI_1g09890v3 0 BRADI_1g77505v3 461 BRADI_1g48960v3 0 SRR7804230 completed mapping pipeline successfully