Starting /dee2/code/volunteer_pipeline.sh SRR7804231 current disk space = 1540533547008 free memory = 1601906576 SRR7804231 SRAfilesize ee070d48d2f9cb304ec702d9ff3dc7ac SRR7804231.sra SRR7804231.sra file validated SRR7804231 is paired end SRR7804231 is conventional basespace SRR7804231 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804231_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1995 37.0 37.0 37.0 37.0 37.0 2 36.281 37.0 37.0 37.0 37.0 37.0 3 36.384 37.0 37.0 37.0 37.0 37.0 4 36.5575 37.0 37.0 37.0 37.0 37.0 5 36.5065 37.0 37.0 37.0 37.0 37.0 6 36.522 37.0 37.0 37.0 37.0 37.0 7 36.4275 37.0 37.0 37.0 37.0 37.0 8 36.5715 37.0 37.0 37.0 37.0 37.0 9 36.445 37.0 37.0 37.0 37.0 37.0 10-14 36.482499999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.496500000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.4848 37.0 37.0 37.0 37.0 37.0 25-29 36.3833 37.0 37.0 37.0 37.0 37.0 30-34 36.3463 37.0 37.0 37.0 37.0 37.0 35-39 36.3667 37.0 37.0 37.0 37.0 37.0 40-44 36.3433 37.0 37.0 37.0 37.0 37.0 45-49 36.271300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.298 37.0 37.0 37.0 37.0 37.0 55-59 36.2183 37.0 37.0 37.0 37.0 37.0 60-64 36.1749 37.0 37.0 37.0 37.0 37.0 65-69 36.2153 37.0 37.0 37.0 37.0 37.0 70-74 36.09740000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.1555 37.0 37.0 37.0 37.0 37.0 80-84 36.1276 37.0 37.0 37.0 37.0 37.0 85-89 36.0158 37.0 37.0 37.0 37.0 37.0 90-94 36.0008 37.0 37.0 37.0 37.0 37.0 95-99 35.9058 37.0 37.0 37.0 37.0 37.0 100-104 35.873 37.0 37.0 37.0 37.0 37.0 105-109 35.8488 37.0 37.0 37.0 37.0 37.0 110-114 35.8643 37.0 37.0 37.0 37.0 37.0 115-119 35.727599999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.575900000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.5655 37.0 37.0 37.0 37.0 37.0 130-134 35.4813 37.0 37.0 37.0 37.0 37.0 135-139 35.4092 37.0 37.0 37.0 32.2 37.0 140-144 35.38869999999999 37.0 37.0 37.0 34.6 37.0 145-149 35.2073 37.0 37.0 37.0 29.8 37.0 150-151 34.676500000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 3.0 24 5.0 25 1.0 26 9.0 27 18.0 28 12.0 29 30.0 30 33.0 31 51.0 32 67.0 33 77.0 34 184.0 35 422.0 36 2845.0 37 241.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.94182547642929 14.292878635907725 10.406218655967905 36.35907723169509 2 24.85 20.200000000000003 33.550000000000004 21.4 3 21.9 26.325 22.875 28.9 4 25.275 34.849999999999994 17.8 22.075 5 26.950000000000003 33.550000000000004 20.8 18.7 6 20.474999999999998 32.925 24.224999999999998 22.375 7 15.275 20.849999999999998 42.35 21.525 8 21.025 20.724999999999998 26.1 32.15 9 20.5 18.9 30.175 30.425 10-14 23.06 27.395000000000003 24.345 25.2 15-19 23.5 26.14 24.740000000000002 25.619999999999997 20-24 22.8 26.52 24.945 25.735000000000003 25-29 22.855 25.85 25.155 26.14 30-34 22.900000000000002 26.125 24.72 26.255 35-39 22.89 25.855 24.990000000000002 26.265 40-44 23.52 25.735000000000003 25.069999999999997 25.674999999999997 45-49 22.865 25.814999999999998 25.19 26.13 50-54 23.275000000000002 25.435000000000002 25.235000000000003 26.055 55-59 23.64 26.1 24.54 25.72 60-64 23.935000000000002 25.46 24.91 25.695 65-69 23.185 25.840000000000003 24.81 26.165 70-74 23.74 25.380000000000003 24.709999999999997 26.169999999999998 75-79 23.669999999999998 25.71 24.884999999999998 25.735000000000003 80-84 24.12 25.515 24.02 26.345000000000002 85-89 23.56 25.119999999999997 25.259999999999998 26.06 90-94 24.04 25.2 24.355 26.405 95-99 24.32 24.88 25.0 25.8 100-104 23.715 24.73 24.82 26.735 105-109 24.19 25.474999999999998 24.404999999999998 25.929999999999996 110-114 24.16 25.135 24.39 26.314999999999998 115-119 24.310000000000002 24.705 24.779999999999998 26.205000000000002 120-124 24.79 25.0 24.154999999999998 26.055 125-129 24.275 24.16 24.755 26.810000000000002 130-134 24.65 24.185000000000002 25.040000000000003 26.125 135-139 25.165 24.38 24.18 26.275 140-144 24.635 24.685000000000002 24.375 26.305 145-149 25.055 24.5 24.125 26.32 150-151 25.5625 24.2625 23.5 26.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 3.0 29 5.5 30 6.0 31 9.0 32 14.0 33 24.0 34 36.5 35 37.0 36 43.0 37 59.0 38 83.5 39 99.0 40 118.5 41 158.5 42 167.5 43 193.5 44 198.0 45 189.0 46 192.0 47 180.0 48 180.5 49 183.0 50 177.0 51 151.5 52 135.0 53 131.0 54 122.0 55 109.0 56 98.0 57 77.0 58 74.0 59 84.0 60 75.0 61 65.0 62 54.0 63 47.5 64 58.0 65 52.5 66 46.5 67 46.5 68 37.5 69 32.0 70 25.5 71 24.0 72 27.5 73 20.5 74 14.0 75 10.0 76 5.0 77 6.5 78 6.0 79 2.5 80 1.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.825 #Duplication Level Percentage of deduplicated Percentage of total 1 95.82572397599792 91.825 2 3.991651447951996 7.6499999999999995 3 0.1826245760500913 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5875 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.8500000000000001 0.0 0.0 0.0 0.0 130-131 0.9624999999999999 0.0 0.0 0.0 0.0 132-133 1.0750000000000002 0.0 0.0 0.0 0.0 134-135 1.1625 0.0 0.0 0.0 0.0 136-137 1.25 0.0 0.0 0.0 0.0 138-139 1.3250000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804231 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804231_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2935 37.0 37.0 37.0 37.0 37.0 2 35.998 37.0 37.0 37.0 37.0 37.0 3 36.101 37.0 37.0 37.0 37.0 37.0 4 36.1445 37.0 37.0 37.0 37.0 37.0 5 36.2085 37.0 37.0 37.0 37.0 37.0 6 36.17 37.0 37.0 37.0 37.0 37.0 7 36.0755 37.0 37.0 37.0 37.0 37.0 8 36.1885 37.0 37.0 37.0 37.0 37.0 9 36.223 37.0 37.0 37.0 37.0 37.0 10-14 36.1521 37.0 37.0 37.0 37.0 37.0 15-19 36.1087 37.0 37.0 37.0 37.0 37.0 20-24 36.0554 37.0 37.0 37.0 37.0 37.0 25-29 36.062400000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.0062 37.0 37.0 37.0 37.0 37.0 35-39 35.915000000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.8741 37.0 37.0 37.0 37.0 37.0 45-49 35.819100000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.7625 37.0 37.0 37.0 37.0 37.0 55-59 35.791 37.0 37.0 37.0 37.0 37.0 60-64 35.707800000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.6169 37.0 37.0 37.0 37.0 37.0 70-74 35.6434 37.0 37.0 37.0 37.0 37.0 75-79 35.5485 37.0 37.0 37.0 37.0 37.0 80-84 35.4671 37.0 37.0 37.0 37.0 37.0 85-89 35.457800000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.3389 37.0 37.0 37.0 37.0 37.0 95-99 35.251 37.0 37.0 37.0 29.8 37.0 100-104 35.210300000000004 37.0 37.0 37.0 29.8 37.0 105-109 35.183800000000005 37.0 37.0 37.0 29.8 37.0 110-114 35.068900000000006 37.0 37.0 37.0 25.0 37.0 115-119 34.972699999999996 37.0 37.0 37.0 25.0 37.0 120-124 34.92250000000001 37.0 37.0 37.0 25.0 37.0 125-129 34.8183 37.0 37.0 37.0 25.0 37.0 130-134 34.74300000000001 37.0 37.0 37.0 25.0 37.0 135-139 34.597899999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.370599999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.3375 37.0 37.0 37.0 25.0 37.0 150-151 33.63575 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 5.0 15 3.0 16 3.0 17 3.0 18 1.0 19 2.0 20 1.0 21 4.0 22 9.0 23 8.0 24 6.0 25 10.0 26 14.0 27 10.0 28 27.0 29 35.0 30 37.0 31 52.0 32 96.0 33 169.0 34 294.0 35 849.0 36 2277.0 37 83.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.375 12.049999999999999 12.925 34.65 2 28.65 20.200000000000003 28.275 22.875 3 24.15 22.85 27.275 25.724999999999998 4 28.925 29.875 16.975 24.224999999999998 5 28.9 30.2 19.05 21.85 6 21.175 32.6 19.45 26.775 7 21.525 14.025000000000002 37.65 26.8 8 22.475 19.075 23.575 34.875 9 24.05 21.275 24.075 30.599999999999998 10-14 26.240000000000002 25.11 21.834999999999997 26.815 15-19 26.06 24.185000000000002 22.73 27.025 20-24 26.02 24.43 22.8 26.75 25-29 26.095000000000002 24.169999999999998 23.055 26.68 30-34 26.015 24.15 23.06 26.775 35-39 26.43 24.27 22.93 26.369999999999997 40-44 26.6 24.560000000000002 23.025000000000002 25.814999999999998 45-49 26.314999999999998 24.515 22.865 26.305 50-54 27.395000000000003 24.095 22.81 25.7 55-59 26.46 24.665 23.24 25.635 60-64 27.08 24.505 23.155 25.259999999999998 65-69 26.75 25.005 23.155 25.09 70-74 26.51 24.36 23.49 25.64 75-79 26.655 24.85 23.435 25.06 80-84 26.729999999999997 24.825 23.14 25.305 85-89 26.314999999999998 25.05 23.515 25.119999999999997 90-94 26.575 24.975 23.16 25.290000000000003 95-99 27.29 24.305 22.905 25.5 100-104 26.565 24.58 23.685000000000002 25.169999999999998 105-109 26.255 24.51 23.735 25.5 110-114 26.865 25.240000000000002 22.845 25.05 115-119 26.66 24.41 23.849999999999998 25.080000000000002 120-124 26.889999999999997 24.365000000000002 23.84 24.905 125-129 26.945000000000004 25.259999999999998 23.175 24.62 130-134 27.115000000000002 24.310000000000002 23.669999999999998 24.905 135-139 27.445000000000004 24.48 23.785 24.29 140-144 27.495000000000005 25.165 23.055 24.285 145-149 26.634999999999998 25.025 23.880000000000003 24.46 150-151 27.0625 24.6875 23.6375 24.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.5 13 1.0 14 1.0 15 1.0 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 1.5 25 0.5 26 0.0 27 0.0 28 2.0 29 5.5 30 5.5 31 8.0 32 13.5 33 13.0 34 12.0 35 14.0 36 24.0 37 39.0 38 52.0 39 72.0 40 96.0 41 105.5 42 115.0 43 151.5 44 167.5 45 167.5 46 175.5 47 165.0 48 151.5 49 151.0 50 155.5 51 146.0 52 133.5 53 128.0 54 117.0 55 103.5 56 92.0 57 86.0 58 89.0 59 97.5 60 93.0 61 90.5 62 86.5 63 77.5 64 79.5 65 73.5 66 73.5 67 76.0 68 74.0 69 70.5 70 68.0 71 56.0 72 44.0 73 47.0 74 40.0 75 22.5 76 15.5 77 16.5 78 11.5 79 5.5 80 2.5 81 2.0 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.65 #Duplication Level Percentage of deduplicated Percentage of total 1 95.7919498170413 91.625 2 3.9205436487192893 7.5 3 0.26136957658128596 0.75 4 0.0 0.0 5 0.026136957658128592 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5875 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.8500000000000001 0.0 0.0 0.0 0.0 130-131 0.9624999999999999 0.0 0.0 0.0 0.0 132-133 1.0499999999999998 0.0 0.0 0.0 0.0 134-135 1.1375 0.0 0.0 0.0 0.0 136-137 1.225 0.0 0.0 0.0 0.0 138-139 1.2999999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805325 spots for SRR7804231.sra Written 1805325 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra Read 1805324 spots for SRR7804231.sra Written 1805324 spots for SRR7804231.sra SRR ids: ['SRR7804231.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p4vs4l2w SRR7804231.sra spots: 36106481 blocks: [[1, 1805324], [1805325, 3610648], [3610649, 5415972], [5415973, 7221296], [7221297, 9026620], [9026621, 10831944], [10831945, 12637268], [12637269, 14442592], [14442593, 16247916], [16247917, 18053240], [18053241, 19858564], [19858565, 21663888], [21663889, 23469212], [23469213, 25274536], [25274537, 27079860], [27079861, 28885184], [28885185, 30690508], [30690509, 32495832], [32495833, 34301156], [34301157, 36106481]] SRR7804231 file size 12213601 SRR7804231 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804231 SRR7804231_1.fastq SRR7804231_2.fastq Input file: SRR7804231_1.fastq Paired file: SRR7804231_2.fastq trimmed: SRR7804231-trimmed-pair1.fastq, SRR7804231-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:41:45 2024 >> started Sat Dec 7 18:42:53 2024 >> done (68.103s) 36106481 read pairs processed; of these: 91 ( 0.00%) short read pairs filtered out after trimming by size control 743 ( 0.00%) empty read pairs filtered out after trimming by size control 36105647 (100.00%) read pairs available; of these: 611070 ( 1.69%) trimmed read pairs available after processing 35494577 (98.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 24 0.00% 20 12 0.00% 21 20 0.00% 22 27 0.00% 23 29 0.00% 24 27 0.00% 25 33 0.00% 26 37 0.00% 27 28 0.00% 28 27 0.00% 29 30 0.00% 30 31 0.00% 31 52 0.00% 32 47 0.00% 33 42 0.00% 34 49 0.00% 35 57 0.00% 36 50 0.00% 37 53 0.00% 38 78 0.00% 39 57 0.00% 40 46 0.00% 41 51 0.00% 42 67 0.00% 43 71 0.00% 44 76 0.00% 45 98 0.00% 46 92 0.00% 47 66 0.00% 48 70 0.00% 49 76 0.00% 50 86 0.00% 51 71 0.00% 52 103 0.00% 53 88 0.00% 54 92 0.00% 55 109 0.00% 56 103 0.00% 57 99 0.00% 58 103 0.00% 59 92 0.00% 60 114 0.00% 61 100 0.00% 62 110 0.00% 63 121 0.00% 64 138 0.00% 65 119 0.00% 66 119 0.00% 67 119 0.00% 68 143 0.00% 69 150 0.00% 70 174 0.00% 71 158 0.00% 72 178 0.00% 73 201 0.00% 74 199 0.00% 75 182 0.00% 76 248 0.00% 77 271 0.00% 78 245 0.00% 79 273 0.00% 80 262 0.00% 81 287 0.00% 82 351 0.00% 83 400 0.00% 84 431 0.00% 85 479 0.00% 86 522 0.00% 87 579 0.00% 88 624 0.00% 89 692 0.00% 90 700 0.00% 91 851 0.00% 92 917 0.00% 93 934 0.00% 94 1111 0.00% 95 1256 0.00% 96 1326 0.00% 97 1471 0.00% 98 1633 0.00% 99 1698 0.00% 100 1885 0.01% 101 2048 0.01% 102 2335 0.01% 103 2492 0.01% 104 2634 0.01% 105 2856 0.01% 106 3181 0.01% 107 3235 0.01% 108 3623 0.01% 109 4078 0.01% 110 4106 0.01% 111 4307 0.01% 112 4568 0.01% 113 4882 0.01% 114 5454 0.02% 115 5747 0.02% 116 5852 0.02% 117 6504 0.02% 118 6746 0.02% 119 7184 0.02% 120 7459 0.02% 121 8161 0.02% 122 8352 0.02% 123 8766 0.02% 124 9361 0.03% 125 10030 0.03% 126 10424 0.03% 127 10939 0.03% 128 11453 0.03% 129 11918 0.03% 130 12499 0.03% 131 12718 0.04% 132 13690 0.04% 133 14250 0.04% 134 14791 0.04% 135 15861 0.04% 136 16647 0.05% 137 16891 0.05% 138 17639 0.05% 139 18366 0.05% 140 18871 0.05% 141 19801 0.05% 142 20871 0.06% 143 20978 0.06% 144 22356 0.06% 145 23152 0.06% 146 24017 0.07% 147 25051 0.07% 148 25679 0.07% 149 26357 0.07% 150 27633 0.08% 151 35494577 98.31% 36105647 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=12.81 fanout-score-rank=19 prefix-density=0.37 prefix-fanout=6.9 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTTACCAGATCGCCTGTCAATCTTGGTCACCAGCTCGGCAAACTTCACGGCAATGTGGGAGGTGTGGCAGTCCAGCACTGGGGCGTAGCCGTTGCCAATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCAGCCTCCTTGGCAGGGTCATCCTTGGAGTTGGATGCAACAAACCCACGCTTGAGATCCTTCACAGCAACGTTCTTGACGTTGAAGCCAACATTGTCACCAGGAAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=347.84 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=29.0 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=31 prefix-density=0.77 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=618.98 fanout-score-rank=1 prefix-density=1.20 prefix-fanout=18.7 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804231 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:43:38 Started mapping on | Dec 07 18:43:38 Finished on | Dec 07 18:49:02 Mapping speed, Million of reads per hour | 401.17 Number of input reads | 36105647 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 33537246 Uniquely mapped reads % | 92.89% Average mapped length | 300.26 Number of splices: Total | 35954951 Number of splices: Annotated (sjdb) | 33770842 Number of splices: GT/AG | 35475833 Number of splices: GC/AG | 403880 Number of splices: AT/AC | 27828 Number of splices: Non-canonical | 47410 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.73 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 571278 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 46532 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.60% % of reads unmapped: other | 0.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1997123 1997123 1997123 N_multimapping 571278 571278 571278 N_noFeature 853307 32693229 1151611 N_ambiguous 660459 6033 117427 UnstrandedReadsAssigned:32023480 PositiveStrandReadsAssigned:837984 NegativeStrandReadsAssigned:32268208 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804231 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804231-trimmed-pair1.fastq SRR7804231-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,105,647 reads, 32,835,585 reads pseudoaligned [quant] estimated average fragment length: 344.803 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52973 SRR7804231.ke.tsv 35125 SRR7804231.se.tsv 88098 total ==> SRR7804231.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 593.848 2.10935 0.137708 PNS24247 1044 700.197 87.4601 4.84257 PNS24249 1928 1584.2 388.496 9.50744 PNS24246 1044 700.197 87.4601 4.84257 PNS24248 1044 700.197 87.4601 4.84257 PNS24244 1471 1127.2 283.014 9.73408 PNS24243 293 66.8649 0 0 KQK14069 1603 1259.2 10939.2 336.804 KQK14071 474 182.873 69.4621 14.726 ==> SRR7804231.se.tsv <== BRADI_1g14170v3 11438 BRADI_1g53295v3 214 BRADI_1g59795v3 761 BRADI_1g07683v3 0 BRADI_1g00485v3 48 BRADI_1g20270v3 3482 BRADI_1g74790v3 136 BRADI_1g09890v3 2 BRADI_1g77505v3 429 BRADI_1g48960v3 0 SRR7804231 completed mapping pipeline successfully