Starting /dee2/code/volunteer_pipeline.sh SRR7804232 current disk space = 1540464574464 free memory = 1515472292 SRR7804232 SRAfilesize 189435fbac5b6020034470bc2794b643 SRR7804232.sra SRR7804232.sra file validated SRR7804232 is paired end SRR7804232 is conventional basespace SRR7804232 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804232_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1715 37.0 37.0 37.0 37.0 37.0 2 36.202 37.0 37.0 37.0 37.0 37.0 3 36.3935 37.0 37.0 37.0 37.0 37.0 4 36.4605 37.0 37.0 37.0 37.0 37.0 5 36.6325 37.0 37.0 37.0 37.0 37.0 6 36.4335 37.0 37.0 37.0 37.0 37.0 7 36.3575 37.0 37.0 37.0 37.0 37.0 8 36.461 37.0 37.0 37.0 37.0 37.0 9 36.419 37.0 37.0 37.0 37.0 37.0 10-14 36.51989999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4797 37.0 37.0 37.0 37.0 37.0 20-24 36.447199999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.3445 37.0 37.0 37.0 37.0 37.0 30-34 36.3489 37.0 37.0 37.0 37.0 37.0 35-39 36.3009 37.0 37.0 37.0 37.0 37.0 40-44 36.3192 37.0 37.0 37.0 37.0 37.0 45-49 36.2531 37.0 37.0 37.0 37.0 37.0 50-54 36.2411 37.0 37.0 37.0 37.0 37.0 55-59 36.2128 37.0 37.0 37.0 37.0 37.0 60-64 36.2151 37.0 37.0 37.0 37.0 37.0 65-69 36.187 37.0 37.0 37.0 37.0 37.0 70-74 36.1331 37.0 37.0 37.0 37.0 37.0 75-79 36.064 37.0 37.0 37.0 37.0 37.0 80-84 36.1269 37.0 37.0 37.0 37.0 37.0 85-89 36.033500000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9216 37.0 37.0 37.0 37.0 37.0 95-99 35.852599999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.8071 37.0 37.0 37.0 37.0 37.0 105-109 35.7872 37.0 37.0 37.0 37.0 37.0 110-114 35.8117 37.0 37.0 37.0 37.0 37.0 115-119 35.70309999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.5809 37.0 37.0 37.0 37.0 37.0 125-129 35.5558 37.0 37.0 37.0 37.0 37.0 130-134 35.4507 37.0 37.0 37.0 37.0 37.0 135-139 35.375899999999994 37.0 37.0 37.0 34.6 37.0 140-144 35.295300000000005 37.0 37.0 37.0 32.2 37.0 145-149 35.1332 37.0 37.0 37.0 27.4 37.0 150-151 34.48525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 3.0 25 4.0 26 7.0 27 11.0 28 17.0 29 26.0 30 33.0 31 62.0 32 60.0 33 116.0 34 182.0 35 474.0 36 2803.0 37 201.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.28256513026052 13.076152304609218 10.395791583166334 35.245490981963925 2 24.3 18.05 33.300000000000004 24.349999999999998 3 21.125 25.45 25.85 27.575 4 25.8 31.45 20.525 22.225 5 24.875 31.775 23.625 19.725 6 22.05 31.5 24.125 22.325 7 16.725 19.425 42.325 21.525 8 19.325 21.349999999999998 27.725 31.6 9 19.575 20.175 31.674999999999997 28.575 10-14 22.720000000000002 26.284999999999997 25.505 25.490000000000002 15-19 22.38 25.595000000000002 25.765 26.26 20-24 22.895 25.52 25.69 25.895000000000003 25-29 22.96 25.735000000000003 25.615 25.69 30-34 22.994999999999997 25.44 25.53 26.035000000000004 35-39 23.375 25.224999999999998 25.485000000000003 25.915 40-44 23.275000000000002 25.840000000000003 25.335 25.55 45-49 22.925 26.33 25.240000000000002 25.505 50-54 23.34 25.185000000000002 25.75 25.724999999999998 55-59 22.825 25.525 25.82 25.83 60-64 23.395 25.39 25.03 26.185000000000002 65-69 23.435 24.895 25.41 26.26 70-74 23.025000000000002 25.865 25.035 26.075 75-79 23.11 24.98 25.240000000000002 26.669999999999998 80-84 23.36 25.16 25.365 26.115 85-89 23.095 25.595000000000002 25.005 26.305 90-94 23.23 25.215 25.34 26.215 95-99 23.74 25.330000000000002 25.814999999999998 25.115 100-104 24.01 25.455 24.695 25.840000000000003 105-109 23.355 24.95 25.545 26.150000000000002 110-114 23.799999999999997 25.040000000000003 25.2 25.96 115-119 23.674999999999997 25.180000000000003 25.28 25.865 120-124 24.005000000000003 25.06 24.685000000000002 26.25 125-129 23.485 25.180000000000003 24.585 26.75 130-134 24.325 25.14 24.815 25.72 135-139 23.669999999999998 24.435000000000002 25.295 26.6 140-144 24.169999999999998 25.15 24.38 26.3 145-149 24.15 24.275 24.97 26.605 150-151 24.3625 25.3125 24.2 26.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 2.0 25 2.5 26 2.5 27 3.0 28 6.5 29 12.0 30 12.5 31 13.0 32 18.0 33 20.5 34 30.0 35 44.0 36 63.0 37 77.0 38 95.0 39 116.0 40 129.0 41 146.5 42 161.0 43 172.5 44 170.0 45 173.0 46 189.0 47 194.5 48 192.0 49 190.0 50 166.5 51 140.0 52 135.0 53 121.0 54 118.0 55 106.0 56 94.0 57 85.0 58 69.5 59 73.0 60 64.5 61 54.0 62 49.0 63 51.0 64 46.5 65 39.0 66 38.5 67 43.5 68 46.5 69 42.5 70 37.5 71 30.0 72 27.0 73 20.0 74 14.5 75 11.5 76 9.5 77 8.0 78 5.5 79 3.5 80 1.5 81 1.0 82 1.0 83 2.0 84 2.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.8 #Duplication Level Percentage of deduplicated Percentage of total 1 95.92901878914405 91.9 2 3.7839248434238 7.249999999999999 3 0.2609603340292276 0.75 4 0.026096033402922752 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.4875 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.5375000000000001 0.0 0.0 0.0 0.0 128-129 0.5625 0.0 0.0 0.0 0.0 130-131 0.6125 0.0 0.0 0.0 0.0 132-133 0.6875 0.0 0.0 0.0 0.0 134-135 0.8 0.0 0.0 0.0 0.0 136-137 0.9125000000000001 0.0 0.0 0.0 0.0 138-139 1.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATTGC 10 0.006830828 145.0 4 GAGCTCC 10 0.006830828 145.0 9 GCCAGGT 10 0.006830828 145.0 2 CGAGCTC 10 0.006830828 145.0 8 >>END_MODULE SRR7804232 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804232_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3465 37.0 37.0 37.0 37.0 37.0 2 36.008 37.0 37.0 37.0 37.0 37.0 3 36.139 37.0 37.0 37.0 37.0 37.0 4 36.1445 37.0 37.0 37.0 37.0 37.0 5 36.2125 37.0 37.0 37.0 37.0 37.0 6 36.122 37.0 37.0 37.0 37.0 37.0 7 36.048 37.0 37.0 37.0 37.0 37.0 8 36.2705 37.0 37.0 37.0 37.0 37.0 9 36.22 37.0 37.0 37.0 37.0 37.0 10-14 36.1862 37.0 37.0 37.0 37.0 37.0 15-19 36.0918 37.0 37.0 37.0 37.0 37.0 20-24 36.0564 37.0 37.0 37.0 37.0 37.0 25-29 35.9949 37.0 37.0 37.0 37.0 37.0 30-34 36.0105 37.0 37.0 37.0 37.0 37.0 35-39 35.9442 37.0 37.0 37.0 37.0 37.0 40-44 35.9146 37.0 37.0 37.0 37.0 37.0 45-49 35.8491 37.0 37.0 37.0 37.0 37.0 50-54 35.8464 37.0 37.0 37.0 37.0 37.0 55-59 35.7367 37.0 37.0 37.0 37.0 37.0 60-64 35.658 37.0 37.0 37.0 37.0 37.0 65-69 35.6254 37.0 37.0 37.0 37.0 37.0 70-74 35.6217 37.0 37.0 37.0 37.0 37.0 75-79 35.5878 37.0 37.0 37.0 37.0 37.0 80-84 35.492000000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.436499999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.446999999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.3618 37.0 37.0 37.0 34.6 37.0 100-104 35.2805 37.0 37.0 37.0 37.0 37.0 105-109 35.231700000000004 37.0 37.0 37.0 29.8 37.0 110-114 35.1178 37.0 37.0 37.0 27.4 37.0 115-119 35.0616 37.0 37.0 37.0 25.0 37.0 120-124 34.9897 37.0 37.0 37.0 25.0 37.0 125-129 34.9003 37.0 37.0 37.0 25.0 37.0 130-134 34.8922 37.0 37.0 37.0 25.0 37.0 135-139 34.6982 37.0 37.0 37.0 25.0 37.0 140-144 34.473699999999994 37.0 37.0 37.0 25.0 37.0 145-149 34.4355 37.0 37.0 37.0 25.0 37.0 150-151 33.78075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 5.0 15 5.0 16 5.0 17 1.0 18 1.0 19 1.0 20 6.0 21 6.0 22 8.0 23 10.0 24 12.0 25 12.0 26 13.0 27 10.0 28 22.0 29 20.0 30 41.0 31 59.0 32 84.0 33 140.0 34 294.0 35 748.0 36 2382.0 37 112.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.175 14.000000000000002 12.35 29.475 2 29.625 19.025 29.25 22.1 3 25.025 21.9 28.249999999999996 24.825 4 26.150000000000002 31.424999999999997 19.975 22.45 5 28.15 33.050000000000004 17.9 20.9 6 22.575 34.825 19.3 23.3 7 21.099999999999998 15.875 37.225 25.8 8 24.425 21.25 20.549999999999997 33.775 9 24.224999999999998 22.025 26.375 27.375 10-14 25.779999999999998 25.785000000000004 22.869999999999997 25.564999999999998 15-19 26.265 24.915000000000003 23.53 25.290000000000003 20-24 26.135 25.1 23.96 24.805 25-29 26.16 25.03 23.485 25.324999999999996 30-34 25.805 25.765 23.400000000000002 25.03 35-39 26.284999999999997 24.81 23.49 25.415 40-44 25.580000000000002 24.975 23.91 25.535000000000004 45-49 25.595000000000002 25.009999999999998 24.085 25.31 50-54 25.755 25.335 23.765 25.145 55-59 26.419999999999998 24.705 23.865 25.009999999999998 60-64 25.585 25.264999999999997 24.125 25.025 65-69 26.474999999999998 24.959999999999997 23.44 25.124999999999996 70-74 25.96 24.805 23.73 25.505 75-79 26.375 24.92 23.549999999999997 25.155 80-84 26.205000000000002 25.34 23.68 24.775 85-89 26.295 24.855 24.37 24.48 90-94 25.665 25.635 24.099999999999998 24.6 95-99 26.540000000000003 25.5 23.86 24.099999999999998 100-104 26.71 24.965 23.849999999999998 24.474999999999998 105-109 25.740000000000002 25.290000000000003 23.885 25.085 110-114 26.745 25.124999999999996 23.369999999999997 24.759999999999998 115-119 26.784999999999997 25.025 23.66 24.529999999999998 120-124 26.645000000000003 25.495 23.369999999999997 24.490000000000002 125-129 26.355 25.779999999999998 23.265 24.6 130-134 26.155 25.745 23.845 24.255 135-139 26.424999999999997 25.515 24.044999999999998 24.015 140-144 26.14 25.91 23.76 24.19 145-149 25.955000000000002 25.555 24.4 24.09 150-151 25.687500000000004 26.1125 23.3 24.9 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 1.0 16 1.5 17 2.0 18 1.5 19 0.0 20 0.5 21 2.5 22 2.5 23 0.5 24 0.0 25 1.0 26 3.0 27 2.0 28 2.5 29 5.0 30 9.5 31 13.5 32 19.0 33 25.0 34 27.5 35 33.5 36 50.5 37 68.0 38 75.0 39 93.0 40 118.5 41 131.5 42 135.5 43 151.5 44 162.0 45 174.0 46 178.0 47 154.0 48 146.0 49 147.5 50 140.0 51 126.5 52 118.5 53 123.0 54 108.5 55 92.0 56 87.0 57 81.5 58 75.5 59 74.0 60 80.5 61 86.0 62 83.5 63 69.5 64 63.0 65 66.0 66 75.5 67 77.0 68 69.0 69 59.5 70 49.5 71 47.0 72 43.5 73 34.0 74 27.5 75 25.0 76 19.0 77 13.5 78 9.0 79 7.5 80 7.5 81 2.5 82 1.5 83 2.5 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.575 #Duplication Level Percentage of deduplicated Percentage of total 1 95.68401778707822 91.45 2 4.002092597436569 7.6499999999999995 3 0.31388961548522104 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.3875 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.4875 0.0 0.0 0.0 0.0 126-127 0.5125 0.0 0.0 0.0 0.0 128-129 0.5375000000000001 0.0 0.0 0.0 0.0 130-131 0.5874999999999999 0.0 0.0 0.0 0.0 132-133 0.6625000000000001 0.0 0.0 0.0 0.0 134-135 0.7749999999999999 0.0 0.0 0.0 0.0 136-137 0.8875 0.0 0.0 0.0 0.0 138-139 0.9874999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTCCT 10 0.006830828 145.0 7 >>END_MODULE Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra Read 1323614 spots for SRR7804232.sra Written 1323614 spots for SRR7804232.sra Read 1323607 spots for SRR7804232.sra Written 1323607 spots for SRR7804232.sra SRR ids: ['SRR7804232.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_whnpr9f3 SRR7804232.sra spots: 26472147 blocks: [[1, 1323607], [1323608, 2647214], [2647215, 3970821], [3970822, 5294428], [5294429, 6618035], [6618036, 7941642], [7941643, 9265249], [9265250, 10588856], [10588857, 11912463], [11912464, 13236070], [13236071, 14559677], [14559678, 15883284], [15883285, 17206891], [17206892, 18530498], [18530499, 19854105], [19854106, 21177712], [21177713, 22501319], [22501320, 23824926], [23824927, 25148533], [25148534, 26472147]] SRR7804232 file size 8948841 SRR7804232 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804232 SRR7804232_1.fastq SRR7804232_2.fastq Input file: SRR7804232_1.fastq Paired file: SRR7804232_2.fastq trimmed: SRR7804232-trimmed-pair1.fastq, SRR7804232-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:44:03 2024 >> started Sat Dec 7 18:44:44 2024 >> done (41.275s) 26472147 read pairs processed; of these: 81 ( 0.00%) short read pairs filtered out after trimming by size control 777 ( 0.00%) empty read pairs filtered out after trimming by size control 26471289 (100.00%) read pairs available; of these: 515903 ( 1.95%) trimmed read pairs available after processing 25955386 (98.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 12 0.00% 20 16 0.00% 21 12 0.00% 22 20 0.00% 23 19 0.00% 24 13 0.00% 25 28 0.00% 26 30 0.00% 27 40 0.00% 28 45 0.00% 29 54 0.00% 30 40 0.00% 31 35 0.00% 32 43 0.00% 33 41 0.00% 34 51 0.00% 35 58 0.00% 36 49 0.00% 37 62 0.00% 38 55 0.00% 39 65 0.00% 40 57 0.00% 41 71 0.00% 42 67 0.00% 43 62 0.00% 44 64 0.00% 45 80 0.00% 46 59 0.00% 47 67 0.00% 48 79 0.00% 49 75 0.00% 50 76 0.00% 51 61 0.00% 52 99 0.00% 53 91 0.00% 54 74 0.00% 55 87 0.00% 56 103 0.00% 57 100 0.00% 58 85 0.00% 59 96 0.00% 60 117 0.00% 61 111 0.00% 62 112 0.00% 63 98 0.00% 64 111 0.00% 65 107 0.00% 66 127 0.00% 67 108 0.00% 68 145 0.00% 69 143 0.00% 70 153 0.00% 71 130 0.00% 72 170 0.00% 73 178 0.00% 74 177 0.00% 75 194 0.00% 76 196 0.00% 77 210 0.00% 78 189 0.00% 79 260 0.00% 80 232 0.00% 81 277 0.00% 82 287 0.00% 83 349 0.00% 84 373 0.00% 85 334 0.00% 86 425 0.00% 87 437 0.00% 88 479 0.00% 89 522 0.00% 90 606 0.00% 91 686 0.00% 92 741 0.00% 93 840 0.00% 94 985 0.00% 95 999 0.00% 96 1148 0.00% 97 1163 0.00% 98 1360 0.01% 99 1429 0.01% 100 1527 0.01% 101 1743 0.01% 102 1960 0.01% 103 2044 0.01% 104 2325 0.01% 105 2507 0.01% 106 2646 0.01% 107 2721 0.01% 108 3037 0.01% 109 3327 0.01% 110 3394 0.01% 111 3759 0.01% 112 4028 0.02% 113 4420 0.02% 114 4582 0.02% 115 4967 0.02% 116 5153 0.02% 117 5438 0.02% 118 5707 0.02% 119 5956 0.02% 120 6429 0.02% 121 6619 0.03% 122 7182 0.03% 123 7561 0.03% 124 8055 0.03% 125 8461 0.03% 126 9019 0.03% 127 9122 0.03% 128 9437 0.04% 129 10196 0.04% 130 10342 0.04% 131 10815 0.04% 132 11549 0.04% 133 12000 0.05% 134 12771 0.05% 135 13099 0.05% 136 13961 0.05% 137 14475 0.05% 138 14676 0.06% 139 15376 0.06% 140 15846 0.06% 141 16516 0.06% 142 17177 0.06% 143 17960 0.07% 144 18681 0.07% 145 19496 0.07% 146 20581 0.08% 147 21076 0.08% 148 21621 0.08% 149 22246 0.08% 150 23264 0.09% 151 25955386 98.05% 26471289 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=10.46 fanout-score-rank=11 prefix-density=0.29 prefix-fanout=5.7 sequence=GCTTCTTTGGTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=240.86 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=16.6 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=32 prefix-density=0.37 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=207.53 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=22.7 sequence=CGCCGCCGCCGTC SRR7804232 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:45:39 Started mapping on | Dec 07 18:45:40 Finished on | Dec 07 18:50:45 Mapping speed, Million of reads per hour | 312.45 Number of input reads | 26471289 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 23329026 Uniquely mapped reads % | 88.13% Average mapped length | 300.03 Number of splices: Total | 22926121 Number of splices: Annotated (sjdb) | 21177765 Number of splices: GT/AG | 22608955 Number of splices: GC/AG | 267592 Number of splices: AT/AC | 8090 Number of splices: Non-canonical | 41484 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.75 Insertion rate per base | 0.01% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 625508 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 84726 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.02% % of reads unmapped: other | 2.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2516755 2516755 2516755 N_multimapping 625508 625508 625508 N_noFeature 1602020 22434240 2053446 N_ambiguous 573042 6008 130085 UnstrandedReadsAssigned:21153964 PositiveStrandReadsAssigned:888778 NegativeStrandReadsAssigned:21145495 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804232 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804232-trimmed-pair1.fastq SRR7804232-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,471,289 reads, 21,608,102 reads pseudoaligned [quant] estimated average fragment length: 346.858 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52973 SRR7804232.ke.tsv 35125 SRR7804232.se.tsv 88098 total ==> SRR7804232.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 591.755 0 0 PNS24247 1044 698.142 83.9155 7.49785 PNS24249 1928 1582.14 374.149 14.7516 PNS24246 1044 698.142 83.9155 7.49785 PNS24248 1044 698.142 83.9155 7.49785 PNS24244 1471 1125.14 121.104 6.71412 PNS24243 293 69.7879 0 0 KQK14069 1603 1257.14 133.102 6.60449 KQK14071 474 183.737 3.06851 1.04176 ==> SRR7804232.se.tsv <== BRADI_1g14170v3 154 BRADI_1g53295v3 2159 BRADI_1g59795v3 713 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 886 BRADI_1g74790v3 1000 BRADI_1g09890v3 0 BRADI_1g77505v3 292 BRADI_1g48960v3 0 SRR7804232 completed mapping pipeline successfully