Starting /dee2/code/volunteer_pipeline.sh SRR7804233 current disk space = 1540335087616 free memory = 1600964468 SRR7804233 SRAfilesize bd80ca79ec0be0e06d2acf86367196a8 SRR7804233.sra SRR7804233.sra file validated SRR7804233 is paired end SRR7804233 is conventional basespace SRR7804233 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804233_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0815 37.0 37.0 37.0 37.0 37.0 2 36.241 37.0 37.0 37.0 37.0 37.0 3 36.4205 37.0 37.0 37.0 37.0 37.0 4 36.4815 37.0 37.0 37.0 37.0 37.0 5 36.555 37.0 37.0 37.0 37.0 37.0 6 36.5595 37.0 37.0 37.0 37.0 37.0 7 36.301 37.0 37.0 37.0 37.0 37.0 8 36.4655 37.0 37.0 37.0 37.0 37.0 9 36.4695 37.0 37.0 37.0 37.0 37.0 10-14 36.491 37.0 37.0 37.0 37.0 37.0 15-19 36.463 37.0 37.0 37.0 37.0 37.0 20-24 36.4588 37.0 37.0 37.0 37.0 37.0 25-29 36.399499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.3852 37.0 37.0 37.0 37.0 37.0 35-39 36.324799999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3061 37.0 37.0 37.0 37.0 37.0 45-49 36.278200000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.2121 37.0 37.0 37.0 37.0 37.0 55-59 36.1835 37.0 37.0 37.0 37.0 37.0 60-64 36.1712 37.0 37.0 37.0 37.0 37.0 65-69 36.1556 37.0 37.0 37.0 37.0 37.0 70-74 36.0673 37.0 37.0 37.0 37.0 37.0 75-79 36.0804 37.0 37.0 37.0 37.0 37.0 80-84 36.0924 37.0 37.0 37.0 37.0 37.0 85-89 36.0469 37.0 37.0 37.0 37.0 37.0 90-94 35.940999999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8776 37.0 37.0 37.0 37.0 37.0 100-104 35.842200000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.7967 37.0 37.0 37.0 37.0 37.0 110-114 35.775999999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.6386 37.0 37.0 37.0 37.0 37.0 120-124 35.6409 37.0 37.0 37.0 37.0 37.0 125-129 35.614 37.0 37.0 37.0 37.0 37.0 130-134 35.4235 37.0 37.0 37.0 34.6 37.0 135-139 35.306799999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.3673 37.0 37.0 37.0 32.2 37.0 145-149 35.147 37.0 37.0 37.0 25.0 37.0 150-151 34.612 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 1.0 25 5.0 26 6.0 27 13.0 28 19.0 29 36.0 30 35.0 31 48.0 32 70.0 33 100.0 34 181.0 35 446.0 36 2815.0 37 223.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.691073219658975 12.587763289869608 11.785356068204614 36.935807422266805 2 24.625 19.025 33.525 22.825 3 20.575 25.75 24.025 29.65 4 25.525 31.674999999999997 20.3 22.5 5 25.825 30.825000000000003 22.625 20.724999999999998 6 20.075000000000003 33.15 24.325 22.45 7 15.375 19.375 42.225 23.025000000000002 8 20.175 20.200000000000003 28.299999999999997 31.324999999999996 9 20.8 20.45 30.525000000000002 28.225 10-14 22.75 26.695 24.610000000000003 25.945 15-19 23.080000000000002 24.990000000000002 25.915 26.015 20-24 22.725 25.47 25.380000000000003 26.424999999999997 25-29 23.04 25.240000000000002 25.779999999999998 25.94 30-34 23.115 24.945 26.16 25.779999999999998 35-39 23.1 25.205 25.790000000000003 25.905 40-44 23.43 25.09 25.47 26.009999999999998 45-49 23.015 25.805 25.590000000000003 25.590000000000003 50-54 23.205000000000002 25.490000000000002 25.230000000000004 26.075 55-59 22.84 25.56 25.724999999999998 25.874999999999996 60-64 22.625 25.755 25.035 26.584999999999997 65-69 22.99 26.284999999999997 24.85 25.874999999999996 70-74 23.24 26.125 24.91 25.724999999999998 75-79 23.47 25.385 25.235000000000003 25.91 80-84 23.66 25.025 25.535000000000004 25.779999999999998 85-89 23.810000000000002 24.79 25.0 26.400000000000002 90-94 23.44 25.03 25.035 26.495 95-99 23.79 25.185000000000002 25.11 25.915 100-104 24.295 24.875 24.7 26.13 105-109 23.35 25.0 25.314999999999998 26.334999999999997 110-114 23.849999999999998 24.82 25.09 26.240000000000002 115-119 24.215 25.25 24.545 25.990000000000002 120-124 24.255 24.645 25.1 26.0 125-129 23.455000000000002 25.615 25.064999999999998 25.865 130-134 23.405 25.415 24.905 26.275 135-139 24.21 24.740000000000002 24.995 26.055 140-144 24.69 24.959999999999997 24.145 26.205000000000002 145-149 24.21 24.845 24.69 26.255 150-151 25.637500000000003 24.8125 24.3625 25.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 1.0 23 1.0 24 1.0 25 0.0 26 0.0 27 1.0 28 3.5 29 6.5 30 7.0 31 12.0 32 23.5 33 31.0 34 34.0 35 40.0 36 56.0 37 78.5 38 91.5 39 104.0 40 124.0 41 148.0 42 166.0 43 185.0 44 203.0 45 197.0 46 183.5 47 184.0 48 182.0 49 163.0 50 148.5 51 147.5 52 142.5 53 130.0 54 116.0 55 92.0 56 75.5 57 70.5 58 69.5 59 70.0 60 70.5 61 63.5 62 59.0 63 51.5 64 50.0 65 56.5 66 53.5 67 52.5 68 53.5 69 43.0 70 27.0 71 25.0 72 25.0 73 20.0 74 14.0 75 9.5 76 9.0 77 8.5 78 3.5 79 3.0 80 3.0 81 1.5 82 1.0 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.22058823529412 90.64999999999999 2 4.543067226890756 8.649999999999999 3 0.21008403361344538 0.6 4 0.026260504201680673 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.2625 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.3125 0.0 0.0 0.0 0.0 124-125 0.4125 0.0 0.0 0.0 0.0 126-127 0.5625 0.0 0.0 0.0 0.0 128-129 0.6375 0.0 0.0 0.0 0.0 130-131 0.7 0.0 0.0 0.0 0.0 132-133 0.7875 0.0 0.0 0.0 0.0 134-135 0.875 0.0 0.0 0.0 0.0 136-137 0.925 0.0 0.0 0.0 0.0 138-139 1.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTTCC 10 0.006830828 145.0 4 >>END_MODULE SRR7804233 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804233_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.132 37.0 37.0 37.0 37.0 37.0 2 35.7165 37.0 37.0 37.0 37.0 37.0 3 35.902 37.0 37.0 37.0 37.0 37.0 4 36.0215 37.0 37.0 37.0 37.0 37.0 5 36.0085 37.0 37.0 37.0 37.0 37.0 6 35.8805 37.0 37.0 37.0 37.0 37.0 7 35.7755 37.0 37.0 37.0 37.0 37.0 8 36.1015 37.0 37.0 37.0 37.0 37.0 9 36.038 37.0 37.0 37.0 37.0 37.0 10-14 35.9396 37.0 37.0 37.0 37.0 37.0 15-19 35.8303 37.0 37.0 37.0 37.0 37.0 20-24 35.790499999999994 37.0 37.0 37.0 37.0 37.0 25-29 35.7628 37.0 37.0 37.0 37.0 37.0 30-34 35.7187 37.0 37.0 37.0 37.0 37.0 35-39 35.6606 37.0 37.0 37.0 37.0 37.0 40-44 35.645599999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.5853 37.0 37.0 37.0 37.0 37.0 50-54 35.5475 37.0 37.0 37.0 37.0 37.0 55-59 35.5367 37.0 37.0 37.0 37.0 37.0 60-64 35.393299999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.4257 37.0 37.0 37.0 37.0 37.0 70-74 35.2803 37.0 37.0 37.0 34.6 37.0 75-79 35.2577 37.0 37.0 37.0 34.6 37.0 80-84 35.2158 37.0 37.0 37.0 29.8 37.0 85-89 35.200900000000004 37.0 37.0 37.0 29.8 37.0 90-94 35.1233 37.0 37.0 37.0 27.4 37.0 95-99 34.9531 37.0 37.0 37.0 25.0 37.0 100-104 34.9476 37.0 37.0 37.0 25.0 37.0 105-109 34.9051 37.0 37.0 37.0 25.0 37.0 110-114 34.6844 37.0 37.0 37.0 25.0 37.0 115-119 34.6058 37.0 37.0 37.0 25.0 37.0 120-124 34.5612 37.0 37.0 37.0 25.0 37.0 125-129 34.4251 37.0 37.0 37.0 25.0 37.0 130-134 34.530499999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.2481 37.0 37.0 37.0 25.0 37.0 140-144 34.082899999999995 37.0 37.0 37.0 25.0 37.0 145-149 33.925 37.0 37.0 37.0 25.0 37.0 150-151 33.257 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 6.0 15 4.0 16 4.0 17 3.0 18 2.0 19 3.0 20 2.0 21 5.0 22 14.0 23 6.0 24 15.0 25 12.0 26 10.0 27 26.0 28 26.0 29 40.0 30 51.0 31 79.0 32 108.0 33 179.0 34 396.0 35 918.0 36 2026.0 37 59.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.5 13.075000000000001 13.875000000000002 34.55 2 31.65 18.85 29.875 19.625 3 24.55 22.925 27.125 25.4 4 27.675 30.025000000000002 18.475 23.825 5 27.625 32.95 19.275000000000002 20.150000000000002 6 22.675 34.949999999999996 18.0 24.375 7 22.15 14.000000000000002 37.375 26.474999999999998 8 23.5 19.400000000000002 22.875 34.225 9 24.9 20.525 25.55 29.025000000000002 10-14 25.91 25.650000000000002 22.745 25.695 15-19 25.69 24.535 23.974999999999998 25.8 20-24 25.745 24.615000000000002 23.66 25.979999999999997 25-29 25.480000000000004 25.130000000000003 23.435 25.955000000000002 30-34 25.86 24.46 23.845 25.835 35-39 26.0 24.555 24.04 25.405 40-44 25.945 24.81 23.895 25.35 45-49 26.455000000000002 24.6 23.735 25.21 50-54 26.029999999999998 25.019999999999996 23.095 25.855 55-59 26.35 24.445 23.98 25.224999999999998 60-64 26.035000000000004 25.224999999999998 23.635 25.105 65-69 26.415 24.185000000000002 23.674999999999997 25.724999999999998 70-74 26.415 24.55 23.685000000000002 25.35 75-79 26.015 24.54 24.18 25.264999999999997 80-84 26.355 24.77 23.78 25.095 85-89 26.224999999999998 24.745 23.68 25.35 90-94 26.674999999999997 24.759999999999998 23.595 24.97 95-99 27.04 24.935 23.66 24.365000000000002 100-104 26.5 24.915000000000003 24.060000000000002 24.525 105-109 26.805 24.495 23.674999999999997 25.025 110-114 26.064999999999998 24.959999999999997 23.715 25.259999999999998 115-119 26.634999999999998 25.074999999999996 23.3 24.990000000000002 120-124 26.085 24.845 24.18 24.89 125-129 26.619999999999997 24.84 23.845 24.695 130-134 26.555 24.495 24.09 24.86 135-139 26.66 24.779999999999998 24.709999999999997 23.849999999999998 140-144 26.6 24.965 24.215 24.22 145-149 27.529999999999998 25.095 23.925 23.45 150-151 26.937499999999996 24.0375 24.675 24.349999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 1.5 15 1.0 16 1.5 17 1.5 18 0.0 19 0.5 20 0.5 21 1.0 22 2.0 23 1.5 24 1.0 25 1.0 26 1.0 27 3.0 28 4.5 29 6.5 30 9.0 31 13.0 32 21.0 33 21.0 34 23.0 35 32.5 36 39.0 37 56.0 38 76.0 39 98.5 40 116.0 41 117.5 42 139.0 43 155.5 44 142.5 45 151.5 46 168.5 47 169.5 48 164.0 49 154.0 50 133.0 51 121.0 52 106.0 53 98.0 54 106.0 55 94.0 56 83.5 57 82.5 58 99.0 59 98.0 60 83.5 61 82.0 62 75.5 63 81.5 64 83.0 65 68.5 66 65.0 67 76.5 68 73.5 69 56.5 70 52.5 71 53.0 72 49.5 73 45.5 74 37.0 75 25.5 76 17.5 77 15.5 78 11.5 79 6.5 80 5.5 81 2.0 82 1.5 83 2.0 84 1.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 1.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.15 #Duplication Level Percentage of deduplicated Percentage of total 1 95.21807672096689 90.60000000000001 2 4.492905937992643 8.55 3 0.2627430373095113 0.75 4 0.02627430373095113 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2375 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.2875 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.5125 0.0 0.0 0.0 0.0 128-129 0.5874999999999999 0.0 0.0 0.0 0.0 130-131 0.6125 0.0 0.0 0.0 0.0 132-133 0.6875 0.0 0.0 0.0 0.0 134-135 0.775 0.0 0.0 0.0 0.0 136-137 0.825 0.0 0.0 0.0 0.0 138-139 0.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTGCT 10 0.006830828 145.0 4 >>END_MODULE Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra Read 2197737 spots for SRR7804233.sra Written 2197737 spots for SRR7804233.sra Read 2197732 spots for SRR7804233.sra Written 2197732 spots for SRR7804233.sra SRR ids: ['SRR7804233.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kcdcfx_2 SRR7804233.sra spots: 43954645 blocks: [[1, 2197732], [2197733, 4395464], [4395465, 6593196], [6593197, 8790928], [8790929, 10988660], [10988661, 13186392], [13186393, 15384124], [15384125, 17581856], [17581857, 19779588], [19779589, 21977320], [21977321, 24175052], [24175053, 26372784], [26372785, 28570516], [28570517, 30768248], [30768249, 32965980], [32965981, 35163712], [35163713, 37361444], [37361445, 39559176], [39559177, 41756908], [41756909, 43954645]] SRR7804233 file size 14873086 SRR7804233 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804233 SRR7804233_1.fastq SRR7804233_2.fastq Input file: SRR7804233_1.fastq Paired file: SRR7804233_2.fastq trimmed: SRR7804233-trimmed-pair1.fastq, SRR7804233-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:59:24 2024 >> started Sat Dec 7 19:00:26 2024 >> done (62.174s) 43954645 read pairs processed; of these: 102 ( 0.00%) short read pairs filtered out after trimming by size control 1400 ( 0.00%) empty read pairs filtered out after trimming by size control 43953143 (100.00%) read pairs available; of these: 802230 ( 1.83%) trimmed read pairs available after processing 43150913 (98.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 24 0.00% 20 25 0.00% 21 26 0.00% 22 26 0.00% 23 31 0.00% 24 39 0.00% 25 42 0.00% 26 42 0.00% 27 30 0.00% 28 54 0.00% 29 42 0.00% 30 53 0.00% 31 50 0.00% 32 56 0.00% 33 50 0.00% 34 56 0.00% 35 70 0.00% 36 71 0.00% 37 76 0.00% 38 71 0.00% 39 71 0.00% 40 70 0.00% 41 67 0.00% 42 89 0.00% 43 78 0.00% 44 84 0.00% 45 95 0.00% 46 91 0.00% 47 79 0.00% 48 91 0.00% 49 93 0.00% 50 104 0.00% 51 88 0.00% 52 109 0.00% 53 102 0.00% 54 119 0.00% 55 108 0.00% 56 108 0.00% 57 132 0.00% 58 123 0.00% 59 139 0.00% 60 134 0.00% 61 136 0.00% 62 125 0.00% 63 152 0.00% 64 141 0.00% 65 135 0.00% 66 159 0.00% 67 154 0.00% 68 159 0.00% 69 135 0.00% 70 220 0.00% 71 213 0.00% 72 207 0.00% 73 227 0.00% 74 207 0.00% 75 261 0.00% 76 255 0.00% 77 313 0.00% 78 299 0.00% 79 387 0.00% 80 384 0.00% 81 440 0.00% 82 450 0.00% 83 502 0.00% 84 530 0.00% 85 607 0.00% 86 676 0.00% 87 707 0.00% 88 798 0.00% 89 949 0.00% 90 936 0.00% 91 1138 0.00% 92 1253 0.00% 93 1363 0.00% 94 1592 0.00% 95 1722 0.00% 96 1835 0.00% 97 2035 0.00% 98 2175 0.00% 99 2370 0.01% 100 2580 0.01% 101 2754 0.01% 102 3197 0.01% 103 3413 0.01% 104 3541 0.01% 105 4056 0.01% 106 4233 0.01% 107 4524 0.01% 108 4858 0.01% 109 5206 0.01% 110 5555 0.01% 111 5899 0.01% 112 6421 0.01% 113 6716 0.02% 114 7299 0.02% 115 7647 0.02% 116 8365 0.02% 117 8329 0.02% 118 8877 0.02% 119 9605 0.02% 120 10132 0.02% 121 10622 0.02% 122 11236 0.03% 123 11827 0.03% 124 12669 0.03% 125 13324 0.03% 126 13855 0.03% 127 14432 0.03% 128 14928 0.03% 129 15953 0.04% 130 16248 0.04% 131 16775 0.04% 132 17827 0.04% 133 19049 0.04% 134 19918 0.05% 135 20534 0.05% 136 21387 0.05% 137 22685 0.05% 138 22947 0.05% 139 23721 0.05% 140 24475 0.06% 141 25543 0.06% 142 26739 0.06% 143 27203 0.06% 144 28333 0.06% 145 30229 0.07% 146 31124 0.07% 147 32373 0.07% 148 33758 0.08% 149 33957 0.08% 150 35883 0.08% 151 43150913 98.17% 43953143 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.13 fanout-score-rank=25 prefix-density=0.27 prefix-fanout=4.3 sequence=TGATGGTCTTGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=166.50 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=10.4 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGA criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=35 prefix-density=0.36 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=216.04 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=23.0 sequence=CGCCGCCGCCGTC SRR7804233 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 19:05:10 Started mapping on | Dec 07 19:05:11 Finished on | Dec 07 19:15:15 Mapping speed, Million of reads per hour | 261.97 Number of input reads | 43953143 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 40594972 Uniquely mapped reads % | 92.36% Average mapped length | 300.05 Number of splices: Total | 41491246 Number of splices: Annotated (sjdb) | 38495324 Number of splices: GT/AG | 40917427 Number of splices: GC/AG | 489015 Number of splices: AT/AC | 17084 Number of splices: Non-canonical | 67720 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 2.72 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 737823 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 84520 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.36% % of reads unmapped: other | 1.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2620348 2620348 2620348 N_multimapping 737823 737823 737823 N_noFeature 2317546 39101188 2979017 N_ambiguous 1062035 9903 230684 UnstrandedReadsAssigned:37215391 PositiveStrandReadsAssigned:1483881 NegativeStrandReadsAssigned:37385271 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804233 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804233-trimmed-pair1.fastq SRR7804233-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,953,143 reads, 37,932,720 reads pseudoaligned [quant] estimated average fragment length: 346.281 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52973 SRR7804233.ke.tsv 35125 SRR7804233.se.tsv 88098 total ==> SRR7804233.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 592.559 0.114249 0.00669933 PNS24247 1044 698.719 120.795 6.00699 PNS24249 1928 1582.72 432.263 9.48976 PNS24246 1044 698.719 120.795 6.00699 PNS24248 1044 698.719 120.795 6.00699 PNS24244 1471 1125.72 222.238 6.85961 PNS24243 293 67.865 0 0 KQK14069 1603 1257.72 279.986 7.73505 KQK14071 474 182.869 1.85789 0.353014 ==> SRR7804233.se.tsv <== BRADI_1g14170v3 324 BRADI_1g53295v3 3990 BRADI_1g59795v3 1557 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 1376 BRADI_1g74790v3 1335 BRADI_1g09890v3 0 BRADI_1g77505v3 502 BRADI_1g48960v3 0 SRR7804233 completed mapping pipeline successfully