Starting /dee2/code/volunteer_pipeline.sh SRR7804234 current disk space = 1540327972864 free memory = 1436715840 SRR7804234 SRAfilesize 26a808b4b821f909e10beac0062f9381 SRR7804234.sra SRR7804234.sra file validated SRR7804234 is paired end SRR7804234 is conventional basespace SRR7804234 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804234_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.20575 37.0 37.0 37.0 37.0 37.0 2 36.297 37.0 37.0 37.0 37.0 37.0 3 36.397 37.0 37.0 37.0 37.0 37.0 4 36.4725 37.0 37.0 37.0 37.0 37.0 5 36.6085 37.0 37.0 37.0 37.0 37.0 6 36.495 37.0 37.0 37.0 37.0 37.0 7 36.381 37.0 37.0 37.0 37.0 37.0 8 36.5095 37.0 37.0 37.0 37.0 37.0 9 36.392 37.0 37.0 37.0 37.0 37.0 10-14 36.508399999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.459999999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.4697 37.0 37.0 37.0 37.0 37.0 25-29 36.3999 37.0 37.0 37.0 37.0 37.0 30-34 36.3523 37.0 37.0 37.0 37.0 37.0 35-39 36.2957 37.0 37.0 37.0 37.0 37.0 40-44 36.29809999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.2275 37.0 37.0 37.0 37.0 37.0 50-54 36.1766 37.0 37.0 37.0 37.0 37.0 55-59 36.1438 37.0 37.0 37.0 37.0 37.0 60-64 36.101299999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.1503 37.0 37.0 37.0 37.0 37.0 70-74 36.0262 37.0 37.0 37.0 37.0 37.0 75-79 36.0164 37.0 37.0 37.0 37.0 37.0 80-84 35.9669 37.0 37.0 37.0 37.0 37.0 85-89 35.9348 37.0 37.0 37.0 37.0 37.0 90-94 35.89960000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.7944 37.0 37.0 37.0 37.0 37.0 100-104 35.7758 37.0 37.0 37.0 37.0 37.0 105-109 35.770799999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.7265 37.0 37.0 37.0 37.0 37.0 115-119 35.5627 37.0 37.0 37.0 37.0 37.0 120-124 35.5459 37.0 37.0 37.0 37.0 37.0 125-129 35.5318 37.0 37.0 37.0 37.0 37.0 130-134 35.3956 37.0 37.0 37.0 34.6 37.0 135-139 35.30479999999999 37.0 37.0 37.0 32.2 37.0 140-144 35.3341 37.0 37.0 37.0 32.2 37.0 145-149 35.0764 37.0 37.0 37.0 25.0 37.0 150-151 34.52875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 7.0 26 12.0 27 9.0 28 16.0 29 37.0 30 44.0 31 73.0 32 75.0 33 102.0 34 164.0 35 449.0 36 2774.0 37 235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.710743801652896 11.770598547458052 11.770598547458052 41.748059103431004 2 23.775 18.675 35.875 21.675 3 21.525 25.775 23.625 29.075 4 26.400000000000002 31.75 19.225 22.625 5 25.775 33.550000000000004 21.0 19.675 6 19.625 33.925 23.474999999999998 22.975 7 15.475 19.6 42.55 22.375 8 20.349999999999998 18.475 28.175 33.0 9 21.224999999999998 18.675 29.349999999999998 30.75 10-14 23.04 26.025 24.845 26.090000000000003 15-19 23.09 24.555 25.72 26.634999999999998 20-24 23.505000000000003 24.315 25.490000000000002 26.69 25-29 23.794999999999998 24.47 25.56 26.174999999999997 30-34 23.425 24.955 25.27 26.35 35-39 23.830000000000002 24.505 25.535000000000004 26.13 40-44 24.295 24.785 24.91 26.009999999999998 45-49 23.97 24.925 24.94 26.165 50-54 23.515 24.38 25.47 26.634999999999998 55-59 24.03 24.43 24.62 26.919999999999998 60-64 24.445 24.04 24.779999999999998 26.735 65-69 23.79 23.995 24.775 27.439999999999998 70-74 23.895 24.65 24.7 26.755000000000003 75-79 23.145 24.69 25.27 26.895000000000003 80-84 23.625 24.795 25.155 26.424999999999997 85-89 24.185000000000002 23.665 24.9 27.250000000000004 90-94 23.97 24.37 24.585 27.075 95-99 24.245 24.54 24.52 26.695 100-104 24.154999999999998 24.505 24.66 26.68 105-109 24.68 24.175 25.009999999999998 26.135 110-114 24.4 24.044999999999998 24.59 26.965 115-119 24.435000000000002 23.935000000000002 24.68 26.950000000000003 120-124 24.01 24.6 24.305 27.084999999999997 125-129 24.404999999999998 24.4 24.54 26.655 130-134 24.25 23.71 24.310000000000002 27.73 135-139 24.135 24.115000000000002 24.485 27.265 140-144 24.725 23.805 24.975 26.495 145-149 24.195 24.66 24.404999999999998 26.740000000000002 150-151 23.375 24.725 24.45 27.450000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 1.5 17 1.5 18 1.0 19 1.5 20 1.0 21 0.0 22 0.5 23 1.0 24 3.0 25 3.0 26 3.5 27 6.5 28 7.5 29 9.0 30 7.5 31 11.0 32 20.5 33 26.5 34 32.5 35 37.5 36 50.0 37 63.0 38 75.0 39 93.0 40 103.0 41 120.5 42 141.5 43 148.5 44 147.5 45 152.5 46 161.5 47 163.5 48 165.0 49 160.5 50 161.0 51 149.0 52 128.0 53 127.0 54 130.0 55 130.5 56 128.5 57 125.5 58 112.5 59 96.5 60 93.0 61 87.0 62 70.0 63 59.0 64 56.5 65 54.5 66 49.5 67 45.0 68 44.0 69 39.0 70 37.0 71 36.5 72 26.0 73 21.0 74 21.0 75 15.5 76 8.5 77 6.0 78 6.5 79 5.0 80 3.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.875 #Duplication Level Percentage of deduplicated Percentage of total 1 94.59387483355526 88.8 2 4.660452729693742 8.75 3 0.4793608521970706 1.35 4 0.21304926764314247 0.8 5 0.0 0.0 6 0.05326231691078562 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTGCGAACGT 6 0.15 No Hit CTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTGC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.48750000000000004 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.7625 0.0 0.0 0.0 0.0 130-131 0.8374999999999999 0.0 0.0 0.0 0.0 132-133 0.9125 0.0 0.0 0.0 0.0 134-135 1.025 0.0 0.0 0.0 0.0 136-137 1.1 0.0 0.0 0.0 0.0 138-139 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCAAGC 10 0.006830828 145.0 6 GTGCGAA 10 0.006830828 145.0 1 >>END_MODULE SRR7804234 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804234_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3995 37.0 37.0 37.0 37.0 37.0 2 36.18 37.0 37.0 37.0 37.0 37.0 3 36.1735 37.0 37.0 37.0 37.0 37.0 4 36.1975 37.0 37.0 37.0 37.0 37.0 5 36.282 37.0 37.0 37.0 37.0 37.0 6 36.218 37.0 37.0 37.0 37.0 37.0 7 36.1735 37.0 37.0 37.0 37.0 37.0 8 36.283 37.0 37.0 37.0 37.0 37.0 9 36.345 37.0 37.0 37.0 37.0 37.0 10-14 36.243700000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.161199999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.15259999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.144 37.0 37.0 37.0 37.0 37.0 30-34 36.105000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.054 37.0 37.0 37.0 37.0 37.0 40-44 36.0002 37.0 37.0 37.0 37.0 37.0 45-49 35.9011 37.0 37.0 37.0 37.0 37.0 50-54 35.9547 37.0 37.0 37.0 37.0 37.0 55-59 35.9178 37.0 37.0 37.0 37.0 37.0 60-64 35.782399999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.7542 37.0 37.0 37.0 37.0 37.0 70-74 35.722300000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.7054 37.0 37.0 37.0 37.0 37.0 80-84 35.572900000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.58540000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.5476 37.0 37.0 37.0 37.0 37.0 95-99 35.388799999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.2954 37.0 37.0 37.0 34.6 37.0 105-109 35.252300000000005 37.0 37.0 37.0 29.8 37.0 110-114 35.198100000000004 37.0 37.0 37.0 29.8 37.0 115-119 35.1201 37.0 37.0 37.0 25.0 37.0 120-124 35.0825 37.0 37.0 37.0 25.0 37.0 125-129 34.9551 37.0 37.0 37.0 25.0 37.0 130-134 34.8523 37.0 37.0 37.0 25.0 37.0 135-139 34.712900000000005 37.0 37.0 37.0 25.0 37.0 140-144 34.52139999999999 37.0 37.0 37.0 25.0 37.0 145-149 34.495400000000004 37.0 37.0 37.0 25.0 37.0 150-151 33.807500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 2.0 21 5.0 22 3.0 23 6.0 24 10.0 25 12.0 26 12.0 27 20.0 28 21.0 29 31.0 30 44.0 31 65.0 32 75.0 33 138.0 34 261.0 35 818.0 36 2382.0 37 90.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.0 12.125 13.950000000000001 37.925 2 28.15 19.325 31.424999999999997 21.099999999999998 3 24.0 22.900000000000002 27.325 25.775 4 27.500000000000004 32.375 16.125 24.0 5 28.225 33.900000000000006 17.95 19.925 6 22.95 35.275 19.55 22.225 7 20.775 15.525 37.225 26.474999999999998 8 23.549999999999997 19.275000000000002 22.75 34.425 9 25.825 20.599999999999998 24.125 29.45 10-14 26.125 25.155 22.115000000000002 26.605 15-19 26.795 25.074999999999996 22.345000000000002 25.785000000000004 20-24 26.419999999999998 24.84 23.150000000000002 25.590000000000003 25-29 26.19 24.285 23.325000000000003 26.200000000000003 30-34 27.075 25.064999999999998 22.96 24.9 35-39 26.565 25.105 22.81 25.52 40-44 26.779999999999998 24.22 23.29 25.71 45-49 27.18 24.44 22.869999999999997 25.509999999999998 50-54 26.93 25.009999999999998 23.095 24.965 55-59 26.71 24.8 23.075000000000003 25.415 60-64 26.915 24.375 22.955000000000002 25.755 65-69 26.935 24.135 23.799999999999997 25.130000000000003 70-74 27.025 24.695 22.955000000000002 25.324999999999996 75-79 26.605 24.085 23.61 25.7 80-84 27.375 24.695 22.755 25.174999999999997 85-89 27.800000000000004 24.335 22.955000000000002 24.91 90-94 27.22 24.3 23.244999999999997 25.235000000000003 95-99 28.075 24.34 22.67 24.915000000000003 100-104 27.994999999999997 24.529999999999998 23.1 24.375 105-109 27.884999999999998 24.09 22.835 25.19 110-114 26.905 25.380000000000003 22.585 25.130000000000003 115-119 27.21 24.725 22.830000000000002 25.235000000000003 120-124 27.565 24.985 22.765 24.685000000000002 125-129 27.12 24.575 23.1 25.205 130-134 27.834999999999997 25.424999999999997 22.415 24.325 135-139 27.925 25.330000000000002 22.845 23.9 140-144 27.365000000000002 25.85 22.82 23.965 145-149 27.810000000000002 24.765 22.884999999999998 24.54 150-151 26.900000000000002 24.8125 23.400000000000002 24.887500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 2.5 21 2.0 22 0.5 23 0.5 24 0.5 25 1.5 26 3.5 27 3.5 28 5.0 29 6.0 30 11.0 31 14.5 32 11.0 33 17.0 34 27.0 35 25.5 36 31.5 37 45.0 38 57.0 39 72.0 40 80.5 41 96.5 42 124.5 43 130.0 44 129.0 45 153.5 46 173.5 47 160.0 48 141.5 49 126.0 50 120.5 51 138.5 52 135.0 53 128.0 54 144.0 55 142.5 56 123.5 57 112.0 58 118.0 59 110.0 60 88.5 61 94.0 62 87.0 63 81.0 64 78.0 65 61.0 66 66.0 67 67.0 68 69.0 69 70.5 70 59.5 71 56.0 72 46.0 73 35.0 74 29.5 75 24.0 76 18.0 77 14.5 78 11.5 79 6.5 80 2.5 81 1.5 82 2.0 83 1.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.87519915029209 89.325 2 4.354753053637812 8.200000000000001 3 0.5841741901221456 1.6500000000000001 4 0.10621348911311736 0.4 5 0.05310674455655868 0.25 6 0.0 0.0 7 0.02655337227827934 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGG 7 0.17500000000000002 No Hit GCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGGAACG 5 0.125 No Hit CGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGGAACGCGGACACAGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.7375 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.8875 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.0750000000000002 0.0 0.0 0.0 0.0 138-139 1.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTTCT 10 0.006830828 145.0 4 TAGCAGA 10 0.006830828 145.0 9 AGTTCAG 10 0.006830828 145.0 5 >>END_MODULE Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310381 spots for SRR7804234.sra Written 1310381 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra Read 1310379 spots for SRR7804234.sra Written 1310379 spots for SRR7804234.sra SRR ids: ['SRR7804234.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cmz9pw1a SRR7804234.sra spots: 26207582 blocks: [[1, 1310379], [1310380, 2620758], [2620759, 3931137], [3931138, 5241516], [5241517, 6551895], [6551896, 7862274], [7862275, 9172653], [9172654, 10483032], [10483033, 11793411], [11793412, 13103790], [13103791, 14414169], [14414170, 15724548], [15724549, 17034927], [17034928, 18345306], [18345307, 19655685], [19655686, 20966064], [20966065, 22276443], [22276444, 23586822], [23586823, 24897201], [24897202, 26207582]] SRR7804234 file size 8859189 SRR7804234 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804234 SRR7804234_1.fastq SRR7804234_2.fastq Input file: SRR7804234_1.fastq Paired file: SRR7804234_2.fastq trimmed: SRR7804234-trimmed-pair1.fastq, SRR7804234-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:51:01 2024 >> started Sat Dec 7 18:51:30 2024 >> done (29.434s) 26207582 read pairs processed; of these: 77 ( 0.00%) short read pairs filtered out after trimming by size control 786 ( 0.00%) empty read pairs filtered out after trimming by size control 26206719 (100.00%) read pairs available; of these: 577047 ( 2.20%) trimmed read pairs available after processing 25629672 (97.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 4 0.00% 20 16 0.00% 21 18 0.00% 22 27 0.00% 23 26 0.00% 24 29 0.00% 25 26 0.00% 26 39 0.00% 27 42 0.00% 28 39 0.00% 29 35 0.00% 30 40 0.00% 31 46 0.00% 32 60 0.00% 33 59 0.00% 34 43 0.00% 35 68 0.00% 36 47 0.00% 37 55 0.00% 38 61 0.00% 39 71 0.00% 40 57 0.00% 41 52 0.00% 42 54 0.00% 43 54 0.00% 44 71 0.00% 45 79 0.00% 46 86 0.00% 47 79 0.00% 48 94 0.00% 49 80 0.00% 50 86 0.00% 51 92 0.00% 52 87 0.00% 53 113 0.00% 54 103 0.00% 55 96 0.00% 56 108 0.00% 57 99 0.00% 58 80 0.00% 59 106 0.00% 60 123 0.00% 61 136 0.00% 62 107 0.00% 63 131 0.00% 64 137 0.00% 65 125 0.00% 66 158 0.00% 67 147 0.00% 68 163 0.00% 69 184 0.00% 70 179 0.00% 71 204 0.00% 72 221 0.00% 73 237 0.00% 74 203 0.00% 75 249 0.00% 76 247 0.00% 77 305 0.00% 78 321 0.00% 79 355 0.00% 80 333 0.00% 81 366 0.00% 82 429 0.00% 83 495 0.00% 84 554 0.00% 85 579 0.00% 86 619 0.00% 87 662 0.00% 88 768 0.00% 89 764 0.00% 90 882 0.00% 91 962 0.00% 92 1129 0.00% 93 1132 0.00% 94 1400 0.01% 95 1510 0.01% 96 1495 0.01% 97 1758 0.01% 98 1887 0.01% 99 1954 0.01% 100 2114 0.01% 101 2293 0.01% 102 2387 0.01% 103 2652 0.01% 104 2843 0.01% 105 3242 0.01% 106 3250 0.01% 107 3559 0.01% 108 3682 0.01% 109 3946 0.02% 110 4059 0.02% 111 4521 0.02% 112 4755 0.02% 113 5124 0.02% 114 5482 0.02% 115 5872 0.02% 116 6167 0.02% 117 6375 0.02% 118 6482 0.02% 119 6960 0.03% 120 7363 0.03% 121 7771 0.03% 122 8095 0.03% 123 8570 0.03% 124 9184 0.04% 125 9632 0.04% 126 10045 0.04% 127 10242 0.04% 128 10598 0.04% 129 10869 0.04% 130 11602 0.04% 131 12106 0.05% 132 12578 0.05% 133 13229 0.05% 134 13878 0.05% 135 14566 0.06% 136 15268 0.06% 137 15883 0.06% 138 16129 0.06% 139 16892 0.06% 140 17290 0.07% 141 17755 0.07% 142 18613 0.07% 143 19346 0.07% 144 20119 0.08% 145 21236 0.08% 146 21725 0.08% 147 22381 0.09% 148 23319 0.09% 149 24034 0.09% 150 24818 0.09% 151 25629672 97.80% 26206719 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=21 prefix-density=0.56 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=161.95 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=7.1 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=17 prefix-density=0.38 prefix-fanout=2.9 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTG criterion=fanout-score sequence-density=0.16 sequence-density-rank=13 fanout-score=19.02 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=7.7 sequence=TTCTCCTCCTTC SRR7804234 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:52:49 Started mapping on | Dec 07 18:52:49 Finished on | Dec 07 18:57:35 Mapping speed, Million of reads per hour | 329.87 Number of input reads | 26206719 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 23277035 Uniquely mapped reads % | 88.82% Average mapped length | 300.20 Number of splices: Total | 21906294 Number of splices: Annotated (sjdb) | 20562192 Number of splices: GT/AG | 21613644 Number of splices: GC/AG | 253172 Number of splices: AT/AC | 8161 Number of splices: Non-canonical | 31317 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1666606 % of reads mapped to multiple loci | 6.36% Number of reads mapped to too many loci | 17072 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.32% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1263078 1263078 1263078 N_multimapping 1666606 1666606 1666606 N_noFeature 2324127 22585753 2543143 N_ambiguous 569948 12314 94883 UnstrandedReadsAssigned:20382960 PositiveStrandReadsAssigned:678968 NegativeStrandReadsAssigned:20639009 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804234 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804234-trimmed-pair1.fastq SRR7804234-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,206,719 reads, 21,529,168 reads pseudoaligned [quant] estimated average fragment length: 333.958 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52973 SRR7804234.ke.tsv 35125 SRR7804234.se.tsv 88098 total ==> SRR7804234.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 604.419 0 0 PNS24247 1044 711.042 57.6228 4.26606 PNS24249 1928 1595.04 107.451 3.54621 PNS24246 1044 711.042 57.6228 4.26606 PNS24248 1044 711.042 57.6228 4.26606 PNS24244 1471 1138.04 127.681 5.90602 PNS24243 293 69.7984 0 0 KQK14069 1603 1270.04 421.375 17.4654 KQK14071 474 187.042 2.32745 0.655041 ==> SRR7804234.se.tsv <== BRADI_1g14170v3 463 BRADI_1g53295v3 15 BRADI_1g59795v3 476 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 412 BRADI_1g74790v3 1718 BRADI_1g09890v3 0 BRADI_1g77505v3 121 BRADI_1g48960v3 0 SRR7804234 completed mapping pipeline successfully