Starting /dee2/code/volunteer_pipeline.sh SRR7804235 current disk space = 1540275482624 free memory = 1424578236 SRR7804235 SRAfilesize 3ee3040d0d285584d19013d8fd5c59ac SRR7804235.sra SRR7804235.sra file validated SRR7804235 is paired end SRR7804235 is conventional basespace SRR7804235 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804235_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.29175 37.0 37.0 37.0 37.0 37.0 2 36.306 37.0 37.0 37.0 37.0 37.0 3 36.3835 37.0 37.0 37.0 37.0 37.0 4 36.4755 37.0 37.0 37.0 37.0 37.0 5 36.506 37.0 37.0 37.0 37.0 37.0 6 36.5425 37.0 37.0 37.0 37.0 37.0 7 36.281 37.0 37.0 37.0 37.0 37.0 8 36.496 37.0 37.0 37.0 37.0 37.0 9 36.5245 37.0 37.0 37.0 37.0 37.0 10-14 36.5471 37.0 37.0 37.0 37.0 37.0 15-19 36.4824 37.0 37.0 37.0 37.0 37.0 20-24 36.511300000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.438 37.0 37.0 37.0 37.0 37.0 30-34 36.395500000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.336600000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.330799999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.300599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.281600000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.1923 37.0 37.0 37.0 37.0 37.0 60-64 36.176100000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.14489999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.070100000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.0469 37.0 37.0 37.0 37.0 37.0 80-84 36.017700000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.9711 37.0 37.0 37.0 37.0 37.0 90-94 35.9285 37.0 37.0 37.0 37.0 37.0 95-99 35.7804 37.0 37.0 37.0 37.0 37.0 100-104 35.789300000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.7662 37.0 37.0 37.0 37.0 37.0 110-114 35.7817 37.0 37.0 37.0 37.0 37.0 115-119 35.632400000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.5326 37.0 37.0 37.0 37.0 37.0 125-129 35.5501 37.0 37.0 37.0 37.0 37.0 130-134 35.409000000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.354000000000006 37.0 37.0 37.0 34.6 37.0 140-144 35.3405 37.0 37.0 37.0 32.2 37.0 145-149 35.1561 37.0 37.0 37.0 27.4 37.0 150-151 34.36825 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 0.0 24 3.0 25 6.0 26 9.0 27 17.0 28 20.0 29 21.0 30 40.0 31 50.0 32 86.0 33 83.0 34 199.0 35 433.0 36 2779.0 37 250.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.737026823765355 12.960641764853348 11.957884181499123 34.34444722988218 2 24.55 17.925 32.025 25.5 3 23.05 23.05 23.35 30.55 4 29.075 29.049999999999997 19.525000000000002 22.35 5 26.450000000000003 30.7 21.25 21.6 6 21.25 32.800000000000004 22.225 23.724999999999998 7 18.3 20.200000000000003 40.050000000000004 21.45 8 21.0 20.225 26.424999999999997 32.35 9 21.9 20.150000000000002 29.525000000000002 28.425 10-14 23.9 25.22 24.015 26.865 15-19 24.14 23.965 25.324999999999996 26.57 20-24 24.52 24.315 24.715 26.450000000000003 25-29 24.115000000000002 24.895 24.0 26.99 30-34 24.98 24.25 23.93 26.840000000000003 35-39 24.57 24.310000000000002 24.125 26.995 40-44 24.77 24.595 23.990000000000002 26.645000000000003 45-49 24.75 24.26 23.77 27.22 50-54 25.06 24.19 23.77 26.979999999999997 55-59 24.795 24.32 23.34 27.544999999999998 60-64 24.5 24.555 23.945 27.0 65-69 25.174999999999997 24.005000000000003 23.799999999999997 27.02 70-74 24.89 24.215 24.11 26.784999999999997 75-79 25.130000000000003 23.95 24.135 26.784999999999997 80-84 25.35 24.135 23.745 26.77 85-89 24.825 23.674999999999997 24.81 26.69 90-94 24.89 24.025 23.93 27.155 95-99 25.8 23.849999999999998 24.125 26.224999999999998 100-104 25.465 23.380000000000003 24.025 27.13 105-109 25.235000000000003 23.435 24.355 26.974999999999998 110-114 25.314999999999998 23.28 24.4 27.005000000000003 115-119 25.569999999999997 23.555 23.849999999999998 27.025 120-124 25.47 23.755000000000003 23.385 27.389999999999997 125-129 26.090000000000003 23.385 23.455000000000002 27.07 130-134 25.779999999999998 23.435 23.93 26.855 135-139 25.790000000000003 23.41 23.415 27.384999999999998 140-144 26.08 22.919999999999998 23.89 27.11 145-149 26.27 23.305 23.244999999999997 27.18 150-151 26.0125 22.912499999999998 23.7625 27.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 1.5 28 3.0 29 3.0 30 2.5 31 5.0 32 9.5 33 17.5 34 27.5 35 34.5 36 44.0 37 46.0 38 54.0 39 78.5 40 88.5 41 113.0 42 145.5 43 157.0 44 165.5 45 172.5 46 173.0 47 163.0 48 166.0 49 170.0 50 168.0 51 156.0 52 140.0 53 118.5 54 103.0 55 119.0 56 114.5 57 88.5 58 83.5 59 90.5 60 86.5 61 77.5 62 67.5 63 70.0 64 71.5 65 64.0 66 63.5 67 70.5 68 65.0 69 46.0 70 44.0 71 50.5 72 47.0 73 34.0 74 31.0 75 26.5 76 15.5 77 13.0 78 8.5 79 5.0 80 5.0 81 3.5 82 3.5 83 3.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.03753910323253 92.10000000000001 2 3.6757038581856096 7.049999999999999 3 0.2606882168925964 0.75 4 0.026068821689259645 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2125 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.5249999999999999 0.0 0.0 0.0 0.0 124-125 0.6 0.0 0.0 0.0 0.0 126-127 0.6625 0.0 0.0 0.0 0.0 128-129 0.7625 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 1.1124999999999998 0.0 0.0 0.0 0.0 136-137 1.35 0.0 0.0 0.0 0.0 138-139 1.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACCA 10 0.006830828 145.0 4 CGAAACG 10 0.006830828 145.0 3 >>END_MODULE SRR7804235 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804235_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2615 37.0 37.0 37.0 37.0 37.0 2 35.7975 37.0 37.0 37.0 37.0 37.0 3 35.9225 37.0 37.0 37.0 37.0 37.0 4 36.043 37.0 37.0 37.0 37.0 37.0 5 36.168 37.0 37.0 37.0 37.0 37.0 6 35.8915 37.0 37.0 37.0 37.0 37.0 7 35.798 37.0 37.0 37.0 37.0 37.0 8 35.998 37.0 37.0 37.0 37.0 37.0 9 35.945 37.0 37.0 37.0 37.0 37.0 10-14 35.870000000000005 37.0 37.0 37.0 37.0 37.0 15-19 35.741200000000006 37.0 37.0 37.0 37.0 37.0 20-24 35.805099999999996 37.0 37.0 37.0 37.0 37.0 25-29 35.7067 37.0 37.0 37.0 37.0 37.0 30-34 35.6213 37.0 37.0 37.0 37.0 37.0 35-39 35.565400000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.4615 37.0 37.0 37.0 37.0 37.0 45-49 35.4145 37.0 37.0 37.0 37.0 37.0 50-54 35.4884 37.0 37.0 37.0 37.0 37.0 55-59 35.4022 37.0 37.0 37.0 37.0 37.0 60-64 35.3333 37.0 37.0 37.0 37.0 37.0 65-69 35.3537 37.0 37.0 37.0 37.0 37.0 70-74 35.1831 37.0 37.0 37.0 34.6 37.0 75-79 35.152699999999996 37.0 37.0 37.0 32.2 37.0 80-84 35.1083 37.0 37.0 37.0 29.8 37.0 85-89 35.1079 37.0 37.0 37.0 27.4 37.0 90-94 34.9181 37.0 37.0 37.0 25.0 37.0 95-99 34.8508 37.0 37.0 37.0 25.0 37.0 100-104 34.8063 37.0 37.0 37.0 25.0 37.0 105-109 34.7625 37.0 37.0 37.0 25.0 37.0 110-114 34.6041 37.0 37.0 37.0 25.0 37.0 115-119 34.6081 37.0 37.0 37.0 25.0 37.0 120-124 34.5545 37.0 37.0 37.0 25.0 37.0 125-129 34.456100000000006 37.0 37.0 37.0 25.0 37.0 130-134 34.3532 37.0 37.0 37.0 25.0 37.0 135-139 34.1325 37.0 37.0 37.0 25.0 37.0 140-144 33.936099999999996 37.0 37.0 37.0 25.0 37.0 145-149 33.819 37.0 37.0 37.0 25.0 37.0 150-151 33.22225 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 7.0 14 11.0 15 12.0 16 8.0 17 5.0 18 4.0 19 8.0 20 9.0 21 9.0 22 7.0 23 17.0 24 14.0 25 16.0 26 13.0 27 13.0 28 26.0 29 36.0 30 49.0 31 75.0 32 92.0 33 150.0 34 314.0 35 906.0 36 2145.0 37 52.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.925 13.750000000000002 13.225000000000001 34.1 2 29.725 19.0 27.425 23.849999999999998 3 27.400000000000002 22.25 25.624999999999996 24.725 4 30.225 28.075 16.5 25.2 5 29.9 30.475 17.25 22.375 6 22.625 34.8 18.325 24.25 7 23.25 15.125 34.525 27.1 8 24.425 20.200000000000003 19.400000000000002 35.975 9 25.275 22.075 22.400000000000002 30.25 10-14 27.750000000000004 24.69 20.61 26.950000000000003 15-19 27.0 24.05 22.6 26.35 20-24 26.700000000000003 24.279999999999998 22.400000000000002 26.619999999999997 25-29 26.795 24.525 21.395 27.284999999999997 30-34 27.16 23.77 22.15 26.919999999999998 35-39 26.779999999999998 24.19 22.16 26.87 40-44 27.474999999999998 24.07 22.23 26.224999999999998 45-49 26.745 24.404999999999998 22.42 26.43 50-54 27.295 24.104999999999997 21.92 26.68 55-59 27.450000000000003 23.695 22.2 26.655 60-64 27.47 24.02 22.009999999999998 26.5 65-69 28.610000000000003 23.965 22.12 25.305 70-74 27.339999999999996 24.03 22.54 26.090000000000003 75-79 27.515 23.73 22.040000000000003 26.715 80-84 27.779999999999998 23.830000000000002 22.055 26.334999999999997 85-89 27.79 23.98 22.185 26.045 90-94 27.99 24.455 21.560000000000002 25.995 95-99 28.125 24.135 22.18 25.56 100-104 28.01 23.515 22.42 26.055 105-109 27.905 24.3 22.245 25.55 110-114 27.46 24.27 22.009999999999998 26.26 115-119 28.105000000000004 23.97 21.975 25.95 120-124 28.435 23.98 22.45 25.135 125-129 27.875 24.87 21.88 25.374999999999996 130-134 28.000000000000004 24.57 22.145 25.285000000000004 135-139 28.33 24.86 22.035 24.775 140-144 28.34 24.42 22.035 25.205 145-149 28.26 24.275 21.965 25.5 150-151 29.037499999999998 24.2 21.6625 25.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 1.5 11 1.0 12 0.5 13 0.5 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 1.0 24 1.0 25 2.0 26 2.0 27 1.0 28 2.5 29 4.0 30 2.5 31 3.5 32 7.0 33 11.0 34 12.5 35 13.5 36 19.5 37 26.0 38 43.5 39 65.5 40 69.0 41 75.0 42 104.5 43 119.5 44 124.0 45 144.5 46 156.5 47 160.0 48 174.0 49 163.0 50 142.5 51 150.0 52 138.0 53 117.5 54 119.5 55 117.0 56 113.5 57 112.5 58 107.0 59 102.0 60 96.0 61 86.0 62 87.5 63 85.0 64 80.0 65 87.5 66 95.5 67 86.0 68 74.5 69 72.5 70 73.0 71 66.0 72 47.5 73 42.5 74 39.0 75 27.5 76 18.0 77 17.0 78 13.5 79 8.5 80 6.0 81 4.5 82 4.5 83 5.0 84 2.0 85 0.5 86 1.0 87 1.0 88 0.5 89 0.5 90 1.0 91 1.0 92 1.0 93 1.5 94 1.5 95 2.0 96 2.0 97 2.0 98 2.0 99 2.0 100 8.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.1 #Duplication Level Percentage of deduplicated Percentage of total 1 95.76761303890642 91.07499999999999 2 3.8643533123028395 7.35 3 0.2891692954784437 0.8250000000000001 4 0.052576235541535225 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026288117770767613 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 22 0.5499999999999999 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2125 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.65 0.0 0.0 0.0 0.0 126-127 0.7125 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.925 0.0 0.0 0.0 0.0 132-133 1.0 0.0 0.0 0.0 0.0 134-135 1.1875 0.0 0.0 0.0 0.0 136-137 1.4125 0.0 0.0 0.0 0.0 138-139 1.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTAAAT 10 0.006830828 145.0 1 ATTAAGC 10 0.006830828 145.0 6 GATTAAG 10 0.006830828 145.0 5 AGATTAA 10 0.006830828 145.0 4 >>END_MODULE Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439451 spots for SRR7804235.sra Written 1439451 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra Read 1439446 spots for SRR7804235.sra Written 1439446 spots for SRR7804235.sra SRR ids: ['SRR7804235.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zs4mnil9 SRR7804235.sra spots: 28788925 blocks: [[1, 1439446], [1439447, 2878892], [2878893, 4318338], [4318339, 5757784], [5757785, 7197230], [7197231, 8636676], [8636677, 10076122], [10076123, 11515568], [11515569, 12955014], [12955015, 14394460], [14394461, 15833906], [15833907, 17273352], [17273353, 18712798], [18712799, 20152244], [20152245, 21591690], [21591691, 23031136], [23031137, 24470582], [24470583, 25910028], [25910029, 27349474], [27349475, 28788925]] SRR7804235 file size 9733921 SRR7804235 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804235 SRR7804235_1.fastq SRR7804235_2.fastq Input file: SRR7804235_1.fastq Paired file: SRR7804235_2.fastq trimmed: SRR7804235-trimmed-pair1.fastq, SRR7804235-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:52:19 2024 >> started Sat Dec 7 18:52:52 2024 >> done (33.049s) 28788925 read pairs processed; of these: 90 ( 0.00%) short read pairs filtered out after trimming by size control 2698 ( 0.01%) empty read pairs filtered out after trimming by size control 28786137 (99.99%) read pairs available; of these: 848129 ( 2.95%) trimmed read pairs available after processing 27938008 (97.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 14 0.00% 20 23 0.00% 21 28 0.00% 22 31 0.00% 23 25 0.00% 24 30 0.00% 25 51 0.00% 26 52 0.00% 27 46 0.00% 28 42 0.00% 29 53 0.00% 30 58 0.00% 31 52 0.00% 32 52 0.00% 33 64 0.00% 34 52 0.00% 35 84 0.00% 36 66 0.00% 37 61 0.00% 38 83 0.00% 39 87 0.00% 40 68 0.00% 41 76 0.00% 42 97 0.00% 43 102 0.00% 44 101 0.00% 45 93 0.00% 46 96 0.00% 47 120 0.00% 48 100 0.00% 49 93 0.00% 50 105 0.00% 51 105 0.00% 52 108 0.00% 53 128 0.00% 54 127 0.00% 55 158 0.00% 56 130 0.00% 57 117 0.00% 58 131 0.00% 59 145 0.00% 60 168 0.00% 61 160 0.00% 62 159 0.00% 63 167 0.00% 64 126 0.00% 65 155 0.00% 66 164 0.00% 67 191 0.00% 68 194 0.00% 69 194 0.00% 70 224 0.00% 71 233 0.00% 72 251 0.00% 73 284 0.00% 74 276 0.00% 75 302 0.00% 76 315 0.00% 77 345 0.00% 78 348 0.00% 79 461 0.00% 80 441 0.00% 81 454 0.00% 82 562 0.00% 83 567 0.00% 84 645 0.00% 85 718 0.00% 86 789 0.00% 87 896 0.00% 88 939 0.00% 89 986 0.00% 90 1218 0.00% 91 1281 0.00% 92 1438 0.00% 93 1546 0.01% 94 1736 0.01% 95 1892 0.01% 96 2126 0.01% 97 2328 0.01% 98 2490 0.01% 99 2709 0.01% 100 2900 0.01% 101 3135 0.01% 102 3509 0.01% 103 3679 0.01% 104 4002 0.01% 105 4326 0.02% 106 4766 0.02% 107 4934 0.02% 108 5334 0.02% 109 5820 0.02% 110 6068 0.02% 111 6550 0.02% 112 6923 0.02% 113 7402 0.03% 114 7994 0.03% 115 8473 0.03% 116 8966 0.03% 117 9316 0.03% 118 10020 0.03% 119 10298 0.04% 120 10759 0.04% 121 11196 0.04% 122 11941 0.04% 123 12679 0.04% 124 13388 0.05% 125 13997 0.05% 126 14811 0.05% 127 15347 0.05% 128 15989 0.06% 129 16698 0.06% 130 17013 0.06% 131 17840 0.06% 132 19043 0.07% 133 19866 0.07% 134 20863 0.07% 135 21761 0.08% 136 22601 0.08% 137 23180 0.08% 138 24624 0.09% 139 25158 0.09% 140 25404 0.09% 141 26332 0.09% 142 27603 0.10% 143 28826 0.10% 144 29782 0.10% 145 31335 0.11% 146 32452 0.11% 147 33298 0.12% 148 34413 0.12% 149 34736 0.12% 150 37030 0.13% 151 27938008 97.05% 28786137 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=23 prefix-density=0.38 prefix-fanout=2.9 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAGGAAGAAGATTAAGCTGAAGGCTTCTAGGCTTGTGTGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=28.74 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.0 sequence=CGTCAGCCCCCATACATGGTCTTACGACTTTGCGGAGACCTGTGTTTTTGGTAAACAGTCGCCCGGGCCTGGTCACTGCGACCCCCTTTTGTGAGGGGGCACCCCTTCTCCCGAAGTTACGGGGCTATTTTGCCGAGTTCCTTAGAGAGAGTTGTCTCGCGCCCCTAGGTATTCTCTACCTACCCACCTGTGTCGGTTTCGGGTACAGGTACCCTTTTGTTGAAGGTCGTTCGAGCTTTTCCTGGGAGTATGGCATCGGTTACATACTTCAGTGCCGTAGCGCCTGGTATGAGCCTCGTGGAGAAGCAATCGCTAGTCCACGGGGCTCATACTTCAGCGCTGCAGCGCTTGGTACTCGGACCTCGGCTCGAGGCATTTTCTCTACCCCTTCTTACCCTGAAAAAGCAGGGTCACCTTGTGTCCTTAAACCTATAACCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCCGTACCAACAAGGGGTAGTACAGGAATATTGACCTGTTGTC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=4.04 fanout-score-rank=20 prefix-density=0.56 prefix-fanout=3.0 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.13 sequence-density-rank=19 fanout-score=133.01 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=18.8 sequence=CCGCCGCCGCCG SRR7804235 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:53:45 Started mapping on | Dec 07 18:53:46 Finished on | Dec 07 18:59:42 Mapping speed, Million of reads per hour | 291.10 Number of input reads | 28786137 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 25799081 Uniquely mapped reads % | 89.62% Average mapped length | 299.73 Number of splices: Total | 25294878 Number of splices: Annotated (sjdb) | 23862499 Number of splices: GT/AG | 24967493 Number of splices: GC/AG | 281781 Number of splices: AT/AC | 10489 Number of splices: Non-canonical | 35115 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 535349 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 31805 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.38% % of reads unmapped: other | 1.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2451707 2451707 2451707 N_multimapping 535349 535349 535349 N_noFeature 745279 25096220 973416 N_ambiguous 552277 3727 77758 UnstrandedReadsAssigned:24501525 PositiveStrandReadsAssigned:699134 NegativeStrandReadsAssigned:24747907 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804235 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804235-trimmed-pair1.fastq SRR7804235-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,786,137 reads, 25,499,638 reads pseudoaligned [quant] estimated average fragment length: 312.789 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52973 SRR7804235.ke.tsv 35125 SRR7804235.se.tsv 88098 total ==> SRR7804235.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 624.855 0 0 PNS24247 1044 732.211 39.5445 2.60316 PNS24249 1928 1616.21 223.141 6.65475 PNS24246 1044 732.211 39.5445 2.60316 PNS24248 1044 732.211 39.5445 2.60316 PNS24244 1471 1159.21 29.2258 1.21522 PNS24243 293 73.2942 0 0 KQK14069 1603 1291.21 642.928 24.0003 KQK14071 474 195.725 7.44722 1.834 ==> SRR7804235.se.tsv <== BRADI_1g14170v3 683 BRADI_1g53295v3 32 BRADI_1g59795v3 180 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 1020 BRADI_1g74790v3 1083 BRADI_1g09890v3 0 BRADI_1g77505v3 154 BRADI_1g48960v3 0 SRR7804235 completed mapping pipeline successfully