Starting /dee2/code/volunteer_pipeline.sh SRR7804236 current disk space = 1540361125888 free memory = 1601407928 SRR7804236 SRAfilesize 877ca7ff032aa758f07b9f1cea63febc SRR7804236.sra SRR7804236.sra file validated SRR7804236 is paired end SRR7804236 is conventional basespace SRR7804236 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804236_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1475 37.0 37.0 37.0 37.0 37.0 2 36.2895 37.0 37.0 37.0 37.0 37.0 3 36.4215 37.0 37.0 37.0 37.0 37.0 4 36.5185 37.0 37.0 37.0 37.0 37.0 5 36.5025 37.0 37.0 37.0 37.0 37.0 6 36.5065 37.0 37.0 37.0 37.0 37.0 7 36.3635 37.0 37.0 37.0 37.0 37.0 8 36.55 37.0 37.0 37.0 37.0 37.0 9 36.4845 37.0 37.0 37.0 37.0 37.0 10-14 36.5311 37.0 37.0 37.0 37.0 37.0 15-19 36.5128 37.0 37.0 37.0 37.0 37.0 20-24 36.4791 37.0 37.0 37.0 37.0 37.0 25-29 36.443400000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.3991 37.0 37.0 37.0 37.0 37.0 35-39 36.385999999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3485 37.0 37.0 37.0 37.0 37.0 45-49 36.2905 37.0 37.0 37.0 37.0 37.0 50-54 36.2348 37.0 37.0 37.0 37.0 37.0 55-59 36.2226 37.0 37.0 37.0 37.0 37.0 60-64 36.203 37.0 37.0 37.0 37.0 37.0 65-69 36.1586 37.0 37.0 37.0 37.0 37.0 70-74 36.0595 37.0 37.0 37.0 37.0 37.0 75-79 36.078700000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.0133 37.0 37.0 37.0 37.0 37.0 85-89 35.944 37.0 37.0 37.0 37.0 37.0 90-94 35.928999999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.879099999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.8376 37.0 37.0 37.0 37.0 37.0 105-109 35.763099999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.7989 37.0 37.0 37.0 37.0 37.0 115-119 35.6504 37.0 37.0 37.0 37.0 37.0 120-124 35.615500000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.5918 37.0 37.0 37.0 37.0 37.0 130-134 35.404700000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.3318 37.0 37.0 37.0 37.0 37.0 140-144 35.3638 37.0 37.0 37.0 34.6 37.0 145-149 35.128 37.0 37.0 37.0 27.4 37.0 150-151 34.66275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 3.0 26 6.0 27 9.0 28 17.0 29 24.0 30 36.0 31 66.0 32 68.0 33 111.0 34 173.0 35 503.0 36 2729.0 37 251.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.873620862587764 10.030090270812437 12.236710130391174 44.859578736208626 2 24.625 16.0 33.95 25.424999999999997 3 25.275 21.025 22.425 31.275 4 28.65 28.475 17.224999999999998 25.650000000000002 5 27.325 29.7 23.75 19.225 6 21.8 32.45 22.55 23.200000000000003 7 17.150000000000002 20.9 40.275 21.675 8 21.05 19.6 28.050000000000004 31.3 9 21.6 18.925 31.35 28.125 10-14 23.91 25.419999999999998 24.08 26.590000000000003 15-19 23.865 24.490000000000002 24.36 27.284999999999997 20-24 23.825 23.995 25.39 26.790000000000003 25-29 23.974999999999998 24.285 25.215 26.525 30-34 23.985 24.060000000000002 24.795 27.16 35-39 24.565 24.33 24.01 27.095000000000002 40-44 24.805 24.875 23.75 26.57 45-49 24.605 23.945 24.055 27.395000000000003 50-54 24.715 24.14 24.310000000000002 26.834999999999997 55-59 24.044999999999998 24.349999999999998 24.12 27.485 60-64 24.9 24.22 24.125 26.755000000000003 65-69 24.104999999999997 24.41 24.395 27.089999999999996 70-74 24.32 23.93 24.065 27.685 75-79 25.105 23.275000000000002 24.675 26.945000000000004 80-84 25.259999999999998 23.794999999999998 24.075 26.87 85-89 25.395 23.44 23.825 27.339999999999996 90-94 24.775 23.375 24.39 27.46 95-99 24.345 23.98 24.404999999999998 27.27 100-104 25.205 24.125 23.69 26.979999999999997 105-109 25.235000000000003 23.25 24.12 27.395000000000003 110-114 25.230000000000004 24.03 23.96 26.779999999999998 115-119 25.69 23.595 23.715 27.0 120-124 25.629999999999995 23.580000000000002 23.695 27.095000000000002 125-129 24.79 23.7 23.84 27.67 130-134 25.53 23.535 23.549999999999997 27.384999999999998 135-139 25.455 23.765 24.05 26.729999999999997 140-144 26.05 23.674999999999997 23.200000000000003 27.075 145-149 24.845 23.485 23.995 27.675 150-151 25.775 22.6875 23.35 28.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 2.5 29 3.5 30 3.5 31 6.5 32 11.0 33 16.0 34 22.0 35 25.0 36 37.5 37 49.5 38 59.0 39 72.5 40 86.0 41 114.5 42 132.0 43 139.0 44 156.0 45 161.0 46 170.5 47 188.5 48 191.5 49 176.0 50 171.5 51 166.0 52 150.5 53 129.0 54 109.0 55 110.0 56 109.0 57 103.5 58 95.5 59 91.5 60 86.5 61 72.5 62 68.0 63 64.5 64 64.0 65 72.0 66 69.5 67 65.0 68 58.0 69 54.5 70 52.0 71 47.5 72 42.5 73 31.5 74 24.5 75 18.0 76 15.0 77 12.0 78 4.5 79 2.5 80 3.5 81 2.5 82 0.5 83 1.0 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.9864477456346 92.07499999999999 2 3.7789940057336464 7.249999999999999 3 0.23455824863174357 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.7749999999999999 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 0.9624999999999999 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.3250000000000002 0.0 0.0 0.0 0.0 128-129 1.4874999999999998 0.0 0.0 0.0 0.0 130-131 1.5750000000000002 0.0 0.0 0.0 0.0 132-133 1.75 0.0 0.0 0.0 0.0 134-135 1.925 0.0 0.0 0.0 0.0 136-137 2.0375 0.0 0.0 0.0 0.0 138-139 2.2249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTCCA 10 0.006830828 145.0 9 TGATCTA 10 0.006830828 145.0 4 CTGATCT 10 0.006830828 145.0 3 GGCCTCA 10 0.006830828 145.0 5 GTTCGTC 10 0.006830828 145.0 1 >>END_MODULE SRR7804236 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804236_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2735 37.0 37.0 37.0 37.0 37.0 2 35.9445 37.0 37.0 37.0 37.0 37.0 3 36.123 37.0 37.0 37.0 37.0 37.0 4 36.0155 37.0 37.0 37.0 37.0 37.0 5 36.2195 37.0 37.0 37.0 37.0 37.0 6 36.055 37.0 37.0 37.0 37.0 37.0 7 36.131 37.0 37.0 37.0 37.0 37.0 8 36.2395 37.0 37.0 37.0 37.0 37.0 9 36.3215 37.0 37.0 37.0 37.0 37.0 10-14 36.199200000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.112700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.113600000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1015 37.0 37.0 37.0 37.0 37.0 30-34 36.0131 37.0 37.0 37.0 37.0 37.0 35-39 35.9448 37.0 37.0 37.0 37.0 37.0 40-44 35.9262 37.0 37.0 37.0 37.0 37.0 45-49 35.903600000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.9422 37.0 37.0 37.0 37.0 37.0 55-59 35.869299999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.7611 37.0 37.0 37.0 37.0 37.0 65-69 35.663799999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.6931 37.0 37.0 37.0 37.0 37.0 75-79 35.5957 37.0 37.0 37.0 37.0 37.0 80-84 35.6069 37.0 37.0 37.0 37.0 37.0 85-89 35.5631 37.0 37.0 37.0 37.0 37.0 90-94 35.4828 37.0 37.0 37.0 37.0 37.0 95-99 35.3356 37.0 37.0 37.0 34.6 37.0 100-104 35.366400000000006 37.0 37.0 37.0 34.6 37.0 105-109 35.24810000000001 37.0 37.0 37.0 29.8 37.0 110-114 35.1014 37.0 37.0 37.0 25.0 37.0 115-119 35.0524 37.0 37.0 37.0 25.0 37.0 120-124 35.043899999999994 37.0 37.0 37.0 25.0 37.0 125-129 34.8671 37.0 37.0 37.0 25.0 37.0 130-134 34.8774 37.0 37.0 37.0 25.0 37.0 135-139 34.6075 37.0 37.0 37.0 25.0 37.0 140-144 34.44780000000001 37.0 37.0 37.0 25.0 37.0 145-149 34.407799999999995 37.0 37.0 37.0 25.0 37.0 150-151 33.76125 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 3.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 1.0 21 5.0 22 2.0 23 4.0 24 2.0 25 6.0 26 11.0 27 20.0 28 21.0 29 22.0 30 51.0 31 66.0 32 98.0 33 154.0 34 346.0 35 887.0 36 2207.0 37 89.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.675 10.725 14.774999999999999 41.825 2 28.175 17.925 30.625000000000004 23.275000000000002 3 24.775 22.0 26.375 26.85 4 28.675 26.650000000000002 17.75 26.924999999999997 5 29.95 29.299999999999997 19.075 21.675 6 22.625 33.6 19.3 24.474999999999998 7 22.1 14.875 35.375 27.650000000000002 8 23.775 19.0 23.25 33.975 9 26.900000000000002 20.625 23.674999999999997 28.799999999999997 10-14 26.045 24.32 21.725 27.91 15-19 25.929999999999996 23.974999999999998 23.01 27.084999999999997 20-24 26.619999999999997 24.16 22.57 26.650000000000002 25-29 26.125 24.23 22.57 27.075 30-34 26.484999999999996 24.51 23.025000000000002 25.979999999999997 35-39 26.640000000000004 23.794999999999998 22.345000000000002 27.22 40-44 27.279999999999998 24.79 22.509999999999998 25.419999999999998 45-49 26.93 24.175 22.485 26.41 50-54 26.625 24.16 22.314999999999998 26.900000000000002 55-59 27.384999999999998 23.925 22.39 26.3 60-64 27.525 23.630000000000003 22.145 26.700000000000003 65-69 27.445000000000004 24.13 22.955000000000002 25.47 70-74 27.52 23.595 22.57 26.314999999999998 75-79 27.405 23.794999999999998 22.71 26.090000000000003 80-84 27.38 23.9 22.285 26.435 85-89 27.560000000000002 23.93 22.615 25.895000000000003 90-94 27.49 24.45 22.17 25.89 95-99 27.575 24.26 22.91 25.255 100-104 27.284999999999997 23.96 22.31 26.445 105-109 27.665 24.205 22.400000000000002 25.729999999999997 110-114 27.455000000000002 24.435000000000002 22.07 26.040000000000003 115-119 27.92 23.945 22.605 25.53 120-124 28.455000000000002 23.57 22.525000000000002 25.45 125-129 27.515 24.25 22.825 25.41 130-134 28.189999999999998 23.82 22.67 25.319999999999997 135-139 28.115000000000002 24.445 22.32 25.119999999999997 140-144 28.08 24.515 22.82 24.585 145-149 28.525 23.805 22.564999999999998 25.105 150-151 28.225 23.275000000000002 23.4375 25.0625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.5 26 2.0 27 1.5 28 1.0 29 2.0 30 2.0 31 4.0 32 6.0 33 8.0 34 10.5 35 16.0 36 18.0 37 28.5 38 46.0 39 60.5 40 80.5 41 85.0 42 90.5 43 118.0 44 130.5 45 139.0 46 158.5 47 158.5 48 150.5 49 159.5 50 168.5 51 162.0 52 147.0 53 131.5 54 136.5 55 133.0 56 114.0 57 109.0 58 104.5 59 109.5 60 114.0 61 102.5 62 90.5 63 88.0 64 89.0 65 89.5 66 85.0 67 81.0 68 74.0 69 58.0 70 55.5 71 55.5 72 48.0 73 37.5 74 31.5 75 30.5 76 24.5 77 15.0 78 10.5 79 8.5 80 4.5 81 2.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.75 #Duplication Level Percentage of deduplicated Percentage of total 1 95.90078328981724 91.825 2 3.759791122715405 7.199999999999999 3 0.3394255874673629 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.7749999999999999 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 0.9624999999999999 0.0 0.0 0.0 0.0 124-125 1.1125 0.0 0.0 0.0 0.0 126-127 1.35 0.0 0.0 0.0 0.0 128-129 1.5125000000000002 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 1.775 0.0 0.0 0.0 0.0 134-135 1.95 0.0 0.0 0.0 0.0 136-137 2.0625 0.0 0.0 0.0 0.0 138-139 2.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCCACC 10 0.006830828 145.0 6 TAATGAA 10 0.006830828 145.0 4 ATGCCCA 10 0.006830828 145.0 8 >>END_MODULE Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928360 spots for SRR7804236.sra Written 1928360 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra Read 1928345 spots for SRR7804236.sra Written 1928345 spots for SRR7804236.sra SRR ids: ['SRR7804236.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__21zn8je SRR7804236.sra spots: 38566915 blocks: [[1, 1928345], [1928346, 3856690], [3856691, 5785035], [5785036, 7713380], [7713381, 9641725], [9641726, 11570070], [11570071, 13498415], [13498416, 15426760], [15426761, 17355105], [17355106, 19283450], [19283451, 21211795], [21211796, 23140140], [23140141, 25068485], [25068486, 26996830], [26996831, 28925175], [28925176, 30853520], [30853521, 32781865], [32781866, 34710210], [34710211, 36638555], [36638556, 38566915]] SRR7804236 file size 13047361 SRR7804236 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804236 SRR7804236_1.fastq SRR7804236_2.fastq Input file: SRR7804236_1.fastq Paired file: SRR7804236_2.fastq trimmed: SRR7804236-trimmed-pair1.fastq, SRR7804236-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:55:32 2024 >> started Sat Dec 7 18:56:33 2024 >> done (61.068s) 38566915 read pairs processed; of these: 107 ( 0.00%) short read pairs filtered out after trimming by size control 1196 ( 0.00%) empty read pairs filtered out after trimming by size control 38565612 (100.00%) read pairs available; of these: 1243526 ( 3.22%) trimmed read pairs available after processing 37322086 (96.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 26 0.00% 20 24 0.00% 21 26 0.00% 22 28 0.00% 23 41 0.00% 24 36 0.00% 25 55 0.00% 26 54 0.00% 27 47 0.00% 28 61 0.00% 29 63 0.00% 30 75 0.00% 31 82 0.00% 32 99 0.00% 33 72 0.00% 34 74 0.00% 35 110 0.00% 36 78 0.00% 37 124 0.00% 38 123 0.00% 39 112 0.00% 40 97 0.00% 41 111 0.00% 42 120 0.00% 43 121 0.00% 44 133 0.00% 45 134 0.00% 46 137 0.00% 47 136 0.00% 48 155 0.00% 49 139 0.00% 50 140 0.00% 51 137 0.00% 52 152 0.00% 53 162 0.00% 54 174 0.00% 55 195 0.00% 56 169 0.00% 57 201 0.00% 58 178 0.00% 59 190 0.00% 60 176 0.00% 61 221 0.00% 62 216 0.00% 63 205 0.00% 64 228 0.00% 65 234 0.00% 66 214 0.00% 67 250 0.00% 68 277 0.00% 69 295 0.00% 70 300 0.00% 71 358 0.00% 72 387 0.00% 73 412 0.00% 74 400 0.00% 75 430 0.00% 76 475 0.00% 77 506 0.00% 78 574 0.00% 79 688 0.00% 80 681 0.00% 81 748 0.00% 82 882 0.00% 83 961 0.00% 84 1094 0.00% 85 1127 0.00% 86 1280 0.00% 87 1426 0.00% 88 1558 0.00% 89 1740 0.00% 90 1911 0.00% 91 2042 0.01% 92 2409 0.01% 93 2616 0.01% 94 2745 0.01% 95 3080 0.01% 96 3527 0.01% 97 3647 0.01% 98 4092 0.01% 99 4385 0.01% 100 4785 0.01% 101 4992 0.01% 102 5376 0.01% 103 5962 0.02% 104 6466 0.02% 105 6876 0.02% 106 7660 0.02% 107 7889 0.02% 108 8233 0.02% 109 8890 0.02% 110 9348 0.02% 111 9860 0.03% 112 10789 0.03% 113 11212 0.03% 114 12049 0.03% 115 12914 0.03% 116 13606 0.04% 117 14104 0.04% 118 14841 0.04% 119 15807 0.04% 120 16281 0.04% 121 17077 0.04% 122 18272 0.05% 123 18609 0.05% 124 19832 0.05% 125 21061 0.05% 126 21799 0.06% 127 22905 0.06% 128 23388 0.06% 129 24432 0.06% 130 24982 0.06% 131 26269 0.07% 132 27363 0.07% 133 28185 0.07% 134 29725 0.08% 135 31681 0.08% 136 33215 0.09% 137 34000 0.09% 138 35423 0.09% 139 36288 0.09% 140 37227 0.10% 141 37993 0.10% 142 39497 0.10% 143 40857 0.11% 144 42672 0.11% 145 44341 0.11% 146 46274 0.12% 147 47451 0.12% 148 49535 0.13% 149 50032 0.13% 150 51999 0.13% 151 37322086 96.78% 38565612 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=25 prefix-density=0.37 prefix-fanout=2.8 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAGGAAGAAGATTAAGCTGAAGGCTTCTAGGCTTGTGTGTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=120.67 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=21.1 sequence=CGGCGGCGGCCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=4.31 fanout-score-rank=26 prefix-density=0.47 prefix-fanout=3.1 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.13 sequence-density-rank=24 fanout-score=188.28 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=24.9 sequence=CGCCGCCGCCGG SRR7804236 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:57:37 Started mapping on | Dec 07 18:57:37 Finished on | Dec 07 19:04:18 Mapping speed, Million of reads per hour | 346.22 Number of input reads | 38565612 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 35855928 Uniquely mapped reads % | 92.97% Average mapped length | 299.79 Number of splices: Total | 35661706 Number of splices: Annotated (sjdb) | 33591185 Number of splices: GT/AG | 35210390 Number of splices: GC/AG | 390277 Number of splices: AT/AC | 14755 Number of splices: Non-canonical | 46284 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 777884 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 43331 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.89% % of reads unmapped: other | 1.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1931800 1931800 1931800 N_multimapping 777884 777884 777884 N_noFeature 1022879 34810321 1348750 N_ambiguous 830226 5043 110857 UnstrandedReadsAssigned:34002823 PositiveStrandReadsAssigned:1040564 NegativeStrandReadsAssigned:34396321 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804236 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804236-trimmed-pair1.fastq SRR7804236-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,565,612 reads, 34,857,543 reads pseudoaligned [quant] estimated average fragment length: 314.542 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,370 rounds 52973 SRR7804236.ke.tsv 35125 SRR7804236.se.tsv 88098 total ==> SRR7804236.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 623.521 0 0 PNS24247 1044 730.458 89.9007 4.2928 PNS24249 1928 1614.46 251.159 5.4262 PNS24246 1044 730.458 89.9007 4.2928 PNS24248 1044 730.458 89.9007 4.2928 PNS24244 1471 1157.46 181.139 5.45858 PNS24243 293 75.2523 1 0.463505 KQK14069 1603 1289.46 484.835 13.1148 KQK14071 474 198.049 3.54137 0.623693 ==> SRR7804236.se.tsv <== BRADI_1g14170v3 498 BRADI_1g53295v3 17 BRADI_1g59795v3 231 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 1632 BRADI_1g74790v3 1831 BRADI_1g09890v3 0 BRADI_1g77505v3 109 BRADI_1g48960v3 0 SRR7804236 completed mapping pipeline successfully