Starting /dee2/code/volunteer_pipeline.sh SRR7804237 current disk space = 1540384808960 free memory = 1419036480 SRR7804237 SRAfilesize 96c7a971b5521a7728a9039e9e9bee2c SRR7804237.sra SRR7804237.sra file validated SRR7804237 is paired end SRR7804237 is conventional basespace SRR7804237 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804237_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.22425 37.0 37.0 37.0 37.0 37.0 2 36.252 37.0 37.0 37.0 37.0 37.0 3 36.363 37.0 37.0 37.0 37.0 37.0 4 36.4725 37.0 37.0 37.0 37.0 37.0 5 36.6005 37.0 37.0 37.0 37.0 37.0 6 36.517 37.0 37.0 37.0 37.0 37.0 7 36.3525 37.0 37.0 37.0 37.0 37.0 8 36.511 37.0 37.0 37.0 37.0 37.0 9 36.477 37.0 37.0 37.0 37.0 37.0 10-14 36.5216 37.0 37.0 37.0 37.0 37.0 15-19 36.456399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.4662 37.0 37.0 37.0 37.0 37.0 25-29 36.45569999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.4474 37.0 37.0 37.0 37.0 37.0 35-39 36.3608 37.0 37.0 37.0 37.0 37.0 40-44 36.3492 37.0 37.0 37.0 37.0 37.0 45-49 36.3196 37.0 37.0 37.0 37.0 37.0 50-54 36.298500000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.271699999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.2238 37.0 37.0 37.0 37.0 37.0 65-69 36.1681 37.0 37.0 37.0 37.0 37.0 70-74 36.105199999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.0734 37.0 37.0 37.0 37.0 37.0 80-84 36.1143 37.0 37.0 37.0 37.0 37.0 85-89 36.0287 37.0 37.0 37.0 37.0 37.0 90-94 35.934099999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.893800000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.8416 37.0 37.0 37.0 37.0 37.0 105-109 35.81099999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.8711 37.0 37.0 37.0 37.0 37.0 115-119 35.7335 37.0 37.0 37.0 37.0 37.0 120-124 35.5711 37.0 37.0 37.0 37.0 37.0 125-129 35.659499999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.5072 37.0 37.0 37.0 34.6 37.0 135-139 35.4533 37.0 37.0 37.0 37.0 37.0 140-144 35.4305 37.0 37.0 37.0 34.6 37.0 145-149 35.2222 37.0 37.0 37.0 32.2 37.0 150-151 34.65175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 0.0 24 3.0 25 4.0 26 10.0 27 8.0 28 16.0 29 16.0 30 38.0 31 54.0 32 73.0 33 97.0 34 179.0 35 432.0 36 2802.0 37 265.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.79293055903735 12.559538731511658 11.882677362747556 41.76485334670343 2 24.4 19.55 35.15 20.9 3 21.5 23.9 24.099999999999998 30.5 4 26.275 32.275 18.625 22.825 5 25.775 33.324999999999996 21.825 19.075 6 20.625 33.45 23.225 22.7 7 16.375 19.650000000000002 42.575 21.4 8 20.349999999999998 18.95 28.9 31.8 9 20.424999999999997 20.025000000000002 30.75 28.799999999999997 10-14 21.87 27.29 25.135 25.705 15-19 22.88 25.874999999999996 25.245 26.0 20-24 22.1 26.150000000000002 25.645 26.105 25-29 22.759999999999998 24.560000000000002 25.974999999999998 26.705000000000002 30-34 22.91 24.87 25.69 26.529999999999998 35-39 22.68 25.3 25.869999999999997 26.150000000000002 40-44 22.915 25.405 25.34 26.340000000000003 45-49 22.925 25.580000000000002 25.295 26.200000000000003 50-54 23.43 25.255 24.725 26.590000000000003 55-59 23.175 25.5 24.875 26.450000000000003 60-64 23.18 24.95 25.240000000000002 26.63 65-69 22.835 25.319999999999997 25.324999999999996 26.52 70-74 23.345 25.195 24.975 26.484999999999996 75-79 23.715 24.495 25.040000000000003 26.75 80-84 23.69 25.245 24.62 26.445 85-89 23.28 25.34 25.025 26.355 90-94 24.3 24.175 25.085 26.44 95-99 23.72 25.259999999999998 24.46 26.56 100-104 23.24 25.03 25.495 26.235000000000003 105-109 22.955000000000002 24.625 25.569999999999997 26.85 110-114 23.810000000000002 24.765 24.415 27.01 115-119 23.76 24.605 24.85 26.784999999999997 120-124 23.94 24.945 24.695 26.419999999999998 125-129 23.935000000000002 24.490000000000002 24.69 26.884999999999998 130-134 24.610000000000003 25.1 23.919999999999998 26.369999999999997 135-139 24.349999999999998 24.565 24.855 26.229999999999997 140-144 23.915 24.825 24.77 26.490000000000002 145-149 24.18 24.104999999999997 24.75 26.965 150-151 25.2125 24.275 23.6375 26.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 2.5 28 5.0 29 5.5 30 11.5 31 13.5 32 14.0 33 19.5 34 28.0 35 41.0 36 59.5 37 76.0 38 87.0 39 108.0 40 115.5 41 139.0 42 168.5 43 178.5 44 181.0 45 185.0 46 196.0 47 198.0 48 195.0 49 178.5 50 158.5 51 148.0 52 142.0 53 128.5 54 107.5 55 95.0 56 93.0 57 88.5 58 76.0 59 66.5 60 59.0 61 57.5 62 59.5 63 51.5 64 45.0 65 45.0 66 47.5 67 50.0 68 54.5 69 46.0 70 32.0 71 27.5 72 24.0 73 21.5 74 20.0 75 13.5 76 8.5 77 7.5 78 5.5 79 4.0 80 2.5 81 1.0 82 1.0 83 1.5 84 1.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.75 #Duplication Level Percentage of deduplicated Percentage of total 1 95.71801566579634 91.64999999999999 2 4.12532637075718 7.9 3 0.1566579634464752 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.175 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.4 0.0 0.0 0.0 0.0 126-127 0.4625 0.0 0.0 0.0 0.0 128-129 0.5 0.0 0.0 0.0 0.0 130-131 0.5375000000000001 0.0 0.0 0.0 0.0 132-133 0.6125 0.0 0.0 0.0 0.0 134-135 0.6875 0.0 0.0 0.0 0.0 136-137 0.7875 0.0 0.0 0.0 0.0 138-139 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTACT 10 0.006830828 145.0 145 >>END_MODULE SRR7804237 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804237_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.881 37.0 37.0 37.0 37.0 37.0 2 35.5275 37.0 37.0 37.0 37.0 37.0 3 35.991 37.0 37.0 37.0 37.0 37.0 4 35.998 37.0 37.0 37.0 37.0 37.0 5 35.924 37.0 37.0 37.0 37.0 37.0 6 35.8365 37.0 37.0 37.0 37.0 37.0 7 35.6735 37.0 37.0 37.0 37.0 37.0 8 35.877 37.0 37.0 37.0 37.0 37.0 9 35.9585 37.0 37.0 37.0 37.0 37.0 10-14 35.905899999999995 37.0 37.0 37.0 37.0 37.0 15-19 35.8643 37.0 37.0 37.0 37.0 37.0 20-24 35.7682 37.0 37.0 37.0 37.0 37.0 25-29 35.72410000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.7093 37.0 37.0 37.0 37.0 37.0 35-39 35.608000000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.6292 37.0 37.0 37.0 37.0 37.0 45-49 35.5226 37.0 37.0 37.0 37.0 37.0 50-54 35.485400000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.505399999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.402300000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.3256 37.0 37.0 37.0 34.6 37.0 70-74 35.300200000000004 37.0 37.0 37.0 34.6 37.0 75-79 35.22539999999999 37.0 37.0 37.0 29.8 37.0 80-84 35.1846 37.0 37.0 37.0 29.8 37.0 85-89 35.060500000000005 37.0 37.0 37.0 25.0 37.0 90-94 35.053399999999996 37.0 37.0 37.0 25.0 37.0 95-99 34.9559 37.0 37.0 37.0 25.0 37.0 100-104 34.8513 37.0 37.0 37.0 25.0 37.0 105-109 34.8373 37.0 37.0 37.0 25.0 37.0 110-114 34.658300000000004 37.0 37.0 37.0 25.0 37.0 115-119 34.6656 37.0 37.0 37.0 25.0 37.0 120-124 34.513 37.0 37.0 37.0 25.0 37.0 125-129 34.5329 37.0 37.0 37.0 25.0 37.0 130-134 34.403200000000005 37.0 37.0 37.0 25.0 37.0 135-139 34.17880000000001 37.0 37.0 37.0 25.0 37.0 140-144 34.0223 37.0 37.0 37.0 25.0 37.0 145-149 33.9096 37.0 37.0 37.0 25.0 37.0 150-151 33.15225 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 3.0 15 3.0 16 0.0 17 1.0 18 1.0 19 3.0 20 1.0 21 7.0 22 5.0 23 7.0 24 11.0 25 21.0 26 11.0 27 29.0 28 25.0 29 52.0 30 60.0 31 73.0 32 134.0 33 209.0 34 384.0 35 1033.0 36 1876.0 37 47.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.225 12.45 14.325 41.0 2 29.375 18.6 31.075000000000003 20.95 3 24.474999999999998 21.349999999999998 26.825 27.35 4 27.925 29.299999999999997 17.925 24.85 5 27.474999999999998 31.5 19.650000000000002 21.375 6 21.3 34.525 19.35 24.825 7 20.75 15.0 38.4 25.85 8 22.475 19.275000000000002 22.75 35.5 9 24.15 21.825 25.75 28.275 10-14 25.974999999999998 24.990000000000002 22.715 26.32 15-19 26.08 24.709999999999997 23.580000000000002 25.629999999999995 20-24 25.81 24.755 23.335 26.1 25-29 26.27 24.13 23.64 25.96 30-34 25.679999999999996 25.005 23.155 26.16 35-39 26.27 24.709999999999997 23.474999999999998 25.545 40-44 26.950000000000003 24.240000000000002 23.06 25.75 45-49 25.985000000000003 24.235 23.745 26.035000000000004 50-54 26.974999999999998 24.095 23.380000000000003 25.55 55-59 27.615000000000002 23.765 23.43 25.19 60-64 26.605 23.835 24.169999999999998 25.39 65-69 26.57 24.745 23.985 24.7 70-74 26.91 24.099999999999998 23.805 25.185000000000002 75-79 26.235000000000003 24.855 23.895 25.014999999999997 80-84 26.840000000000003 24.755 23.45 24.955 85-89 26.91 24.075 23.76 25.255 90-94 26.529999999999998 24.51 23.674999999999997 25.285000000000004 95-99 27.389999999999997 24.815 23.61 24.185000000000002 100-104 27.07 24.395 23.799999999999997 24.735 105-109 26.974999999999998 24.505 23.905 24.615000000000002 110-114 27.485 24.4 23.815 24.3 115-119 26.1 24.695 23.94 25.264999999999997 120-124 26.96 24.07 23.474999999999998 25.495 125-129 26.740000000000002 24.815 23.69 24.755 130-134 27.500000000000004 24.895 23.45 24.154999999999998 135-139 27.62 24.34 24.365000000000002 23.674999999999997 140-144 27.415 24.175 23.76 24.65 145-149 27.675 24.955 23.77 23.599999999999998 150-151 27.325 24.6625 23.6625 24.349999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 0.5 26 1.0 27 2.0 28 4.0 29 6.5 30 7.0 31 8.0 32 17.0 33 23.0 34 22.5 35 25.0 36 34.0 37 38.5 38 52.0 39 77.5 40 102.0 41 128.0 42 154.0 43 165.5 44 156.5 45 149.0 46 162.0 47 177.5 48 165.0 49 149.0 50 142.5 51 132.0 52 130.5 53 121.0 54 102.0 55 88.0 56 80.5 57 84.0 58 83.5 59 83.5 60 81.0 61 82.0 62 88.5 63 84.0 64 80.5 65 92.0 66 82.5 67 68.5 68 65.5 69 60.5 70 62.0 71 56.0 72 50.0 73 42.5 74 33.0 75 32.0 76 23.5 77 11.0 78 7.0 79 4.5 80 3.5 81 3.5 82 1.5 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.775 #Duplication Level Percentage of deduplicated Percentage of total 1 95.90185330200993 91.85 2 3.8893239363090575 7.449999999999999 3 0.15661707126076743 0.44999999999999996 4 0.026102845210127904 0.1 5 0.0 0.0 6 0.026102845210127904 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACGAATTTGCAGTGTACGCAGTTCTAGTAAACAAGAACCACATTTCCTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.375 0.0 0.0 0.0 0.0 124-125 0.42500000000000004 0.0 0.0 0.0 0.0 126-127 0.4875 0.0 0.0 0.0 0.0 128-129 0.525 0.0 0.0 0.0 0.0 130-131 0.5625 0.0 0.0 0.0 0.0 132-133 0.6375 0.0 0.0 0.0 0.0 134-135 0.7124999999999999 0.0 0.0 0.0 0.0 136-137 0.8125 0.0 0.0 0.0 0.0 138-139 0.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815380 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815380 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra Read 1815371 spots for SRR7804237.sra Written 1815371 spots for SRR7804237.sra SRR ids: ['SRR7804237.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r0gt648a SRR7804237.sra spots: 36307429 blocks: [[1, 1815371], [1815372, 3630742], [3630743, 5446113], [5446114, 7261484], [7261485, 9076855], [9076856, 10892226], [10892227, 12707597], [12707598, 14522968], [14522969, 16338339], [16338340, 18153710], [18153711, 19969081], [19969082, 21784452], [21784453, 23599823], [23599824, 25415194], [25415195, 27230565], [27230566, 29045936], [29045937, 30861307], [30861308, 32676678], [32676679, 34492049], [34492050, 36307429]] SRR7804237 file size 12281695 SRR7804237 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804237 SRR7804237_1.fastq SRR7804237_2.fastq Input file: SRR7804237_1.fastq Paired file: SRR7804237_2.fastq trimmed: SRR7804237-trimmed-pair1.fastq, SRR7804237-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:55:33 2024 >> started Sat Dec 7 18:56:22 2024 >> done (49.150s) 36307429 read pairs processed; of these: 118 ( 0.00%) short read pairs filtered out after trimming by size control 1159 ( 0.00%) empty read pairs filtered out after trimming by size control 36306152 (100.00%) read pairs available; of these: 756243 ( 2.08%) trimmed read pairs available after processing 35549909 (97.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 22 0.00% 20 13 0.00% 21 23 0.00% 22 34 0.00% 23 33 0.00% 24 29 0.00% 25 25 0.00% 26 32 0.00% 27 37 0.00% 28 36 0.00% 29 38 0.00% 30 43 0.00% 31 45 0.00% 32 62 0.00% 33 51 0.00% 34 55 0.00% 35 74 0.00% 36 61 0.00% 37 57 0.00% 38 77 0.00% 39 82 0.00% 40 53 0.00% 41 58 0.00% 42 61 0.00% 43 89 0.00% 44 71 0.00% 45 76 0.00% 46 88 0.00% 47 76 0.00% 48 72 0.00% 49 93 0.00% 50 105 0.00% 51 82 0.00% 52 80 0.00% 53 103 0.00% 54 102 0.00% 55 137 0.00% 56 129 0.00% 57 115 0.00% 58 111 0.00% 59 100 0.00% 60 130 0.00% 61 139 0.00% 62 117 0.00% 63 149 0.00% 64 137 0.00% 65 142 0.00% 66 150 0.00% 67 168 0.00% 68 156 0.00% 69 193 0.00% 70 167 0.00% 71 187 0.00% 72 227 0.00% 73 232 0.00% 74 227 0.00% 75 272 0.00% 76 252 0.00% 77 267 0.00% 78 337 0.00% 79 365 0.00% 80 342 0.00% 81 363 0.00% 82 427 0.00% 83 555 0.00% 84 542 0.00% 85 583 0.00% 86 687 0.00% 87 742 0.00% 88 768 0.00% 89 874 0.00% 90 908 0.00% 91 1085 0.00% 92 1194 0.00% 93 1301 0.00% 94 1463 0.00% 95 1628 0.00% 96 1732 0.00% 97 2076 0.01% 98 2023 0.01% 99 2231 0.01% 100 2364 0.01% 101 2573 0.01% 102 2829 0.01% 103 3100 0.01% 104 3308 0.01% 105 3705 0.01% 106 4123 0.01% 107 4214 0.01% 108 4558 0.01% 109 4962 0.01% 110 5160 0.01% 111 5610 0.02% 112 5901 0.02% 113 6369 0.02% 114 6759 0.02% 115 7411 0.02% 116 7725 0.02% 117 8091 0.02% 118 8553 0.02% 119 8987 0.02% 120 9730 0.03% 121 10099 0.03% 122 10525 0.03% 123 11298 0.03% 124 12138 0.03% 125 12486 0.03% 126 13062 0.04% 127 13626 0.04% 128 14267 0.04% 129 14576 0.04% 130 15428 0.04% 131 16215 0.04% 132 16745 0.05% 133 17441 0.05% 134 18404 0.05% 135 19286 0.05% 136 20467 0.06% 137 20909 0.06% 138 21603 0.06% 139 22353 0.06% 140 23534 0.06% 141 24077 0.07% 142 25004 0.07% 143 25855 0.07% 144 27349 0.08% 145 28310 0.08% 146 29486 0.08% 147 30164 0.08% 148 31500 0.09% 149 32232 0.09% 150 33486 0.09% 151 35549909 97.92% 36306152 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=25 prefix-density=0.26 prefix-fanout=3.0 sequence=GAGCTGGAGCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=290.74 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=21.3 sequence=ATCATCATCGTGGTAGTACAAGTGAAACCAGCTACACACACTTGGTCGCGAGCATAGTCGATTTGCATATACACATGTGCCTCTCATTGACACCTTACTTGCCGGGAACGAAGTTGGTGGCAAAGGCCCACGCGTTGTTGTTGACGGGGTCGGCAAGGTGGTCAGCGAGGTTCTCAAGGGGACCCTTGCCGGTGACGATGGCCTGAACGAAGAAGCCGAACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGCCAAGCCAAGGGGGTCGAAGCTGCCGCCGGGGTAGAGAGGGTCGACGATCTCACCGAGCGGACCACCAGCAACACGGTACCCCTCGACGGCGCCCATGAGCACGACCTGGCAAGCCCAGATGGCGAGGATGCTCTGGGCATGGACGAGGCTCGGGTTGCCAAGGTAGTCGAGGCCGCCCTCGCTGAAGATCTGGGAGCCGGCCTTGAACCAGACGGC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=4.40 fanout-score-rank=29 prefix-density=0.37 prefix-fanout=3.3 sequence=AAGATGTACCCAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=225.91 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=24.2 sequence=CGCCGCCGCCGG SRR7804237 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:57:58 Started mapping on | Dec 07 18:57:58 Finished on | Dec 07 19:03:06 Mapping speed, Million of reads per hour | 424.36 Number of input reads | 36306152 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 34631310 Uniquely mapped reads % | 95.39% Average mapped length | 300.09 Number of splices: Total | 36805271 Number of splices: Annotated (sjdb) | 34598230 Number of splices: GT/AG | 36347436 Number of splices: GC/AG | 394354 Number of splices: AT/AC | 15575 Number of splices: Non-canonical | 47906 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.78 Insertion rate per base | 0.01% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372615 % of reads mapped to multiple loci | 1.03% Number of reads mapped to too many loci | 19101 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1302227 1302227 1302227 N_multimapping 372615 372615 372615 N_noFeature 1168978 33634185 1512480 N_ambiguous 791211 4975 140671 UnstrandedReadsAssigned:32671121 PositiveStrandReadsAssigned:992150 NegativeStrandReadsAssigned:32978159 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804237 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804237-trimmed-pair1.fastq SRR7804237-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,306,152 reads, 33,233,761 reads pseudoaligned [quant] estimated average fragment length: 339.755 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR7804237.ke.tsv 35125 SRR7804237.se.tsv 88098 total ==> SRR7804237.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 598.855 0 0 PNS24247 1044 705.245 82.4287 4.80183 PNS24249 1928 1589.25 299.217 7.73505 PNS24246 1044 705.245 82.4287 4.80183 PNS24248 1044 705.245 82.4287 4.80183 PNS24244 1471 1132.25 152.497 5.53336 PNS24243 293 69.2009 0 0 KQK14069 1603 1264.25 137.464 4.46709 KQK14071 474 186.026 0 0 ==> SRR7804237.se.tsv <== BRADI_1g14170v3 147 BRADI_1g53295v3 817 BRADI_1g59795v3 559 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 1374 BRADI_1g74790v3 3649 BRADI_1g09890v3 0 BRADI_1g77505v3 182 BRADI_1g48960v3 0 SRR7804237 completed mapping pipeline successfully