Starting /dee2/code/volunteer_pipeline.sh SRR7804238 current disk space = 1540393766912 free memory = 1414266124 SRR7804238 SRAfilesize c81c53a64a8aef090f2e7d2ff0c6f3ec SRR7804238.sra SRR7804238.sra file validated SRR7804238 is paired end SRR7804238 is conventional basespace SRR7804238 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804238_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.159 37.0 37.0 37.0 37.0 37.0 2 36.255 37.0 37.0 37.0 37.0 37.0 3 36.3155 37.0 37.0 37.0 37.0 37.0 4 36.4625 37.0 37.0 37.0 37.0 37.0 5 36.526 37.0 37.0 37.0 37.0 37.0 6 36.501 37.0 37.0 37.0 37.0 37.0 7 36.2605 37.0 37.0 37.0 37.0 37.0 8 36.433 37.0 37.0 37.0 37.0 37.0 9 36.4945 37.0 37.0 37.0 37.0 37.0 10-14 36.504900000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.4579 37.0 37.0 37.0 37.0 37.0 20-24 36.4554 37.0 37.0 37.0 37.0 37.0 25-29 36.4201 37.0 37.0 37.0 37.0 37.0 30-34 36.4006 37.0 37.0 37.0 37.0 37.0 35-39 36.4135 37.0 37.0 37.0 37.0 37.0 40-44 36.308499999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.2911 37.0 37.0 37.0 37.0 37.0 50-54 36.2631 37.0 37.0 37.0 37.0 37.0 55-59 36.216699999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.178900000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.1734 37.0 37.0 37.0 37.0 37.0 70-74 36.095 37.0 37.0 37.0 37.0 37.0 75-79 36.1084 37.0 37.0 37.0 37.0 37.0 80-84 36.096 37.0 37.0 37.0 37.0 37.0 85-89 36.0717 37.0 37.0 37.0 37.0 37.0 90-94 35.9431 37.0 37.0 37.0 37.0 37.0 95-99 35.90429999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.8547 37.0 37.0 37.0 37.0 37.0 105-109 35.831 37.0 37.0 37.0 37.0 37.0 110-114 35.8845 37.0 37.0 37.0 37.0 37.0 115-119 35.743700000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.629999999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.633300000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.4981 37.0 37.0 37.0 37.0 37.0 135-139 35.4157 37.0 37.0 37.0 37.0 37.0 140-144 35.4551 37.0 37.0 37.0 34.6 37.0 145-149 35.18429999999999 37.0 37.0 37.0 27.4 37.0 150-151 34.6375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 3.0 26 4.0 27 11.0 28 13.0 29 28.0 30 44.0 31 53.0 32 76.0 33 97.0 34 183.0 35 443.0 36 2787.0 37 255.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.93490235353029 13.72058087130696 10.14021031547321 36.20430645968953 2 24.525 18.475 35.099999999999994 21.9 3 20.674999999999997 26.325 25.575 27.425 4 25.724999999999998 31.65 21.775 20.849999999999998 5 23.9 34.225 21.5 20.375 6 20.349999999999998 32.25 23.775 23.625 7 16.0 20.674999999999997 42.175000000000004 21.15 8 20.424999999999997 20.575 26.625 32.375 9 20.325 18.925 31.8 28.95 10-14 22.33 27.36 25.0 25.31 15-19 22.91 26.064999999999998 25.16 25.865 20-24 22.0 26.179999999999996 25.89 25.929999999999996 25-29 22.715 26.195 25.69 25.4 30-34 22.425 25.64 26.21 25.724999999999998 35-39 23.0 25.945 25.72 25.335 40-44 22.54 25.94 25.66 25.86 45-49 23.215 25.814999999999998 24.92 26.05 50-54 22.655 25.319999999999997 25.41 26.615 55-59 23.235 26.029999999999998 24.75 25.985000000000003 60-64 22.46 25.990000000000002 25.7 25.85 65-69 22.765 25.69 25.924999999999997 25.619999999999997 70-74 22.884999999999998 25.735000000000003 25.845000000000002 25.535000000000004 75-79 22.84 25.765 25.4 25.995 80-84 23.185 26.245 25.395 25.174999999999997 85-89 23.244999999999997 24.695 26.3 25.759999999999998 90-94 23.505000000000003 25.935000000000002 25.525 25.035 95-99 22.985 25.72 25.345000000000002 25.95 100-104 23.615 26.325 24.765 25.295 105-109 23.205000000000002 26.13 25.22 25.445 110-114 23.5 25.215 25.264999999999997 26.02 115-119 23.47 25.06 25.685000000000002 25.785000000000004 120-124 23.055 25.025 25.419999999999998 26.5 125-129 23.369999999999997 25.590000000000003 25.19 25.85 130-134 23.31 25.695 24.715 26.279999999999998 135-139 24.09 25.27 24.895 25.745 140-144 23.880000000000003 25.295 24.87 25.955000000000002 145-149 24.175 24.57 25.515 25.740000000000002 150-151 23.200000000000003 24.85 25.0125 26.937499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.5 26 2.5 27 2.0 28 3.0 29 3.5 30 5.5 31 12.5 32 23.0 33 23.5 34 29.5 35 49.5 36 58.5 37 74.0 38 89.5 39 101.5 40 142.0 41 172.0 42 184.0 43 192.0 44 193.5 45 211.0 46 217.0 47 206.0 48 183.5 49 172.5 50 167.5 51 150.0 52 132.5 53 116.0 54 98.5 55 89.0 56 88.0 57 82.5 58 72.5 59 59.5 60 56.5 61 56.5 62 53.5 63 45.0 64 46.5 65 46.5 66 39.0 67 42.0 68 41.5 69 32.5 70 27.5 71 24.5 72 18.5 73 12.0 74 13.5 75 13.0 76 4.0 77 5.0 78 6.0 79 2.5 80 1.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.85613760750587 91.95 2 4.039614281991139 7.75 3 0.10424811050299713 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.55 0.0 0.0 0.0 0.0 128-129 0.6375 0.0 0.0 0.0 0.0 130-131 0.6875 0.0 0.0 0.0 0.0 132-133 0.725 0.0 0.0 0.0 0.0 134-135 0.8375 0.0 0.0 0.0 0.0 136-137 0.9624999999999999 0.0 0.0 0.0 0.0 138-139 1.1124999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACAGTG 10 0.006830828 145.0 5 CATCTGG 10 0.006830828 145.0 9 TCATCTG 10 0.006830828 145.0 8 >>END_MODULE SRR7804238 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804238_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.294 37.0 37.0 37.0 37.0 37.0 2 36.071 37.0 37.0 37.0 37.0 37.0 3 36.1255 37.0 37.0 37.0 37.0 37.0 4 36.1705 37.0 37.0 37.0 37.0 37.0 5 36.188 37.0 37.0 37.0 37.0 37.0 6 36.0375 37.0 37.0 37.0 37.0 37.0 7 36.121 37.0 37.0 37.0 37.0 37.0 8 36.2045 37.0 37.0 37.0 37.0 37.0 9 36.186 37.0 37.0 37.0 37.0 37.0 10-14 36.1354 37.0 37.0 37.0 37.0 37.0 15-19 36.065099999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.08239999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.081399999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.951299999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.8344 37.0 37.0 37.0 37.0 37.0 40-44 35.835 37.0 37.0 37.0 37.0 37.0 45-49 35.831900000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.859300000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.8586 37.0 37.0 37.0 37.0 37.0 60-64 35.6723 37.0 37.0 37.0 37.0 37.0 65-69 35.575 37.0 37.0 37.0 37.0 37.0 70-74 35.599199999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.571600000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.5438 37.0 37.0 37.0 37.0 37.0 85-89 35.4816 37.0 37.0 37.0 37.0 37.0 90-94 35.382999999999996 37.0 37.0 37.0 34.6 37.0 95-99 35.2724 37.0 37.0 37.0 29.8 37.0 100-104 35.1505 37.0 37.0 37.0 27.4 37.0 105-109 35.0898 37.0 37.0 37.0 25.0 37.0 110-114 35.0403 37.0 37.0 37.0 25.0 37.0 115-119 34.978500000000004 37.0 37.0 37.0 25.0 37.0 120-124 35.021499999999996 37.0 37.0 37.0 25.0 37.0 125-129 34.8292 37.0 37.0 37.0 25.0 37.0 130-134 34.874700000000004 37.0 37.0 37.0 25.0 37.0 135-139 34.5557 37.0 37.0 37.0 25.0 37.0 140-144 34.3994 37.0 37.0 37.0 25.0 37.0 145-149 34.3481 37.0 37.0 37.0 25.0 37.0 150-151 33.5935 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 4.0 16 1.0 17 3.0 18 0.0 19 3.0 20 1.0 21 1.0 22 10.0 23 10.0 24 7.0 25 8.0 26 17.0 27 19.0 28 26.0 29 29.0 30 29.0 31 63.0 32 112.0 33 149.0 34 311.0 35 832.0 36 2276.0 37 86.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.7 14.799999999999999 11.774999999999999 33.725 2 29.549999999999997 19.7 30.5 20.25 3 24.099999999999998 24.425 28.000000000000004 23.474999999999998 4 25.85 31.574999999999996 19.2 23.375 5 26.6 33.675 19.175 20.549999999999997 6 22.175 35.125 19.625 23.075000000000003 7 20.45 15.325 38.7 25.525 8 23.849999999999998 19.525000000000002 22.875 33.75 9 24.925 20.9 25.7 28.475 10-14 25.71 25.465 23.080000000000002 25.745 15-19 26.090000000000003 24.935 23.64 25.335 20-24 25.15 25.014999999999997 23.990000000000002 25.845000000000002 25-29 26.290000000000003 25.355 23.244999999999997 25.11 30-34 26.195 24.81 23.945 25.05 35-39 25.495 24.995 24.135 25.374999999999996 40-44 25.935000000000002 24.44 24.26 25.365 45-49 26.215 24.13 24.435000000000002 25.22 50-54 25.31 25.130000000000003 24.66 24.9 55-59 26.474999999999998 24.935 24.07 24.52 60-64 25.785000000000004 25.240000000000002 24.4 24.575 65-69 26.115 24.755 24.47 24.66 70-74 26.27 25.040000000000003 24.435000000000002 24.255 75-79 26.919999999999998 25.505 23.695 23.880000000000003 80-84 26.405 24.93 23.585 25.080000000000002 85-89 26.419999999999998 25.28 23.799999999999997 24.5 90-94 27.1 24.98 23.43 24.490000000000002 95-99 27.384999999999998 25.22 23.04 24.355 100-104 26.63 25.380000000000003 24.45 23.54 105-109 26.27 25.2 24.610000000000003 23.919999999999998 110-114 26.235000000000003 25.119999999999997 24.779999999999998 23.865 115-119 26.674999999999997 25.165 24.055 24.104999999999997 120-124 26.650000000000002 25.21 24.095 24.044999999999998 125-129 26.275 25.445 24.135 24.145 130-134 26.424999999999997 24.95 24.615000000000002 24.01 135-139 26.064999999999998 25.635 24.385 23.915 140-144 27.295 24.875 24.54 23.29 145-149 26.779999999999998 25.929999999999996 23.799999999999997 23.49 150-151 26.987499999999997 25.0375 24.2375 23.7375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.5 24 1.0 25 0.0 26 0.5 27 1.5 28 3.0 29 4.0 30 5.0 31 10.5 32 14.0 33 17.5 34 21.0 35 23.5 36 36.0 37 57.5 38 73.0 39 84.0 40 106.0 41 128.5 42 152.0 43 158.5 44 170.0 45 208.0 46 202.0 47 170.0 48 152.0 49 147.0 50 145.5 51 137.5 52 130.0 53 117.5 54 106.5 55 98.0 56 91.0 57 98.5 58 106.5 59 85.5 60 67.0 61 69.5 62 68.5 63 68.0 64 72.5 65 69.5 66 73.5 67 67.5 68 54.0 69 55.0 70 55.0 71 44.5 72 33.0 73 32.5 74 27.5 75 20.5 76 15.5 77 11.0 78 7.0 79 3.0 80 1.0 81 0.5 82 1.0 83 1.0 84 0.5 85 0.5 86 1.0 87 0.5 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 1.0 99 1.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.075 #Duplication Level Percentage of deduplicated Percentage of total 1 96.07077803799116 92.30000000000001 2 3.825136612021858 7.35 3 0.078064012490242 0.22499999999999998 4 0.0 0.0 5 0.026021337496747333 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.55 0.0 0.0 0.0 0.0 128-129 0.6375 0.0 0.0 0.0 0.0 130-131 0.6875 0.0 0.0 0.0 0.0 132-133 0.7375 0.0 0.0 0.0 0.0 134-135 0.8625 0.0 0.0 0.0 0.0 136-137 0.9875 0.0 0.0 0.0 0.0 138-139 1.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAAGT 10 0.006830828 145.0 9 >>END_MODULE Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396891 spots for SRR7804238.sra Written 1396891 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra Read 1396886 spots for SRR7804238.sra Written 1396886 spots for SRR7804238.sra SRR ids: ['SRR7804238.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kd8xpr5v SRR7804238.sra spots: 27937725 blocks: [[1, 1396886], [1396887, 2793772], [2793773, 4190658], [4190659, 5587544], [5587545, 6984430], [6984431, 8381316], [8381317, 9778202], [9778203, 11175088], [11175089, 12571974], [12571975, 13968860], [13968861, 15365746], [15365747, 16762632], [16762633, 18159518], [18159519, 19556404], [19556405, 20953290], [20953291, 22350176], [22350177, 23747062], [23747063, 25143948], [25143949, 26540834], [26540835, 27937725]] SRR7804238 file size 9445477 SRR7804238 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804238 SRR7804238_1.fastq SRR7804238_2.fastq Input file: SRR7804238_1.fastq Paired file: SRR7804238_2.fastq trimmed: SRR7804238-trimmed-pair1.fastq, SRR7804238-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:55:20 2024 >> started Sat Dec 7 18:56:41 2024 >> done (81.041s) 27937725 read pairs processed; of these: 66 ( 0.00%) short read pairs filtered out after trimming by size control 838 ( 0.00%) empty read pairs filtered out after trimming by size control 27936821 (100.00%) read pairs available; of these: 566333 ( 2.03%) trimmed read pairs available after processing 27370488 (97.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 11 0.00% 20 15 0.00% 21 20 0.00% 22 18 0.00% 23 21 0.00% 24 32 0.00% 25 21 0.00% 26 28 0.00% 27 28 0.00% 28 39 0.00% 29 30 0.00% 30 43 0.00% 31 40 0.00% 32 50 0.00% 33 40 0.00% 34 45 0.00% 35 56 0.00% 36 39 0.00% 37 42 0.00% 38 66 0.00% 39 69 0.00% 40 61 0.00% 41 46 0.00% 42 39 0.00% 43 65 0.00% 44 63 0.00% 45 69 0.00% 46 75 0.00% 47 62 0.00% 48 70 0.00% 49 71 0.00% 50 77 0.00% 51 62 0.00% 52 83 0.00% 53 105 0.00% 54 89 0.00% 55 87 0.00% 56 101 0.00% 57 103 0.00% 58 93 0.00% 59 96 0.00% 60 106 0.00% 61 111 0.00% 62 129 0.00% 63 111 0.00% 64 116 0.00% 65 110 0.00% 66 128 0.00% 67 155 0.00% 68 150 0.00% 69 131 0.00% 70 148 0.00% 71 182 0.00% 72 186 0.00% 73 198 0.00% 74 190 0.00% 75 201 0.00% 76 226 0.00% 77 266 0.00% 78 266 0.00% 79 298 0.00% 80 308 0.00% 81 351 0.00% 82 416 0.00% 83 444 0.00% 84 478 0.00% 85 523 0.00% 86 584 0.00% 87 640 0.00% 88 689 0.00% 89 771 0.00% 90 873 0.00% 91 894 0.00% 92 1048 0.00% 93 1104 0.00% 94 1242 0.00% 95 1394 0.00% 96 1464 0.01% 97 1561 0.01% 98 1702 0.01% 99 1854 0.01% 100 1972 0.01% 101 2263 0.01% 102 2302 0.01% 103 2487 0.01% 104 2824 0.01% 105 3130 0.01% 106 3189 0.01% 107 3356 0.01% 108 3549 0.01% 109 3770 0.01% 110 4173 0.01% 111 4322 0.02% 112 4706 0.02% 113 5014 0.02% 114 5278 0.02% 115 5678 0.02% 116 6072 0.02% 117 6188 0.02% 118 6486 0.02% 119 6741 0.02% 120 7181 0.03% 121 7524 0.03% 122 7949 0.03% 123 8489 0.03% 124 8938 0.03% 125 9402 0.03% 126 9992 0.04% 127 10117 0.04% 128 10510 0.04% 129 11168 0.04% 130 11283 0.04% 131 12027 0.04% 132 12457 0.04% 133 13237 0.05% 134 13905 0.05% 135 14677 0.05% 136 15055 0.05% 137 15184 0.05% 138 15991 0.06% 139 16225 0.06% 140 16855 0.06% 141 17297 0.06% 142 18527 0.07% 143 19243 0.07% 144 20069 0.07% 145 20793 0.07% 146 21583 0.08% 147 22270 0.08% 148 23159 0.08% 149 23649 0.08% 150 24046 0.09% 151 27370488 97.97% 27936821 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.69 fanout-score-rank=20 prefix-density=0.21 prefix-fanout=3.7 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=376.44 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=26.8 sequence=CATCATCATCGTGGTAGTACAAGTGAAACCAGCTACACACACTTGGTCGCGAGCATAGTCGATTTGCATATACACATGTGCCTCTCATTGACACCTTACTTGCCGGGAACGAAGTTGGTGGCAAAGGCCCACGCGTTGTTGTTGACGGGGTCGGCAAGGTGGTCAGCGAGGTTCTCAAGGGGACCCTTGCCGGTGACGATGGCCTGAACGAAGAAGCCGAACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGCCAAGCCAAGGGGGTCGAAGCTGCCGCCGGGGTAGAGAGGGTCGACGATCTCACCGAGCGGACCACCAGCAACACGGTACCCCTCGACGGCGCCCATGAGCACGACCTGGCAAGCCCAGATGGCGAGGATGCTCTGGGCATGGACGAGGCTCGGGTTGCCAAGGTAGTCGAGGCCGCCCTCGCTGAAGATCTGGGAGCCGGCCTTGAACCAGACGG criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.53 fanout-score-rank=26 prefix-density=0.28 prefix-fanout=4.2 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=198.04 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=23.3 sequence=CGCCGCCGCCGC SRR7804238 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:57:58 Started mapping on | Dec 07 18:57:58 Finished on | Dec 07 19:01:12 Mapping speed, Million of reads per hour | 518.42 Number of input reads | 27936821 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 26596229 Uniquely mapped reads % | 95.20% Average mapped length | 300.14 Number of splices: Total | 29009481 Number of splices: Annotated (sjdb) | 27300997 Number of splices: GT/AG | 28648650 Number of splices: GC/AG | 309483 Number of splices: AT/AC | 13646 Number of splices: Non-canonical | 37702 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.79 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295238 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 15341 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.30% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1045354 1045354 1045354 N_multimapping 295238 295238 295238 N_noFeature 900995 25809789 1185039 N_ambiguous 604339 4090 104330 UnstrandedReadsAssigned:25090895 PositiveStrandReadsAssigned:782350 NegativeStrandReadsAssigned:25306860 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804238 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804238-trimmed-pair1.fastq SRR7804238-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,936,821 reads, 25,542,288 reads pseudoaligned [quant] estimated average fragment length: 345.911 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR7804238.ke.tsv 35125 SRR7804238.se.tsv 88098 total ==> SRR7804238.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 593.024 0 0 PNS24247 1044 699.089 64.6486 4.94026 PNS24249 1928 1583.09 131.454 4.436 PNS24246 1044 699.089 64.6486 4.94026 PNS24248 1044 699.089 64.6486 4.94026 PNS24244 1471 1126.09 175.6 8.33059 PNS24243 293 69.4254 0 0 KQK14069 1603 1258.09 68.2127 2.89652 KQK14071 474 185.094 1.34644 0.388612 ==> SRR7804238.se.tsv <== BRADI_1g14170v3 72 BRADI_1g53295v3 672 BRADI_1g59795v3 511 BRADI_1g07683v3 1 BRADI_1g00485v3 16 BRADI_1g20270v3 1198 BRADI_1g74790v3 2391 BRADI_1g09890v3 0 BRADI_1g77505v3 151 BRADI_1g48960v3 0 SRR7804238 completed mapping pipeline successfully