Starting /dee2/code/volunteer_pipeline.sh SRR7804239 current disk space = 1540337659904 free memory = 1607423848 SRR7804239 SRAfilesize ff04506d24f6739302a4dd68419ced00 SRR7804239.sra SRR7804239.sra file validated SRR7804239 is paired end SRR7804239 is conventional basespace SRR7804239 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804239_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.15325 37.0 37.0 37.0 37.0 37.0 2 36.251 37.0 37.0 37.0 37.0 37.0 3 36.404 37.0 37.0 37.0 37.0 37.0 4 36.4875 37.0 37.0 37.0 37.0 37.0 5 36.577 37.0 37.0 37.0 37.0 37.0 6 36.4895 37.0 37.0 37.0 37.0 37.0 7 36.352 37.0 37.0 37.0 37.0 37.0 8 36.467 37.0 37.0 37.0 37.0 37.0 9 36.4765 37.0 37.0 37.0 37.0 37.0 10-14 36.5436 37.0 37.0 37.0 37.0 37.0 15-19 36.520799999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.4989 37.0 37.0 37.0 37.0 37.0 25-29 36.4471 37.0 37.0 37.0 37.0 37.0 30-34 36.4319 37.0 37.0 37.0 37.0 37.0 35-39 36.3634 37.0 37.0 37.0 37.0 37.0 40-44 36.3681 37.0 37.0 37.0 37.0 37.0 45-49 36.3095 37.0 37.0 37.0 37.0 37.0 50-54 36.2718 37.0 37.0 37.0 37.0 37.0 55-59 36.238299999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.2062 37.0 37.0 37.0 37.0 37.0 65-69 36.245400000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.1514 37.0 37.0 37.0 37.0 37.0 75-79 36.1543 37.0 37.0 37.0 37.0 37.0 80-84 36.124900000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.0936 37.0 37.0 37.0 37.0 37.0 90-94 36.0644 37.0 37.0 37.0 37.0 37.0 95-99 35.9505 37.0 37.0 37.0 37.0 37.0 100-104 35.9462 37.0 37.0 37.0 37.0 37.0 105-109 35.913399999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.830600000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.75169999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.6679 37.0 37.0 37.0 37.0 37.0 125-129 35.682900000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.555899999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.4086 37.0 37.0 37.0 34.6 37.0 140-144 35.4039 37.0 37.0 37.0 34.6 37.0 145-149 35.321000000000005 37.0 37.0 37.0 29.8 37.0 150-151 34.684749999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 0.0 25 6.0 26 6.0 27 12.0 28 17.0 29 26.0 30 38.0 31 42.0 32 60.0 33 104.0 34 168.0 35 417.0 36 2873.0 37 229.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.060636431971936 13.755950889501378 10.223001753946379 37.96041092458031 2 23.75 19.650000000000002 35.3 21.3 3 21.6 26.75 25.05 26.6 4 26.0 30.15 20.0 23.849999999999998 5 25.025 32.775 21.175 21.025 6 19.6 34.1 22.625 23.674999999999997 7 15.475 20.474999999999998 43.325 20.724999999999998 8 20.825 19.75 27.425 32.0 9 19.875 19.05 30.8 30.275000000000002 10-14 22.1 26.784999999999997 25.335 25.779999999999998 15-19 22.785 25.885 25.509999999999998 25.82 20-24 22.355 26.52 25.295 25.83 25-29 22.99 25.915 25.655 25.44 30-34 22.35 26.025 25.619999999999997 26.005 35-39 23.515 25.0 25.380000000000003 26.105 40-44 23.09 25.96 25.31 25.64 45-49 22.63 25.575 25.55 26.245 50-54 23.07 25.6 25.615 25.715 55-59 24.025 25.485000000000003 24.34 26.150000000000002 60-64 22.86 26.005 24.975 26.16 65-69 23.24 25.4 25.314999999999998 26.045 70-74 23.305 25.759999999999998 24.97 25.965 75-79 22.98 25.580000000000002 24.965 26.474999999999998 80-84 22.900000000000002 25.230000000000004 25.36 26.51 85-89 23.225 25.53 25.215 26.029999999999998 90-94 23.265 25.825 24.805 26.105 95-99 23.515 24.815 25.15 26.52 100-104 23.549999999999997 25.06 24.95 26.44 105-109 23.52 24.455 25.52 26.505000000000003 110-114 23.525 24.815 25.074999999999996 26.584999999999997 115-119 23.995 24.815 25.0 26.19 120-124 23.745 25.264999999999997 25.03 25.96 125-129 24.0 25.235000000000003 24.195 26.57 130-134 23.925 25.080000000000002 24.86 26.135 135-139 24.2 24.29 25.064999999999998 26.445 140-144 23.73 25.205 24.98 26.085 145-149 24.22 24.64 25.27 25.869999999999997 150-151 23.474999999999998 25.687500000000004 24.725 26.1125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 2.0 25 2.5 26 2.0 27 1.5 28 1.0 29 3.5 30 11.5 31 19.0 32 19.0 33 18.5 34 27.5 35 46.0 36 58.0 37 62.5 38 86.5 39 118.0 40 142.5 41 153.0 42 162.0 43 188.0 44 200.5 45 199.0 46 193.0 47 193.5 48 180.0 49 158.0 50 156.5 51 160.0 52 144.0 53 120.5 54 104.5 55 89.0 56 87.5 57 90.5 58 77.5 59 62.0 60 67.5 61 67.5 62 56.0 63 45.5 64 46.0 65 49.0 66 40.0 67 38.5 68 43.0 69 42.5 70 37.0 71 24.5 72 19.5 73 21.5 74 17.5 75 14.0 76 9.5 77 6.0 78 5.0 79 3.5 80 1.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.47120418848168 91.175 2 4.371727748691099 8.35 3 0.13089005235602094 0.375 4 0.026178010471204192 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.3375 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.5625 0.0 0.0 0.0 0.0 128-129 0.65 0.0 0.0 0.0 0.0 130-131 0.7 0.0 0.0 0.0 0.0 132-133 0.75 0.0 0.0 0.0 0.0 134-135 0.8375 0.0 0.0 0.0 0.0 136-137 0.9375 0.0 0.0 0.0 0.0 138-139 1.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATTA 10 0.006830828 145.0 1 GGGGCTT 10 0.006830828 145.0 1 TGTACAA 10 0.006830828 145.0 7 GCATTAC 10 0.006830828 145.0 2 AAGTCGC 10 0.006830828 145.0 5 >>END_MODULE SRR7804239 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804239_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3145 37.0 37.0 37.0 37.0 37.0 2 36.045 37.0 37.0 37.0 37.0 37.0 3 36.1145 37.0 37.0 37.0 37.0 37.0 4 36.089 37.0 37.0 37.0 37.0 37.0 5 36.2695 37.0 37.0 37.0 37.0 37.0 6 35.9805 37.0 37.0 37.0 37.0 37.0 7 36.0685 37.0 37.0 37.0 37.0 37.0 8 36.255 37.0 37.0 37.0 37.0 37.0 9 36.217 37.0 37.0 37.0 37.0 37.0 10-14 36.175200000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.0516 37.0 37.0 37.0 37.0 37.0 20-24 36.0327 37.0 37.0 37.0 37.0 37.0 25-29 36.0548 37.0 37.0 37.0 37.0 37.0 30-34 36.0097 37.0 37.0 37.0 37.0 37.0 35-39 35.9556 37.0 37.0 37.0 37.0 37.0 40-44 35.9011 37.0 37.0 37.0 37.0 37.0 45-49 35.870999999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.891000000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.8125 37.0 37.0 37.0 37.0 37.0 60-64 35.711600000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.6494 37.0 37.0 37.0 37.0 37.0 70-74 35.6434 37.0 37.0 37.0 37.0 37.0 75-79 35.6167 37.0 37.0 37.0 37.0 37.0 80-84 35.5311 37.0 37.0 37.0 37.0 37.0 85-89 35.4435 37.0 37.0 37.0 37.0 37.0 90-94 35.4169 37.0 37.0 37.0 37.0 37.0 95-99 35.3354 37.0 37.0 37.0 34.6 37.0 100-104 35.2182 37.0 37.0 37.0 27.4 37.0 105-109 35.1808 37.0 37.0 37.0 27.4 37.0 110-114 35.0395 37.0 37.0 37.0 25.0 37.0 115-119 35.0718 37.0 37.0 37.0 25.0 37.0 120-124 34.971 37.0 37.0 37.0 25.0 37.0 125-129 34.8839 37.0 37.0 37.0 25.0 37.0 130-134 34.788 37.0 37.0 37.0 25.0 37.0 135-139 34.603699999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.441100000000006 37.0 37.0 37.0 25.0 37.0 145-149 34.323299999999996 37.0 37.0 37.0 25.0 37.0 150-151 33.67175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 1.0 15 3.0 16 0.0 17 0.0 18 0.0 19 3.0 20 3.0 21 5.0 22 2.0 23 2.0 24 9.0 25 11.0 26 16.0 27 21.0 28 23.0 29 32.0 30 45.0 31 49.0 32 109.0 33 158.0 34 284.0 35 885.0 36 2254.0 37 82.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.1 13.450000000000001 13.3 34.150000000000006 2 29.95 19.375 30.3 20.375 3 23.75 22.900000000000002 27.025 26.325 4 26.1 31.474999999999998 18.85 23.575 5 28.9 32.05 17.775 21.275 6 21.4 35.9 18.525 24.175 7 21.5 14.674999999999999 37.95 25.874999999999996 8 23.1 19.925 23.425 33.550000000000004 9 22.525000000000002 21.025 26.575 29.875 10-14 26.08 25.564999999999998 23.54 24.815 15-19 25.655 24.925 24.060000000000002 25.36 20-24 26.674999999999997 24.52 24.14 24.665 25-29 25.85 24.945 24.09 25.115 30-34 25.575 24.91 24.33 25.185000000000002 35-39 26.055 24.759999999999998 24.23 24.955 40-44 26.43 24.545 24.02 25.005 45-49 26.68 24.595 23.724999999999998 25.0 50-54 26.590000000000003 25.64 23.14 24.63 55-59 26.224999999999998 24.66 24.25 24.865000000000002 60-64 26.61 24.175 24.235 24.98 65-69 26.72 25.119999999999997 23.845 24.315 70-74 26.479999999999997 24.385 24.23 24.905 75-79 26.345000000000002 24.265 24.38 25.009999999999998 80-84 26.91 24.86 23.935000000000002 24.295 85-89 27.065 24.44 23.95 24.545 90-94 26.534999999999997 25.124999999999996 23.645 24.695 95-99 26.575 24.785 24.005000000000003 24.635 100-104 26.540000000000003 25.240000000000002 23.465 24.755 105-109 26.229999999999997 25.240000000000002 24.075 24.455 110-114 26.87 25.09 23.39 24.65 115-119 26.634999999999998 24.33 24.305 24.73 120-124 26.640000000000004 24.92 23.96 24.48 125-129 27.060000000000002 25.465 23.47 24.005000000000003 130-134 26.534999999999997 25.264999999999997 23.96 24.240000000000002 135-139 26.445 25.235000000000003 24.235 24.085 140-144 26.76 25.055 24.305 23.880000000000003 145-149 26.655 25.064999999999998 24.145 24.135 150-151 27.625 25.2625 23.75 23.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 1.0 28 1.0 29 1.5 30 5.0 31 8.5 32 12.0 33 19.5 34 27.5 35 29.5 36 36.5 37 54.0 38 69.5 39 87.5 40 108.5 41 135.5 42 157.0 43 161.5 44 163.0 45 164.0 46 176.0 47 192.0 48 188.5 49 165.5 50 143.0 51 134.5 52 126.0 53 112.5 54 108.0 55 95.0 56 77.0 57 72.0 58 76.5 59 73.5 60 72.0 61 79.0 62 77.5 63 74.5 64 75.0 65 71.5 66 69.0 67 70.0 68 65.5 69 63.0 70 57.0 71 56.0 72 48.5 73 29.5 74 23.5 75 21.5 76 16.5 77 9.5 78 6.5 79 5.0 80 3.0 81 3.5 82 1.5 83 1.5 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.7 #Duplication Level Percentage of deduplicated Percentage of total 1 95.6896551724138 91.57499999999999 2 4.179728317659352 8.0 3 0.07836990595611285 0.22499999999999998 4 0.052246603970741906 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.3375 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.5625 0.0 0.0 0.0 0.0 128-129 0.65 0.0 0.0 0.0 0.0 130-131 0.7 0.0 0.0 0.0 0.0 132-133 0.75 0.0 0.0 0.0 0.0 134-135 0.8375 0.0 0.0 0.0 0.0 136-137 0.9375 0.0 0.0 0.0 0.0 138-139 1.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGACAAC 10 0.006830828 145.0 1 GTCCATC 10 0.006830828 145.0 1 >>END_MODULE Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998515 spots for SRR7804239.sra Written 1998515 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra Read 1998510 spots for SRR7804239.sra Written 1998510 spots for SRR7804239.sra SRR ids: ['SRR7804239.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m6y3hji3 SRR7804239.sra spots: 39970205 blocks: [[1, 1998510], [1998511, 3997020], [3997021, 5995530], [5995531, 7994040], [7994041, 9992550], [9992551, 11991060], [11991061, 13989570], [13989571, 15988080], [15988081, 17986590], [17986591, 19985100], [19985101, 21983610], [21983611, 23982120], [23982121, 25980630], [25980631, 27979140], [27979141, 29977650], [29977651, 31976160], [31976161, 33974670], [33974671, 35973180], [35973181, 37971690], [37971691, 39970205]] SRR7804239 file size 13522890 SRR7804239 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804239 SRR7804239_1.fastq SRR7804239_2.fastq Input file: SRR7804239_1.fastq Paired file: SRR7804239_2.fastq trimmed: SRR7804239-trimmed-pair1.fastq, SRR7804239-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 19:17:24 2024 >> started Sat Dec 7 19:19:53 2024 >> done (148.616s) 39970205 read pairs processed; of these: 96 ( 0.00%) short read pairs filtered out after trimming by size control 791 ( 0.00%) empty read pairs filtered out after trimming by size control 39969318 (100.00%) read pairs available; of these: 892672 ( 2.23%) trimmed read pairs available after processing 39076646 (97.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 18 0.00% 20 15 0.00% 21 24 0.00% 22 23 0.00% 23 31 0.00% 24 29 0.00% 25 33 0.00% 26 43 0.00% 27 42 0.00% 28 44 0.00% 29 44 0.00% 30 45 0.00% 31 48 0.00% 32 43 0.00% 33 39 0.00% 34 55 0.00% 35 69 0.00% 36 63 0.00% 37 65 0.00% 38 94 0.00% 39 84 0.00% 40 80 0.00% 41 61 0.00% 42 69 0.00% 43 67 0.00% 44 75 0.00% 45 88 0.00% 46 106 0.00% 47 78 0.00% 48 88 0.00% 49 104 0.00% 50 108 0.00% 51 102 0.00% 52 109 0.00% 53 115 0.00% 54 117 0.00% 55 128 0.00% 56 122 0.00% 57 110 0.00% 58 136 0.00% 59 107 0.00% 60 129 0.00% 61 143 0.00% 62 169 0.00% 63 141 0.00% 64 151 0.00% 65 167 0.00% 66 155 0.00% 67 178 0.00% 68 168 0.00% 69 208 0.00% 70 185 0.00% 71 199 0.00% 72 232 0.00% 73 260 0.00% 74 259 0.00% 75 288 0.00% 76 266 0.00% 77 289 0.00% 78 343 0.00% 79 425 0.00% 80 406 0.00% 81 461 0.00% 82 536 0.00% 83 538 0.00% 84 619 0.00% 85 733 0.00% 86 813 0.00% 87 843 0.00% 88 921 0.00% 89 1032 0.00% 90 1091 0.00% 91 1263 0.00% 92 1481 0.00% 93 1585 0.00% 94 1811 0.00% 95 1870 0.00% 96 2093 0.01% 97 2243 0.01% 98 2470 0.01% 99 2760 0.01% 100 2989 0.01% 101 3148 0.01% 102 3456 0.01% 103 3901 0.01% 104 3976 0.01% 105 4551 0.01% 106 4830 0.01% 107 4968 0.01% 108 5511 0.01% 109 5927 0.01% 110 6215 0.02% 111 6581 0.02% 112 7204 0.02% 113 7596 0.02% 114 8114 0.02% 115 8772 0.02% 116 9066 0.02% 117 9683 0.02% 118 10260 0.03% 119 10612 0.03% 120 11169 0.03% 121 11705 0.03% 122 12597 0.03% 123 13492 0.03% 124 14015 0.04% 125 14839 0.04% 126 15333 0.04% 127 16087 0.04% 128 16769 0.04% 129 17716 0.04% 130 17770 0.04% 131 19306 0.05% 132 19943 0.05% 133 21119 0.05% 134 21838 0.05% 135 22893 0.06% 136 23896 0.06% 137 24472 0.06% 138 25274 0.06% 139 26256 0.07% 140 27321 0.07% 141 28559 0.07% 142 29467 0.07% 143 30660 0.08% 144 32190 0.08% 145 33855 0.08% 146 34578 0.09% 147 35882 0.09% 148 36890 0.09% 149 37415 0.09% 150 39150 0.10% 151 39076646 97.77% 39969318 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=31 prefix-density=0.27 prefix-fanout=2.1 sequence=GGGTACTCCTTCTTGACCTCCTCCAGCTCCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=118.64 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=11.1 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=5.04 fanout-score-rank=22 prefix-density=0.36 prefix-fanout=3.6 sequence=AAGATGTACCCAGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=18 fanout-score=149.15 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=22.4 sequence=CGCCGCCGCCGTC SRR7804239 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 19:23:04 Started mapping on | Dec 07 19:23:04 Finished on | Dec 07 19:29:21 Mapping speed, Million of reads per hour | 381.67 Number of input reads | 39969318 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 38185591 Uniquely mapped reads % | 95.54% Average mapped length | 300.14 Number of splices: Total | 40749168 Number of splices: Annotated (sjdb) | 38396094 Number of splices: GT/AG | 40235898 Number of splices: GC/AG | 443015 Number of splices: AT/AC | 17710 Number of splices: Non-canonical | 52545 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.75 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414098 % of reads mapped to multiple loci | 1.04% Number of reads mapped to too many loci | 19805 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.02% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1369629 1369629 1369629 N_multimapping 414098 414098 414098 N_noFeature 1213937 37040702 1605587 N_ambiguous 905456 5379 156119 UnstrandedReadsAssigned:36066198 PositiveStrandReadsAssigned:1139510 NegativeStrandReadsAssigned:36423885 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804239 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804239-trimmed-pair1.fastq SRR7804239-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,969,318 reads, 36,712,347 reads pseudoaligned [quant] estimated average fragment length: 330.757 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52973 SRR7804239.ke.tsv 35125 SRR7804239.se.tsv 88098 total ==> SRR7804239.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 607.544 15.5269 0.931984 PNS24247 1044 714.243 97.5712 4.98171 PNS24249 1928 1598.24 326.432 7.44821 PNS24246 1044 714.243 97.5712 4.98171 PNS24248 1044 714.243 97.5712 4.98171 PNS24244 1471 1141.24 177.328 5.66632 PNS24243 293 69.7874 0 0 KQK14069 1603 1273.24 398.459 11.4123 KQK14071 474 188.909 7.9579 1.5362 ==> SRR7804239.se.tsv <== BRADI_1g14170v3 432 BRADI_1g53295v3 963 BRADI_1g59795v3 824 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 1461 BRADI_1g74790v3 3912 BRADI_1g09890v3 0 BRADI_1g77505v3 298 BRADI_1g48960v3 0 SRR7804239 completed mapping pipeline successfully