Starting /dee2/code/volunteer_pipeline.sh SRR7814808 current disk space = 1551417978880 free memory = 1605445344 SRR7814808 SRAfilesize ed2283a47f93f97296f6c99c38af6802 SRR7814808.sra SRR7814808.sra file validated SRR7814808 is paired end SRR7814808 is conventional basespace SRR7814808 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814808_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3825 37.0 37.0 37.0 37.0 37.0 2 36.4255 37.0 37.0 37.0 37.0 37.0 3 36.5445 37.0 37.0 37.0 37.0 37.0 4 36.6225 37.0 37.0 37.0 37.0 37.0 5 36.5915 37.0 37.0 37.0 37.0 37.0 6 36.5155 37.0 37.0 37.0 37.0 37.0 7 36.428 37.0 37.0 37.0 37.0 37.0 8 36.595 37.0 37.0 37.0 37.0 37.0 9 36.5865 37.0 37.0 37.0 37.0 37.0 10-14 36.5789 37.0 37.0 37.0 37.0 37.0 15-19 36.555 37.0 37.0 37.0 37.0 37.0 20-24 36.5263 37.0 37.0 37.0 37.0 37.0 25-29 36.4439 37.0 37.0 37.0 37.0 37.0 30-34 36.3378 37.0 37.0 37.0 37.0 37.0 35-39 36.2579 37.0 37.0 37.0 37.0 37.0 40-44 36.1915 37.0 37.0 37.0 37.0 37.0 45-49 36.1946 37.0 37.0 37.0 37.0 37.0 50-54 36.2374 37.0 37.0 37.0 37.0 37.0 55-59 36.0904 37.0 37.0 37.0 37.0 37.0 60-64 36.102700000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.06099999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.985400000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.0631 37.0 37.0 37.0 37.0 37.0 80-84 36.1015 37.0 37.0 37.0 37.0 37.0 85-89 36.128 37.0 37.0 37.0 37.0 37.0 90-94 36.04979999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.82299999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.4834 37.0 37.0 37.0 34.6 37.0 105-109 35.6206 37.0 37.0 37.0 37.0 37.0 110-114 35.7137 37.0 37.0 37.0 37.0 37.0 115-119 35.5329 37.0 37.0 37.0 37.0 37.0 120-124 35.0241 37.0 37.0 37.0 25.0 37.0 125-129 34.7264 37.0 37.0 37.0 25.0 37.0 130-134 35.2389 37.0 37.0 37.0 29.8 37.0 135-139 35.05799999999999 37.0 37.0 37.0 25.0 37.0 140-144 35.081599999999995 37.0 37.0 37.0 27.4 37.0 145-149 34.98480000000001 37.0 37.0 37.0 27.4 37.0 150-151 34.26775 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 4.0 26 4.0 27 8.0 28 22.0 29 27.0 30 32.0 31 51.0 32 94.0 33 146.0 34 249.0 35 562.0 36 2585.0 37 212.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 55.383074611917884 10.941412118177265 4.156234351527291 29.519278918377566 2 24.85 13.325000000000001 32.125 29.7 3 22.3 19.15 23.674999999999997 34.875 4 27.650000000000002 26.5 19.5 26.35 5 27.250000000000004 29.925 21.55 21.275 6 23.075000000000003 30.349999999999998 24.025 22.55 7 18.95 23.925 37.85 19.275000000000002 8 19.225 23.875 28.775000000000002 28.125 9 21.25 20.45 31.574999999999996 26.724999999999998 10-14 23.849999999999998 26.484999999999996 24.48 25.185000000000002 15-19 23.74 24.9 25.34 26.02 20-24 23.385 25.430000000000003 25.145 26.040000000000003 25-29 24.085 25.355 24.365000000000002 26.195 30-34 23.075000000000003 25.314999999999998 25.15 26.46 35-39 23.68 25.1 25.635 25.585 40-44 23.84 24.865000000000002 25.295 26.0 45-49 24.115000000000002 24.48 25.380000000000003 26.025 50-54 24.395 24.63 24.94 26.035000000000004 55-59 24.345 24.740000000000002 25.124999999999996 25.790000000000003 60-64 24.315 24.65 24.610000000000003 26.424999999999997 65-69 23.97 25.685000000000002 24.745 25.6 70-74 25.05 24.55 24.52 25.88 75-79 24.855 24.310000000000002 24.46 26.375 80-84 25.255 24.38 24.240000000000002 26.125 85-89 24.855 25.55 24.2 25.395 90-94 25.455 24.635 23.7 26.21 95-99 25.03 24.435000000000002 24.21 26.325 100-104 25.005 24.23 24.495 26.27 105-109 25.395 24.4 24.47 25.735000000000003 110-114 25.119999999999997 24.755 24.26 25.865 115-119 25.295 24.025 24.375 26.305 120-124 25.35 25.074999999999996 23.345 26.229999999999997 125-129 25.305 24.605 24.19 25.900000000000002 130-134 25.5 24.37 24.09 26.040000000000003 135-139 25.435000000000002 23.89 23.880000000000003 26.795 140-144 25.119999999999997 24.98 23.990000000000002 25.91 145-149 25.66 24.38 23.93 26.029999999999998 150-151 25.937500000000004 23.962500000000002 23.3125 26.787499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 2.5 28 4.0 29 2.5 30 4.5 31 10.0 32 15.5 33 19.5 34 23.0 35 31.5 36 42.5 37 57.0 38 78.0 39 93.5 40 101.0 41 140.5 42 159.5 43 144.5 44 166.5 45 192.5 46 199.5 47 196.5 48 186.0 49 178.5 50 161.0 51 138.0 52 131.0 53 117.0 54 107.0 55 108.5 56 100.5 57 86.5 58 71.5 59 77.5 60 84.5 61 72.5 62 67.5 63 57.5 64 54.5 65 63.0 66 67.0 67 60.0 68 53.0 69 54.0 70 49.5 71 46.0 72 36.0 73 22.5 74 18.0 75 16.0 76 10.0 77 5.0 78 3.0 79 4.5 80 3.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.62765078490774 83.175 2 7.1881024511153955 13.05 3 1.0465436518865325 2.85 4 0.0550812448361333 0.2 5 0.0 0.0 6 0.02754062241806665 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02754062241806665 0.22499999999999998 >10 0.02754062241806665 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCGTACCATCTCGTAT 14 0.35000000000000003 TruSeq Adapter, Index 3 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCGTACCATCGCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 3 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCGTACCATCTCGTTT 6 0.15 TruSeq Adapter, Index 3 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.7125 0.0 0.0 0.0 0.0 118-119 3.1875 0.0 0.0 0.0 0.0 120-121 3.525 0.0 0.0 0.0 0.0 122-123 4.35 0.0 0.0 0.0 0.0 124-125 4.925 0.0 0.0 0.0 0.0 126-127 5.4375 0.0 0.0 0.0 0.0 128-129 5.8375 0.0 0.0 0.0 0.0 130-131 6.25 0.0 0.0 0.0 0.0 132-133 6.8125 0.0 0.0 0.0 0.0 134-135 7.199999999999999 0.0 0.0 0.0 0.0 136-137 7.7375 0.0 0.0 0.0 0.0 138-139 8.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGCAG 10 0.006830828 145.0 5 >>END_MODULE SRR7814808 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814808_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1235 37.0 37.0 37.0 37.0 37.0 2 35.6115 37.0 37.0 37.0 37.0 37.0 3 35.543 37.0 37.0 37.0 37.0 37.0 4 35.789 37.0 37.0 37.0 37.0 37.0 5 35.712 37.0 37.0 37.0 37.0 37.0 6 35.6375 37.0 37.0 37.0 37.0 37.0 7 35.3795 37.0 37.0 37.0 37.0 37.0 8 35.4215 37.0 37.0 37.0 37.0 37.0 9 35.673 37.0 37.0 37.0 37.0 37.0 10-14 35.519600000000004 37.0 37.0 37.0 37.0 37.0 15-19 35.1609 37.0 37.0 37.0 32.2 37.0 20-24 35.3959 37.0 37.0 37.0 37.0 37.0 25-29 35.203199999999995 37.0 37.0 37.0 34.6 37.0 30-34 34.9455 37.0 37.0 37.0 27.4 37.0 35-39 34.949799999999996 37.0 37.0 37.0 25.0 37.0 40-44 34.6507 37.0 37.0 37.0 25.0 37.0 45-49 34.7469 37.0 37.0 37.0 25.0 37.0 50-54 34.1693 37.0 37.0 37.0 25.0 37.0 55-59 34.0113 37.0 37.0 37.0 25.0 37.0 60-64 34.2932 37.0 37.0 37.0 25.0 37.0 65-69 34.2913 37.0 37.0 37.0 25.0 37.0 70-74 33.9397 37.0 37.0 37.0 25.0 37.0 75-79 33.6845 37.0 37.0 37.0 22.2 37.0 80-84 33.6846 37.0 37.0 37.0 22.2 37.0 85-89 34.0244 37.0 37.0 37.0 25.0 37.0 90-94 33.620099999999994 37.0 37.0 37.0 22.2 37.0 95-99 32.8345 37.0 37.0 37.0 11.0 37.0 100-104 33.2698 37.0 37.0 37.0 16.6 37.0 105-109 32.6877 37.0 34.6 37.0 13.8 37.0 110-114 33.0756 37.0 37.0 37.0 16.6 37.0 115-119 33.187599999999996 37.0 37.0 37.0 16.6 37.0 120-124 32.493 37.0 37.0 37.0 11.0 37.0 125-129 32.62949999999999 37.0 37.0 37.0 11.0 37.0 130-134 32.2232 37.0 32.2 37.0 11.0 37.0 135-139 32.175200000000004 37.0 29.8 37.0 11.0 37.0 140-144 32.3399 37.0 37.0 37.0 11.0 37.0 145-149 32.056400000000004 37.0 29.8 37.0 11.0 37.0 150-151 31.51225 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 5.0 15 10.0 16 6.0 17 4.0 18 4.0 19 4.0 20 3.0 21 16.0 22 31.0 23 36.0 24 56.0 25 70.0 26 84.0 27 82.0 28 96.0 29 111.0 30 130.0 31 139.0 32 164.0 33 225.0 34 352.0 35 775.0 36 1559.0 37 38.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.3 20.075000000000003 6.5 25.124999999999996 2 30.049999999999997 22.675 26.0 21.275 3 25.224999999999998 23.625 27.400000000000002 23.75 4 28.499999999999996 32.225 17.075000000000003 22.2 5 28.675 33.175 16.950000000000003 21.2 6 24.175 35.025 18.65 22.15 7 22.75 19.025 32.925 25.3 8 24.099999999999998 20.974999999999998 23.65 31.275 9 24.2 22.8 25.724999999999998 27.275 10-14 26.945000000000004 25.924999999999997 21.85 25.28 15-19 26.295 25.415 23.380000000000003 24.91 20-24 26.590000000000003 24.38 23.52 25.509999999999998 25-29 26.555 25.185000000000002 23.365 24.895 30-34 26.275 25.380000000000003 23.52 24.825 35-39 25.785000000000004 25.095 24.22 24.9 40-44 25.624999999999996 25.34 23.575 25.46 45-49 26.26 25.285000000000004 23.77 24.685000000000002 50-54 25.575 25.575 24.565 24.285 55-59 25.855 25.2 24.055 24.89 60-64 26.955000000000002 25.45 23.445 24.15 65-69 26.625 25.575 23.505000000000003 24.295 70-74 25.985000000000003 25.929999999999996 23.82 24.265 75-79 25.590000000000003 26.235000000000003 23.919999999999998 24.255 80-84 26.71 26.35 23.09 23.849999999999998 85-89 26.565 26.13 23.145 24.16 90-94 26.790000000000003 26.029999999999998 23.345 23.835 95-99 26.41 26.224999999999998 23.52 23.845 100-104 26.52 26.31 23.830000000000002 23.34 105-109 26.855 26.445 23.62 23.080000000000002 110-114 26.87 26.669999999999998 23.625 22.835 115-119 27.625 25.995 22.52 23.86 120-124 26.605 26.625 23.380000000000003 23.39 125-129 27.115000000000002 26.66 22.88 23.345 130-134 27.6 27.310000000000002 22.84 22.25 135-139 27.24 27.005000000000003 23.18 22.575 140-144 28.095 25.94 23.785 22.18 145-149 27.450000000000003 27.33 22.98 22.24 150-151 28.3375 27.0875 22.8875 21.6875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.5 7 2.0 8 1.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 1.5 15 2.5 16 2.5 17 2.0 18 2.0 19 2.5 20 2.0 21 2.0 22 2.5 23 3.5 24 2.5 25 1.0 26 3.0 27 5.0 28 6.5 29 7.5 30 8.5 31 12.0 32 17.5 33 23.0 34 29.5 35 37.5 36 46.0 37 60.5 38 75.5 39 102.0 40 117.5 41 125.0 42 146.0 43 148.0 44 149.0 45 167.5 46 166.5 47 145.5 48 148.0 49 148.5 50 139.0 51 151.0 52 146.5 53 120.5 54 118.0 55 111.0 56 88.0 57 76.5 58 74.5 59 83.0 60 72.5 61 65.0 62 78.0 63 73.0 64 58.5 65 61.0 66 74.5 67 73.5 68 59.0 69 48.0 70 46.5 71 42.0 72 39.5 73 40.5 74 32.5 75 19.5 76 11.5 77 9.0 78 5.5 79 7.0 80 8.5 81 5.5 82 3.5 83 2.5 84 1.5 85 2.0 86 3.5 87 2.0 88 0.5 89 1.0 90 1.0 91 0.5 92 1.5 93 1.5 94 1.0 95 1.5 96 1.0 97 0.0 98 0.5 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.7753544165758 85.075 2 6.161395856052344 11.3 3 0.8724100327153763 2.4 4 0.08178844056706652 0.3 5 0.0 0.0 6 0.0 0.0 7 0.05452562704471102 0.35000000000000003 8 0.02726281352235551 0.2 9 0.0 0.0 >10 0.02726281352235551 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 15 0.375 No Hit CACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGC 8 0.2 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.7 0.0 0.0 0.0 0.0 114-115 1.9875 0.0 0.0 0.0 0.0 116-117 2.2625 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 3.025 0.0 0.0 0.0 0.0 122-123 3.7875 0.0 0.0 0.0 0.0 124-125 4.25 0.0 0.0 0.0 0.0 126-127 4.65 0.0 0.0 0.0 0.0 128-129 5.012499999999999 0.0 0.0 0.0 0.0 130-131 5.3875 0.0 0.0 0.0 0.0 132-133 5.9125 0.0 0.0 0.0 0.0 134-135 6.2625 0.0 0.0 0.0 0.0 136-137 6.8 0.0 0.0 0.0 0.0 138-139 7.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCCTC 10 0.006830828 145.0 2 >>END_MODULE Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535527 spots for SRR7814808.sra Written 1535527 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra Read 1535510 spots for SRR7814808.sra Written 1535510 spots for SRR7814808.sra SRR ids: ['SRR7814808.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ak12zqtq SRR7814808.sra spots: 30710217 blocks: [[1, 1535510], [1535511, 3071020], [3071021, 4606530], [4606531, 6142040], [6142041, 7677550], [7677551, 9213060], [9213061, 10748570], [10748571, 12284080], [12284081, 13819590], [13819591, 15355100], [15355101, 16890610], [16890611, 18426120], [18426121, 19961630], [19961631, 21497140], [21497141, 23032650], [23032651, 24568160], [24568161, 26103670], [26103671, 27639180], [27639181, 29174690], [29174691, 30710217]] SRR7814808 file size 10384984 SRR7814808 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814808 SRR7814808_1.fastq SRR7814808_2.fastq Input file: SRR7814808_1.fastq Paired file: SRR7814808_2.fastq trimmed: SRR7814808-trimmed-pair1.fastq, SRR7814808-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:45:18 2024 >> started Fri Dec 6 10:45:55 2024 >> done (36.575s) 30710217 read pairs processed; of these: 245 ( 0.00%) short read pairs filtered out after trimming by size control 250339 ( 0.82%) empty read pairs filtered out after trimming by size control 30459633 (99.18%) read pairs available; of these: 3621102 (11.89%) trimmed read pairs available after processing 26838531 (88.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 26 0.00% 20 23 0.00% 21 22 0.00% 22 35 0.00% 23 32 0.00% 24 22 0.00% 25 38 0.00% 26 39 0.00% 27 51 0.00% 28 62 0.00% 29 64 0.00% 30 39 0.00% 31 66 0.00% 32 59 0.00% 33 55 0.00% 34 52 0.00% 35 68 0.00% 36 68 0.00% 37 60 0.00% 38 99 0.00% 39 93 0.00% 40 101 0.00% 41 90 0.00% 42 110 0.00% 43 106 0.00% 44 114 0.00% 45 114 0.00% 46 133 0.00% 47 155 0.00% 48 150 0.00% 49 148 0.00% 50 200 0.00% 51 219 0.00% 52 248 0.00% 53 244 0.00% 54 247 0.00% 55 291 0.00% 56 321 0.00% 57 366 0.00% 58 420 0.00% 59 461 0.00% 60 604 0.00% 61 626 0.00% 62 649 0.00% 63 756 0.00% 64 809 0.00% 65 865 0.00% 66 939 0.00% 67 1083 0.00% 68 1304 0.00% 69 1396 0.00% 70 1647 0.01% 71 1886 0.01% 72 2174 0.01% 73 2427 0.01% 74 2569 0.01% 75 2790 0.01% 76 3171 0.01% 77 3549 0.01% 78 3912 0.01% 79 4559 0.01% 80 5028 0.02% 81 5633 0.02% 82 6387 0.02% 83 7079 0.02% 84 8037 0.03% 85 8462 0.03% 86 9369 0.03% 87 10201 0.03% 88 11122 0.04% 89 11978 0.04% 90 13208 0.04% 91 14548 0.05% 92 15873 0.05% 93 17358 0.06% 94 18886 0.06% 95 20084 0.07% 96 21368 0.07% 97 22193 0.07% 98 23216 0.08% 99 25063 0.08% 100 26470 0.09% 101 28009 0.09% 102 30168 0.10% 103 31534 0.10% 104 33208 0.11% 105 35015 0.11% 106 36260 0.12% 107 37135 0.12% 108 38481 0.13% 109 39870 0.13% 110 41512 0.14% 111 42689 0.14% 112 45076 0.15% 113 47103 0.15% 114 48631 0.16% 115 50324 0.17% 116 52372 0.17% 117 53055 0.17% 118 53588 0.18% 119 55031 0.18% 120 56517 0.19% 121 58614 0.19% 122 59400 0.20% 123 62776 0.21% 124 64662 0.21% 125 65484 0.21% 126 67849 0.22% 127 68429 0.22% 128 68411 0.22% 129 69736 0.23% 130 71533 0.23% 131 72461 0.24% 132 75007 0.25% 133 77405 0.25% 134 80642 0.26% 135 81103 0.27% 136 82602 0.27% 137 82432 0.27% 138 83586 0.27% 139 84802 0.28% 140 86238 0.28% 141 86226 0.28% 142 89453 0.29% 143 90423 0.30% 144 92989 0.31% 145 96603 0.32% 146 100259 0.33% 147 103980 0.34% 148 98528 0.32% 149 99635 0.33% 150 99660 0.33% 151 26838531 88.11% 30459633 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=19.81 fanout-score-rank=10 prefix-density=0.28 prefix-fanout=18.6 sequence=GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCGTACCATCTCGTATGCCGTCTTCTGCTTGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=209.39 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=14.1 sequence=TCTTCTTGGCATGTACAAACCGCTAATTATACTTCTGCTTTGCGATTATACTGATTATACCGGCAGCAGTGTAGCCTATAATAACGAAAATAGATTATCTTTTCTGGAGTACACTCCATGCATCAGTCTCTTATTTATATAAATATAAATATTTCGACGATGCAAATATTTCATACTTTCCGATTGGACACTTTTCAGCGCATTCAACCACGACGATTAGAATCAAGGGTTTTCCATTTCCAACCCCTGCAGGCAGGGGAATTTGCTTATTTTGCAGTCATGGTCACCATGGCCACCATCAGATCGCCTCCCGTCAACGACCACCACCGCCATCGCCTGAGTTTCGCCTGTCTGCTGTCCATCATCTCCGGCCAACTTCCTCGCCGGAGCAGCAGAAGCAGCCGAGGATGTAATCACCAATAGGATGCAGACTAGAACTGCGACTGCCTTCATTCTTCACAAGCTATATGGTTTTCCAAGTACGTTGTGTGGAAAAGAAGTCTATGAAAAA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=7.58 fanout-score-rank=25 prefix-density=1.39 prefix-fanout=1.1 sequence=CAAGTGCGGCAACGGCTGCGGAGGGTGCAAGATGTACCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=247.91 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=26.9 sequence=GCGGCGGCGGCG SRR7814808 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:47:02 Started mapping on | Dec 06 10:47:02 Finished on | Dec 06 10:54:05 Mapping speed, Million of reads per hour | 259.23 Number of input reads | 30459633 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 27411266 Uniquely mapped reads % | 89.99% Average mapped length | 294.12 Number of splices: Total | 25412461 Number of splices: Annotated (sjdb) | 23683535 Number of splices: GT/AG | 25051899 Number of splices: GC/AG | 279867 Number of splices: AT/AC | 16290 Number of splices: Non-canonical | 64405 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.03% Deletion average length | 3.20 Insertion rate per base | 0.03% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414469 % of reads mapped to multiple loci | 1.36% Number of reads mapped to too many loci | 12941 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.36% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2633898 2633898 2633898 N_multimapping 414469 414469 414469 N_noFeature 999868 26608804 1351552 N_ambiguous 531013 3294 80643 UnstrandedReadsAssigned:25880385 PositiveStrandReadsAssigned:799168 NegativeStrandReadsAssigned:25979071 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814808 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814808-trimmed-pair1.fastq SRR7814808-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,459,633 reads, 26,613,470 reads pseudoaligned [quant] estimated average fragment length: 254.242 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR7814808.ke.tsv 35125 SRR7814808.se.tsv 88098 total ==> SRR7814808.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.356 0 0 PNS24247 1044 790.758 122.077 7.8298 PNS24249 1928 1674.76 280.699 8.50057 PNS24246 1044 790.758 122.077 7.8298 PNS24248 1044 790.758 122.077 7.8298 PNS24244 1471 1217.76 219.068 9.12384 PNS24243 293 97.0614 2 1.04506 KQK14069 1603 1349.76 9833.35 369.492 KQK14071 474 239.916 28.2457 5.97109 ==> SRR7814808.se.tsv <== BRADI_1g14170v3 9860 BRADI_1g53295v3 2086 BRADI_1g59795v3 142 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 1324 BRADI_1g74790v3 286 BRADI_1g09890v3 0 BRADI_1g77505v3 404 BRADI_1g48960v3 0 SRR7814808 completed mapping pipeline successfully