Starting /dee2/code/volunteer_pipeline.sh SRR7814809 current disk space = 1551403155456 free memory = 1604606748 SRR7814809 SRAfilesize 64eed0de54319f472350050afc5902d1 SRR7814809.sra SRR7814809.sra file validated SRR7814809 is paired end SRR7814809 is conventional basespace SRR7814809 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814809_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3975 37.0 37.0 37.0 37.0 37.0 2 36.4265 37.0 37.0 37.0 37.0 37.0 3 36.423 37.0 37.0 37.0 37.0 37.0 4 36.5 37.0 37.0 37.0 37.0 37.0 5 36.664 37.0 37.0 37.0 37.0 37.0 6 36.491 37.0 37.0 37.0 37.0 37.0 7 36.517 37.0 37.0 37.0 37.0 37.0 8 36.4635 37.0 37.0 37.0 37.0 37.0 9 36.564 37.0 37.0 37.0 37.0 37.0 10-14 36.5359 37.0 37.0 37.0 37.0 37.0 15-19 36.5409 37.0 37.0 37.0 37.0 37.0 20-24 36.5094 37.0 37.0 37.0 37.0 37.0 25-29 36.4931 37.0 37.0 37.0 37.0 37.0 30-34 36.42960000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4193 37.0 37.0 37.0 37.0 37.0 40-44 36.4112 37.0 37.0 37.0 37.0 37.0 45-49 36.402899999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.383500000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.376200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3221 37.0 37.0 37.0 37.0 37.0 65-69 36.333600000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.3769 37.0 37.0 37.0 37.0 37.0 75-79 36.2926 37.0 37.0 37.0 37.0 37.0 80-84 36.268100000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.22260000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.2042 37.0 37.0 37.0 37.0 37.0 95-99 36.208099999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.1696 37.0 37.0 37.0 37.0 37.0 105-109 36.1987 37.0 37.0 37.0 37.0 37.0 110-114 36.1156 37.0 37.0 37.0 37.0 37.0 115-119 36.0886 37.0 37.0 37.0 37.0 37.0 120-124 35.9148 37.0 37.0 37.0 37.0 37.0 125-129 35.9237 37.0 37.0 37.0 37.0 37.0 130-134 35.919200000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.920500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.871900000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.908699999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.21425 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 1.0 26 2.0 27 3.0 28 11.0 29 22.0 30 24.0 31 32.0 32 61.0 33 102.0 34 148.0 35 325.0 36 2825.0 37 441.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.30858003010537 10.863020572002007 5.193176116407426 38.635223281485196 2 26.125 13.725000000000001 32.4 27.750000000000004 3 20.9 17.95 24.349999999999998 36.8 4 28.125 26.55 19.275000000000002 26.05 5 28.1 28.625 21.349999999999998 21.925 6 22.375 31.95 23.7 21.975 7 17.974999999999998 23.75 39.25 19.025 8 19.925 23.325000000000003 29.599999999999998 27.150000000000002 9 21.475 19.15 32.85 26.525 10-14 23.985 25.705 24.97 25.34 15-19 24.275 25.195 24.715 25.814999999999998 20-24 24.085 24.955 24.645 26.314999999999998 25-29 24.25 24.92 24.57 26.26 30-34 24.04 24.98 24.455 26.525 35-39 23.855 25.06 24.84 26.245 40-44 23.76 25.124999999999996 24.11 27.005000000000003 45-49 24.325 24.615000000000002 24.65 26.41 50-54 24.645 24.585 24.404999999999998 26.365 55-59 24.6 24.995 24.505 25.900000000000002 60-64 24.825 24.33 24.310000000000002 26.534999999999997 65-69 24.26 23.945 25.319999999999997 26.474999999999998 70-74 24.68 24.884999999999998 24.27 26.165 75-79 24.48 24.285 24.349999999999998 26.884999999999998 80-84 24.745 24.82 24.245 26.19 85-89 25.455 24.09 23.615 26.840000000000003 90-94 25.915 24.565 23.880000000000003 25.64 95-99 24.86 24.435000000000002 24.32 26.384999999999998 100-104 24.915000000000003 24.685000000000002 24.060000000000002 26.340000000000003 105-109 25.424999999999997 24.385 24.46 25.729999999999997 110-114 24.735 24.33 24.09 26.845000000000002 115-119 25.09 25.040000000000003 23.76 26.11 120-124 25.369999999999997 24.895 23.205000000000002 26.529999999999998 125-129 25.355 23.69 24.48 26.474999999999998 130-134 25.44 24.165 23.75 26.645000000000003 135-139 25.845000000000002 24.425 23.150000000000002 26.58 140-144 25.155 24.39 23.974999999999998 26.479999999999997 145-149 25.945 24.59 22.86 26.605 150-151 25.637500000000003 23.95 24.0375 26.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 2.0 24 0.0 25 1.0 26 4.0 27 5.5 28 4.0 29 4.5 30 7.0 31 11.0 32 16.0 33 18.0 34 25.0 35 36.5 36 41.0 37 61.5 38 83.0 39 85.5 40 98.5 41 119.5 42 153.5 43 180.0 44 178.5 45 187.5 46 193.0 47 175.5 48 165.0 49 159.5 50 142.0 51 123.0 52 119.5 53 107.0 54 92.5 55 89.0 56 87.0 57 89.0 58 85.5 59 84.0 60 87.0 61 94.5 62 83.0 63 64.5 64 69.0 65 65.0 66 58.0 67 60.0 68 59.0 69 55.0 70 51.5 71 49.5 72 37.0 73 28.5 74 26.5 75 25.0 76 18.5 77 6.5 78 7.5 79 9.0 80 3.5 81 2.0 82 2.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.875 #Duplication Level Percentage of deduplicated Percentage of total 1 90.01390820584145 80.9 2 8.789986091794159 15.8 3 1.1126564673157162 3.0 4 0.08344923504867872 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7124999999999999 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.5125 0.0 0.0 0.0 0.0 104-105 1.6625 0.0 0.0 0.0 0.0 106-107 1.8875 0.0 0.0 0.0 0.0 108-109 2.1624999999999996 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.7125 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.3 0.0 0.0 0.0 0.0 118-119 3.625 0.0 0.0 0.0 0.0 120-121 4.1 0.0 0.0 0.0 0.0 122-123 4.725 0.0 0.0 0.0 0.0 124-125 5.125 0.0 0.0 0.0 0.0 126-127 5.45 0.0 0.0 0.0 0.0 128-129 5.975 0.0 0.0 0.0 0.0 130-131 6.550000000000001 0.0 0.0 0.0 0.0 132-133 7.074999999999999 0.0 0.0 0.0 0.0 134-135 7.737500000000001 0.0 0.0 0.0 0.0 136-137 8.2375 0.0 0.0 0.0 0.0 138-139 8.774999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCAGC 10 0.006577216 146.82278 1 GTGTTTC 10 0.006577216 146.82278 1 TTCTGTG 10 0.006832588 144.9875 5 GTTTCTG 10 0.006832588 144.9875 3 TGCAGCA 10 0.006832588 144.9875 145 >>END_MODULE SRR7814809 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814809_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.233 37.0 37.0 37.0 37.0 37.0 2 35.9605 37.0 37.0 37.0 37.0 37.0 3 35.9515 37.0 37.0 37.0 37.0 37.0 4 36.0275 37.0 37.0 37.0 37.0 37.0 5 36.0775 37.0 37.0 37.0 37.0 37.0 6 35.998 37.0 37.0 37.0 37.0 37.0 7 35.941 37.0 37.0 37.0 37.0 37.0 8 36.181 37.0 37.0 37.0 37.0 37.0 9 36.1535 37.0 37.0 37.0 37.0 37.0 10-14 36.1593 37.0 37.0 37.0 37.0 37.0 15-19 36.045399999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.06099999999999 37.0 37.0 37.0 37.0 37.0 25-29 35.946 37.0 37.0 37.0 37.0 37.0 30-34 36.0008 37.0 37.0 37.0 37.0 37.0 35-39 35.9396 37.0 37.0 37.0 37.0 37.0 40-44 35.9654 37.0 37.0 37.0 37.0 37.0 45-49 35.894600000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.889500000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.7789 37.0 37.0 37.0 37.0 37.0 60-64 35.825300000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.7456 37.0 37.0 37.0 37.0 37.0 70-74 35.7593 37.0 37.0 37.0 37.0 37.0 75-79 35.687400000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.7076 37.0 37.0 37.0 37.0 37.0 85-89 35.59 37.0 37.0 37.0 37.0 37.0 90-94 35.4905 37.0 37.0 37.0 37.0 37.0 95-99 35.614599999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.5385 37.0 37.0 37.0 37.0 37.0 105-109 35.5454 37.0 37.0 37.0 37.0 37.0 110-114 35.4007 37.0 37.0 37.0 37.0 37.0 115-119 35.2869 37.0 37.0 37.0 34.6 37.0 120-124 35.3283 37.0 37.0 37.0 32.2 37.0 125-129 35.2299 37.0 37.0 37.0 32.2 37.0 130-134 35.1932 37.0 37.0 37.0 29.8 37.0 135-139 35.01899999999999 37.0 37.0 37.0 27.4 37.0 140-144 34.799099999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.7946 37.0 37.0 37.0 25.0 37.0 150-151 34.20825000000001 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 4.0 15 3.0 16 2.0 17 3.0 18 3.0 19 2.0 20 2.0 21 6.0 22 7.0 23 6.0 24 6.0 25 6.0 26 11.0 27 10.0 28 22.0 29 25.0 30 35.0 31 54.0 32 86.0 33 157.0 34 252.0 35 629.0 36 2472.0 37 193.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.65 16.675 9.425 34.25 2 29.9 22.6 27.900000000000002 19.6 3 22.525000000000002 24.975 27.625 24.875 4 28.125 29.025000000000002 19.725 23.125 5 27.375 32.45 19.15 21.025 6 24.125 34.575 18.975 22.325 7 24.05 16.725 34.0 25.224999999999998 8 22.825 22.55 24.875 29.75 9 25.55 20.849999999999998 25.424999999999997 28.175 10-14 26.61 24.955 21.86 26.575 15-19 26.44 24.68 22.895 25.985000000000003 20-24 26.284999999999997 24.595 23.03 26.090000000000003 25-29 26.419999999999998 23.990000000000002 22.955000000000002 26.634999999999998 30-34 26.075 24.66 23.51 25.755 35-39 26.055 24.54 23.48 25.924999999999997 40-44 27.029999999999998 24.125 22.994999999999997 25.85 45-49 25.985000000000003 24.535 23.385 26.095000000000002 50-54 26.06 24.235 23.65 26.055 55-59 26.76 23.919999999999998 22.975 26.345000000000002 60-64 25.845000000000002 24.265 23.330000000000002 26.56 65-69 26.015 23.735 23.51 26.740000000000002 70-74 27.08 23.53 23.205000000000002 26.185000000000002 75-79 26.095000000000002 24.404999999999998 23.385 26.115 80-84 26.795 24.115000000000002 23.265 25.825 85-89 26.735 24.215 23.630000000000003 25.419999999999998 90-94 26.939999999999998 24.42 23.385 25.255 95-99 27.04 23.635 23.175 26.150000000000002 100-104 26.36 24.3 23.45 25.89 105-109 26.484999999999996 24.154999999999998 23.655 25.705 110-114 26.47 24.59 23.825 25.115 115-119 27.305 24.72 22.82 25.155 120-124 27.16 24.715 22.45 25.674999999999997 125-129 27.605 25.0 22.720000000000002 24.675 130-134 28.105000000000004 24.63 23.04 24.224999999999998 135-139 27.875 24.12 23.380000000000003 24.625 140-144 27.944999999999997 25.124999999999996 23.11 23.82 145-149 28.455000000000002 24.42 23.275000000000002 23.849999999999998 150-151 29.225 24.337500000000002 23.2125 23.225 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 0.5 23 0.5 24 1.0 25 0.5 26 2.5 27 3.5 28 6.5 29 11.0 30 9.5 31 9.5 32 11.5 33 15.5 34 21.0 35 27.5 36 35.5 37 49.0 38 63.5 39 77.0 40 92.5 41 109.0 42 125.0 43 142.5 44 153.5 45 153.0 46 160.5 47 163.0 48 152.0 49 139.0 50 133.0 51 120.5 52 113.0 53 113.0 54 108.5 55 99.5 56 87.0 57 101.5 58 112.5 59 95.5 60 86.5 61 83.5 62 82.0 63 95.0 64 98.0 65 98.0 66 87.5 67 66.5 68 65.0 69 78.5 70 68.5 71 53.0 72 52.5 73 43.0 74 30.0 75 19.5 76 17.5 77 13.0 78 5.5 79 4.0 80 4.5 81 3.5 82 3.5 83 2.5 84 1.5 85 0.5 86 0.5 87 0.5 88 1.0 89 1.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 1.0 96 1.0 97 0.5 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.78794642857143 80.45 2 8.956473214285714 16.05 3 1.1160714285714286 3.0 4 0.13950892857142858 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.9125000000000001 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.2125000000000004 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.75 0.0 0.0 0.0 0.0 114-115 2.9749999999999996 0.0 0.0 0.0 0.0 116-117 3.325 0.0 0.0 0.0 0.0 118-119 3.6624999999999996 0.0 0.0 0.0 0.0 120-121 4.125 0.0 0.0 0.0 0.0 122-123 4.725 0.0 0.0 0.0 0.0 124-125 5.1 0.0 0.0 0.0 0.0 126-127 5.4125 0.0 0.0 0.0 0.0 128-129 5.9375 0.0 0.0 0.0 0.0 130-131 6.550000000000001 0.0 0.0 0.0 0.0 132-133 7.0875 0.0 0.0 0.0 0.0 134-135 7.75 0.0 0.0 0.0 0.0 136-137 8.25 0.0 0.0 0.0 0.0 138-139 8.725000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGAAG 10 0.006830828 145.0 4 TTTTGAA 10 0.006830828 145.0 3 GTTGAAT 10 0.006830828 145.0 1 TCCCAGA 10 0.006830828 145.0 7 TTTTTTT 20 0.00593511 29.0 10-14 >>END_MODULE Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200495 spots for SRR7814809.sra Written 3200495 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra Read 3200479 spots for SRR7814809.sra Written 3200479 spots for SRR7814809.sra SRR ids: ['SRR7814809.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1si689ld SRR7814809.sra spots: 64009596 blocks: [[1, 3200479], [3200480, 6400958], [6400959, 9601437], [9601438, 12801916], [12801917, 16002395], [16002396, 19202874], [19202875, 22403353], [22403354, 25603832], [25603833, 28804311], [28804312, 32004790], [32004791, 35205269], [35205270, 38405748], [38405749, 41606227], [41606228, 44806706], [44806707, 48007185], [48007186, 51207664], [51207665, 54408143], [54408144, 57608622], [57608623, 60809101], [60809102, 64009596]] SRR7814809 file size 21669051 SRR7814809 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814809 SRR7814809_1.fastq SRR7814809_2.fastq Input file: SRR7814809_1.fastq Paired file: SRR7814809_2.fastq trimmed: SRR7814809-trimmed-pair1.fastq, SRR7814809-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:51:30 2024 >> started Fri Dec 6 10:52:46 2024 >> done (76.009s) 64009596 read pairs processed; of these: 300 ( 0.00%) short read pairs filtered out after trimming by size control 9030 ( 0.01%) empty read pairs filtered out after trimming by size control 64000266 (99.99%) read pairs available; of these: 7088579 (11.08%) trimmed read pairs available after processing 56911687 (88.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 24 0.00% 20 14 0.00% 21 20 0.00% 22 40 0.00% 23 33 0.00% 24 25 0.00% 25 38 0.00% 26 35 0.00% 27 40 0.00% 28 57 0.00% 29 73 0.00% 30 77 0.00% 31 81 0.00% 32 89 0.00% 33 86 0.00% 34 77 0.00% 35 82 0.00% 36 80 0.00% 37 83 0.00% 38 106 0.00% 39 132 0.00% 40 123 0.00% 41 125 0.00% 42 164 0.00% 43 147 0.00% 44 157 0.00% 45 174 0.00% 46 176 0.00% 47 193 0.00% 48 261 0.00% 49 270 0.00% 50 292 0.00% 51 361 0.00% 52 385 0.00% 53 394 0.00% 54 368 0.00% 55 474 0.00% 56 509 0.00% 57 562 0.00% 58 701 0.00% 59 806 0.00% 60 918 0.00% 61 1012 0.00% 62 1206 0.00% 63 1330 0.00% 64 1324 0.00% 65 1485 0.00% 66 1741 0.00% 67 1853 0.00% 68 2114 0.00% 69 2381 0.00% 70 2862 0.00% 71 3374 0.01% 72 3643 0.01% 73 4308 0.01% 74 4729 0.01% 75 5051 0.01% 76 5819 0.01% 77 6320 0.01% 78 7213 0.01% 79 8063 0.01% 80 8956 0.01% 81 9945 0.02% 82 11431 0.02% 83 12955 0.02% 84 14111 0.02% 85 15827 0.02% 86 16920 0.03% 87 18494 0.03% 88 20669 0.03% 89 22201 0.03% 90 23913 0.04% 91 26781 0.04% 92 29343 0.05% 93 31395 0.05% 94 34477 0.05% 95 36892 0.06% 96 39554 0.06% 97 42725 0.07% 98 44344 0.07% 99 47486 0.07% 100 50381 0.08% 101 53415 0.08% 102 56902 0.09% 103 60431 0.09% 104 63501 0.10% 105 66587 0.10% 106 70487 0.11% 107 72333 0.11% 108 75503 0.12% 109 78748 0.12% 110 81067 0.13% 111 84304 0.13% 112 88748 0.14% 113 92873 0.15% 114 95450 0.15% 115 100333 0.16% 116 102287 0.16% 117 106074 0.17% 118 106717 0.17% 119 109950 0.17% 120 112861 0.18% 121 115413 0.18% 122 119490 0.19% 123 123885 0.19% 124 127973 0.20% 125 131007 0.20% 126 133327 0.21% 127 136397 0.21% 128 138107 0.22% 129 141387 0.22% 130 142882 0.22% 131 144692 0.23% 132 149784 0.23% 133 153590 0.24% 134 156659 0.24% 135 160002 0.25% 136 162498 0.25% 137 163935 0.26% 138 165358 0.26% 139 169451 0.26% 140 170464 0.27% 141 173185 0.27% 142 178244 0.28% 143 179334 0.28% 144 185108 0.29% 145 187400 0.29% 146 189644 0.30% 147 191126 0.30% 148 194046 0.30% 149 193872 0.30% 150 198256 0.31% 151 56911687 88.92% 64000266 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=16 prefix-density=0.70 prefix-fanout=3.3 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=42.90 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=4.07 fanout-score-rank=12 prefix-density=0.67 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=101.79 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=5.9 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7814809 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:53:36 Started mapping on | Dec 06 10:53:36 Finished on | Dec 06 11:03:09 Mapping speed, Million of reads per hour | 402.10 Number of input reads | 64000266 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 59740245 Uniquely mapped reads % | 93.34% Average mapped length | 295.39 Number of splices: Total | 58638483 Number of splices: Annotated (sjdb) | 55323318 Number of splices: GT/AG | 57834911 Number of splices: GC/AG | 649106 Number of splices: AT/AC | 20462 Number of splices: Non-canonical | 134004 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 996314 % of reads mapped to multiple loci | 1.56% Number of reads mapped to too many loci | 80322 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.18% % of reads unmapped: other | 0.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3263707 3263707 3263707 N_multimapping 996314 996314 996314 N_noFeature 2148381 57914242 2803736 N_ambiguous 1441688 8377 271766 UnstrandedReadsAssigned:56150176 PositiveStrandReadsAssigned:1817626 NegativeStrandReadsAssigned:56664743 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814809 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814809-trimmed-pair1.fastq SRR7814809-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 64,000,266 reads, 57,166,905 reads pseudoaligned [quant] estimated average fragment length: 264.935 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52973 SRR7814809.ke.tsv 35125 SRR7814809.se.tsv 88098 total ==> SRR7814809.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.497 0 0 PNS24247 1044 780.065 210.055 6.4257 PNS24249 1928 1664.06 535.745 7.68255 PNS24246 1044 780.065 210.055 6.4257 PNS24248 1044 780.065 210.055 6.4257 PNS24244 1471 1207.06 348.089 6.8814 PNS24243 293 96.2875 2 0.495652 KQK14069 1603 1339.06 27577.1 491.433 KQK14071 474 235.4 583.887 59.1888 ==> SRR7814809.se.tsv <== BRADI_1g14170v3 31469 BRADI_1g53295v3 10251 BRADI_1g59795v3 348 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 1741 BRADI_1g74790v3 1972 BRADI_1g09890v3 3 BRADI_1g77505v3 676 BRADI_1g48960v3 0 SRR7814809 completed mapping pipeline successfully