Starting /dee2/code/volunteer_pipeline.sh SRR7814812 current disk space = 1551490420736 free memory = 1605411744 SRR7814812 SRAfilesize cc8272e85be873904840e557b25cd942 SRR7814812.sra SRR7814812.sra file validated SRR7814812 is paired end SRR7814812 is conventional basespace SRR7814812 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814812_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.115 37.0 37.0 37.0 37.0 37.0 2 36.2105 37.0 37.0 37.0 37.0 37.0 3 36.3385 37.0 37.0 37.0 37.0 37.0 4 36.4945 37.0 37.0 37.0 37.0 37.0 5 36.5265 37.0 37.0 37.0 37.0 37.0 6 36.5535 37.0 37.0 37.0 37.0 37.0 7 36.37 37.0 37.0 37.0 37.0 37.0 8 36.4595 37.0 37.0 37.0 37.0 37.0 9 36.517 37.0 37.0 37.0 37.0 37.0 10-14 36.483799999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.514300000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.455799999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4008 37.0 37.0 37.0 37.0 37.0 30-34 36.3889 37.0 37.0 37.0 37.0 37.0 35-39 36.3271 37.0 37.0 37.0 37.0 37.0 40-44 36.3297 37.0 37.0 37.0 37.0 37.0 45-49 36.2559 37.0 37.0 37.0 37.0 37.0 50-54 36.2818 37.0 37.0 37.0 37.0 37.0 55-59 36.275400000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.1891 37.0 37.0 37.0 37.0 37.0 65-69 36.13869999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.0656 37.0 37.0 37.0 37.0 37.0 75-79 36.059799999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.074 37.0 37.0 37.0 37.0 37.0 85-89 35.9738 37.0 37.0 37.0 37.0 37.0 90-94 35.8788 37.0 37.0 37.0 37.0 37.0 95-99 35.8257 37.0 37.0 37.0 37.0 37.0 100-104 35.7617 37.0 37.0 37.0 37.0 37.0 105-109 35.7752 37.0 37.0 37.0 37.0 37.0 110-114 35.751 37.0 37.0 37.0 37.0 37.0 115-119 35.6467 37.0 37.0 37.0 37.0 37.0 120-124 35.597500000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.54729999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.3711 37.0 37.0 37.0 34.6 37.0 135-139 35.2417 37.0 37.0 37.0 32.2 37.0 140-144 35.2418 37.0 37.0 37.0 32.2 37.0 145-149 35.0058 37.0 37.0 37.0 25.0 37.0 150-151 34.38475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 0.0 23 1.0 24 2.0 25 5.0 26 11.0 27 13.0 28 16.0 29 29.0 30 35.0 31 65.0 32 75.0 33 123.0 34 166.0 35 456.0 36 2729.0 37 271.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 57.39719157472417 8.876629889669008 5.366098294884654 28.36008024072217 2 27.275 11.575000000000001 30.049999999999997 31.1 3 22.75 17.8 24.4 35.05 4 29.275000000000002 23.95 20.474999999999998 26.3 5 27.875 27.825 23.5 20.8 6 24.85 31.5 20.674999999999997 22.975 7 19.275000000000002 22.15 36.95 21.625 8 21.325 22.2 28.749999999999996 27.725 9 22.400000000000002 19.625 31.825 26.150000000000002 10-14 25.624999999999996 24.515 24.349999999999998 25.509999999999998 15-19 25.935000000000002 23.044999999999998 24.185000000000002 26.834999999999997 20-24 25.14 24.005000000000003 23.91 26.945000000000004 25-29 25.41 24.345 23.565 26.68 30-34 25.295 23.525 24.135 27.045 35-39 25.03 23.145 23.635 28.189999999999998 40-44 25.505 23.895 23.775 26.825 45-49 25.215 23.115 24.195 27.474999999999998 50-54 25.290000000000003 23.72 23.555 27.435 55-59 25.85 23.345 23.685000000000002 27.12 60-64 25.09 23.57 23.775 27.565 65-69 25.855 23.14 23.799999999999997 27.205000000000002 70-74 26.26 23.419999999999998 23.36 26.96 75-79 26.19 23.200000000000003 23.955000000000002 26.655 80-84 25.814999999999998 23.65 23.345 27.189999999999998 85-89 25.825 22.85 23.685000000000002 27.639999999999997 90-94 26.540000000000003 22.91 23.555 26.995 95-99 26.56 23.04 23.494999999999997 26.905 100-104 26.66 23.06 23.724999999999998 26.555 105-109 26.900000000000002 22.770000000000003 23.849999999999998 26.479999999999997 110-114 26.064999999999998 24.365000000000002 22.884999999999998 26.685 115-119 26.650000000000002 23.955000000000002 23.669999999999998 25.724999999999998 120-124 27.075 23.794999999999998 22.395 26.735 125-129 26.88 23.515 22.625 26.979999999999997 130-134 26.900000000000002 23.03 22.875 27.195000000000004 135-139 26.314999999999998 23.580000000000002 23.48 26.625 140-144 26.63 22.74 23.385 27.245 145-149 26.83 22.925 23.49 26.755000000000003 150-151 26.924999999999997 24.0625 22.6375 26.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 0.5 25 1.5 26 2.5 27 2.0 28 1.0 29 1.0 30 4.5 31 7.5 32 9.5 33 10.5 34 16.5 35 26.0 36 34.5 37 45.0 38 54.0 39 70.5 40 92.0 41 103.0 42 131.5 43 159.0 44 146.5 45 148.0 46 163.0 47 158.5 48 145.5 49 137.5 50 127.5 51 117.5 52 123.5 53 127.0 54 108.0 55 95.0 56 97.0 57 98.5 58 97.0 59 101.5 60 113.5 61 102.0 62 88.5 63 93.5 64 93.0 65 93.0 66 89.5 67 84.0 68 71.0 69 59.5 70 60.0 71 52.0 72 49.0 73 42.5 74 33.5 75 28.5 76 18.5 77 12.0 78 10.5 79 13.0 80 11.5 81 5.0 82 3.0 83 1.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.375 #Duplication Level Percentage of deduplicated Percentage of total 1 93.52074966532797 87.325 2 6.024096385542169 11.25 3 0.34805890227576974 0.975 4 0.08032128514056225 0.3 5 0.0 0.0 6 0.02677376171352075 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAGAGACTCCACGGAGAGAGGGGGCAGGTACGAGAGGGTCTCGAACTTC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0125 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.037500000000000006 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.0625 0.0 0.0 0.025 0.0 80-81 0.125 0.0 0.0 0.025 0.0 82-83 0.16249999999999998 0.0 0.0 0.025 0.0 84-85 0.2 0.0 0.0 0.025 0.0 86-87 0.2 0.0 0.0 0.025 0.0 88-89 0.3 0.0 0.0 0.025 0.0 90-91 0.3375 0.0 0.0 0.025 0.0 92-93 0.3875 0.0 0.0 0.025 0.0 94-95 0.525 0.0 0.0 0.025 0.0 96-97 0.6375 0.0 0.0 0.025 0.0 98-99 0.75 0.0 0.0 0.025 0.0 100-101 0.8875 0.0 0.0 0.025 0.0 102-103 1.05 0.0 0.0 0.025 0.0 104-105 1.325 0.0 0.0 0.025 0.0 106-107 1.5125000000000002 0.0 0.0 0.025 0.0 108-109 1.7374999999999998 0.0 0.0 0.025 0.0 110-111 1.9625 0.0 0.0 0.025 0.0 112-113 2.2375 0.0 0.0 0.025 0.0 114-115 2.5125 0.0 0.0 0.025 0.0 116-117 2.8 0.0 0.0 0.025 0.0 118-119 3.1375 0.0 0.0 0.025 0.0 120-121 3.425 0.0 0.0 0.025 0.0 122-123 3.8625 0.0 0.0 0.025 0.0 124-125 4.275 0.0 0.0 0.025 0.0 126-127 4.575 0.0 0.0 0.025 0.0 128-129 5.05 0.0 0.0 0.025 0.0 130-131 5.4125 0.0 0.0 0.025 0.0 132-133 5.7875 0.0 0.0 0.025 0.0 134-135 6.225 0.0 0.0 0.025 0.0 136-137 6.875 0.0 0.0 0.025 0.0 138-139 7.375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAAGA 10 0.006830828 145.0 3 GGACAAA 10 0.006830828 145.0 1 ATTGTAG 10 0.006830828 145.0 7 GACAAAG 10 0.006830828 145.0 2 TCGGAAG 65 0.0076375785 13.384615 140-144 >>END_MODULE SRR7814812 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814812_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2015 37.0 37.0 37.0 37.0 37.0 2 35.991 37.0 37.0 37.0 37.0 37.0 3 35.939 37.0 37.0 37.0 37.0 37.0 4 36.069 37.0 37.0 37.0 37.0 37.0 5 36.046 37.0 37.0 37.0 37.0 37.0 6 35.9845 37.0 37.0 37.0 37.0 37.0 7 35.9505 37.0 37.0 37.0 37.0 37.0 8 36.1355 37.0 37.0 37.0 37.0 37.0 9 36.0115 37.0 37.0 37.0 37.0 37.0 10-14 35.9634 37.0 37.0 37.0 37.0 37.0 15-19 35.8526 37.0 37.0 37.0 37.0 37.0 20-24 35.7914 37.0 37.0 37.0 37.0 37.0 25-29 35.73799999999999 37.0 37.0 37.0 37.0 37.0 30-34 35.6632 37.0 37.0 37.0 37.0 37.0 35-39 35.6358 37.0 37.0 37.0 37.0 37.0 40-44 35.5784 37.0 37.0 37.0 37.0 37.0 45-49 35.5556 37.0 37.0 37.0 37.0 37.0 50-54 35.5899 37.0 37.0 37.0 37.0 37.0 55-59 35.441700000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.3995 37.0 37.0 37.0 37.0 37.0 65-69 35.35809999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.19799999999999 37.0 37.0 37.0 34.6 37.0 75-79 35.2505 37.0 37.0 37.0 37.0 37.0 80-84 35.106100000000005 37.0 37.0 37.0 27.4 37.0 85-89 35.0712 37.0 37.0 37.0 29.8 37.0 90-94 35.0156 37.0 37.0 37.0 27.4 37.0 95-99 34.796400000000006 37.0 37.0 37.0 25.0 37.0 100-104 34.8564 37.0 37.0 37.0 25.0 37.0 105-109 34.780199999999994 37.0 37.0 37.0 25.0 37.0 110-114 34.63000000000001 37.0 37.0 37.0 25.0 37.0 115-119 34.58839999999999 37.0 37.0 37.0 25.0 37.0 120-124 34.5254 37.0 37.0 37.0 25.0 37.0 125-129 34.4623 37.0 37.0 37.0 25.0 37.0 130-134 34.2042 37.0 37.0 37.0 25.0 37.0 135-139 33.8558 37.0 37.0 37.0 25.0 37.0 140-144 33.7704 37.0 37.0 37.0 25.0 37.0 145-149 33.6138 37.0 37.0 37.0 25.0 37.0 150-151 32.9795 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 8.0 14 12.0 15 9.0 16 6.0 17 7.0 18 7.0 19 8.0 20 7.0 21 14.0 22 9.0 23 10.0 24 13.0 25 15.0 26 11.0 27 16.0 28 17.0 29 29.0 30 41.0 31 67.0 32 109.0 33 178.0 34 350.0 35 858.0 36 2118.0 37 79.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.975 18.0 6.175 25.85 2 30.45 21.725 25.2 22.625 3 25.2 22.325 25.650000000000002 26.825 4 30.125 28.475 16.7 24.7 5 30.099999999999998 32.550000000000004 17.25 20.1 6 24.8 33.275 17.675 24.25 7 24.975 18.675 30.3 26.05 8 23.875 22.5 22.575 31.05 9 25.775 20.549999999999997 25.474999999999998 28.199999999999996 10-14 27.715 24.055 21.095 27.134999999999998 15-19 27.625 23.35 22.15 26.875 20-24 27.395000000000003 23.645 21.795 27.165 25-29 27.495000000000005 23.95 21.84 26.715 30-34 27.560000000000002 23.685000000000002 21.9 26.855 35-39 27.08 23.915 22.025 26.979999999999997 40-44 27.855 23.119999999999997 22.02 27.005000000000003 45-49 27.24 23.23 22.35 27.18 50-54 27.905 23.595 21.93 26.57 55-59 27.060000000000002 23.580000000000002 22.03 27.33 60-64 27.6 23.064999999999998 21.78 27.555000000000003 65-69 27.224999999999998 23.355 22.59 26.83 70-74 27.68 23.14 22.045 27.134999999999998 75-79 27.694999999999997 23.565 21.59 27.150000000000002 80-84 27.224999999999998 23.995 21.515 27.265 85-89 28.225 23.505000000000003 22.335 25.935000000000002 90-94 27.57 23.52 21.935 26.974999999999998 95-99 27.284999999999997 24.375 22.14 26.200000000000003 100-104 27.93 23.505000000000003 22.095000000000002 26.47 105-109 28.22 23.515 22.02 26.245 110-114 27.744999999999997 23.875 21.975 26.405 115-119 28.294999999999998 23.24 21.815 26.650000000000002 120-124 28.595 24.175 21.865000000000002 25.365 125-129 28.470000000000002 23.645 21.46 26.424999999999997 130-134 29.104999999999997 23.419999999999998 21.634999999999998 25.840000000000003 135-139 28.970000000000002 23.865 21.88 25.285000000000004 140-144 29.755 24.135 22.03 24.08 145-149 29.195 23.98 22.15 24.675 150-151 31.2 22.9625 21.125 24.712500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 0.5 21 1.5 22 1.5 23 0.0 24 0.5 25 1.0 26 0.5 27 2.5 28 4.0 29 4.0 30 6.5 31 6.5 32 7.0 33 11.0 34 14.0 35 21.0 36 27.0 37 37.5 38 49.0 39 61.5 40 76.0 41 89.0 42 111.0 43 116.0 44 128.0 45 131.5 46 133.0 47 144.5 48 138.0 49 132.0 50 126.5 51 123.5 52 109.0 53 98.5 54 105.0 55 105.5 56 100.0 57 101.0 58 113.0 59 125.0 60 124.5 61 111.5 62 105.0 63 110.5 64 100.0 65 87.5 66 95.0 67 97.5 68 81.0 69 78.5 70 79.5 71 64.5 72 56.5 73 51.0 74 41.0 75 35.0 76 29.0 77 19.0 78 10.5 79 5.0 80 3.5 81 4.0 82 2.0 83 1.0 84 1.0 85 0.5 86 1.5 87 3.0 88 3.0 89 2.0 90 1.5 91 0.5 92 2.0 93 3.0 94 1.0 95 1.5 96 1.5 97 0.0 98 1.0 99 3.0 100 7.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.675 #Duplication Level Percentage of deduplicated Percentage of total 1 93.68761801996224 86.825 2 5.718910169948745 10.6 3 0.3237118964121931 0.8999999999999999 4 0.16185594820609656 0.6 5 0.0 0.0 6 0.0 0.0 7 0.05395198273536552 0.35000000000000003 8 0.02697599136768276 0.2 9 0.0 0.0 >10 0.02697599136768276 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 21 0.525 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 8 0.2 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 7 0.17500000000000002 No Hit GTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCAGCGTCCATGAT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.7625000000000002 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.3375 0.0 0.0 0.0 0.0 122-123 3.7625 0.0 0.0 0.0 0.0 124-125 4.175000000000001 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 4.9625 0.0 0.0 0.0 0.0 130-131 5.3375 0.0 0.0 0.0 0.0 132-133 5.675 0.0 0.0 0.0 0.0 134-135 6.125 0.0 0.0 0.0 0.0 136-137 6.7375 0.0 0.0 0.0 0.0 138-139 7.199999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGGAC 10 0.006830828 145.0 5 GGAATTT 10 0.006830828 145.0 1 >>END_MODULE Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317831 spots for SRR7814812.sra Written 2317831 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra Read 2317825 spots for SRR7814812.sra Written 2317825 spots for SRR7814812.sra SRR ids: ['SRR7814812.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_83fia_8p SRR7814812.sra spots: 46356506 blocks: [[1, 2317825], [2317826, 4635650], [4635651, 6953475], [6953476, 9271300], [9271301, 11589125], [11589126, 13906950], [13906951, 16224775], [16224776, 18542600], [18542601, 20860425], [20860426, 23178250], [23178251, 25496075], [25496076, 27813900], [27813901, 30131725], [30131726, 32449550], [32449551, 34767375], [34767376, 37085200], [37085201, 39403025], [39403026, 41720850], [41720851, 44038675], [44038676, 46356506]] SRR7814812 file size 15686998 SRR7814812 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814812 SRR7814812_1.fastq SRR7814812_2.fastq Input file: SRR7814812_1.fastq Paired file: SRR7814812_2.fastq trimmed: SRR7814812-trimmed-pair1.fastq, SRR7814812-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:50:31 2024 >> started Fri Dec 6 10:51:49 2024 >> done (77.923s) 46356506 read pairs processed; of these: 288 ( 0.00%) short read pairs filtered out after trimming by size control 10871 ( 0.02%) empty read pairs filtered out after trimming by size control 46345347 (99.98%) read pairs available; of these: 5031488 (10.86%) trimmed read pairs available after processing 41313859 (89.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 22 0.00% 20 30 0.00% 21 28 0.00% 22 18 0.00% 23 39 0.00% 24 39 0.00% 25 56 0.00% 26 58 0.00% 27 64 0.00% 28 77 0.00% 29 73 0.00% 30 70 0.00% 31 86 0.00% 32 119 0.00% 33 85 0.00% 34 87 0.00% 35 102 0.00% 36 98 0.00% 37 102 0.00% 38 114 0.00% 39 121 0.00% 40 128 0.00% 41 130 0.00% 42 127 0.00% 43 162 0.00% 44 156 0.00% 45 181 0.00% 46 156 0.00% 47 183 0.00% 48 191 0.00% 49 219 0.00% 50 248 0.00% 51 267 0.00% 52 333 0.00% 53 312 0.00% 54 269 0.00% 55 350 0.00% 56 357 0.00% 57 459 0.00% 58 454 0.00% 59 582 0.00% 60 651 0.00% 61 629 0.00% 62 737 0.00% 63 865 0.00% 64 895 0.00% 65 1001 0.00% 66 1016 0.00% 67 1159 0.00% 68 1349 0.00% 69 1462 0.00% 70 1822 0.00% 71 2056 0.00% 72 2331 0.01% 73 2571 0.01% 74 2885 0.01% 75 3091 0.01% 76 3533 0.01% 77 3895 0.01% 78 4451 0.01% 79 4947 0.01% 80 5513 0.01% 81 6437 0.01% 82 7217 0.02% 83 7933 0.02% 84 9014 0.02% 85 9635 0.02% 86 10340 0.02% 87 11343 0.02% 88 12433 0.03% 89 13668 0.03% 90 15553 0.03% 91 17000 0.04% 92 18573 0.04% 93 20517 0.04% 94 22455 0.05% 95 23692 0.05% 96 25471 0.05% 97 27173 0.06% 98 28540 0.06% 99 30523 0.07% 100 33153 0.07% 101 35419 0.08% 102 37677 0.08% 103 40560 0.09% 104 42486 0.09% 105 44719 0.10% 106 46449 0.10% 107 48445 0.10% 108 50427 0.11% 109 52832 0.11% 110 54753 0.12% 111 58131 0.13% 112 61379 0.13% 113 63857 0.14% 114 67395 0.15% 115 69466 0.15% 116 70797 0.15% 117 73323 0.16% 118 74639 0.16% 119 76239 0.16% 120 78717 0.17% 121 81559 0.18% 122 82860 0.18% 123 88396 0.19% 124 91587 0.20% 125 93705 0.20% 126 96300 0.21% 127 97285 0.21% 128 98221 0.21% 129 100935 0.22% 130 103444 0.22% 131 104638 0.23% 132 108197 0.23% 133 112460 0.24% 134 113866 0.25% 135 116846 0.25% 136 118228 0.26% 137 118586 0.26% 138 120685 0.26% 139 123325 0.27% 140 124123 0.27% 141 126187 0.27% 142 129749 0.28% 143 132570 0.29% 144 136691 0.29% 145 140242 0.30% 146 141333 0.30% 147 144751 0.31% 148 143891 0.31% 149 143662 0.31% 150 145161 0.31% 151 41313859 89.14% 46345347 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=28 prefix-density=0.73 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCATCATAGTACCCAGGGGAGCTGTTGTGCTCGCGGAAGACGAAGCCGACCTTGCTGAACTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=17.39 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.1 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=24 prefix-density=0.71 prefix-fanout=2.4 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCGGGCAGCCCGTGGTACGGCTCCGACCGCGTGTTGTACCTCGGCCCGCTCTCCGGCGAACCCCCGAGCTACCTGACCGGTGAGTTCCCCGGCGATTACGGGTGGGACACCGCCGGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=100.97 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=1.4 sequence=CAAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG SRR7814812 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:52:50 Started mapping on | Dec 06 10:52:50 Finished on | Dec 06 11:00:05 Mapping speed, Million of reads per hour | 383.55 Number of input reads | 46345347 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 42432294 Uniquely mapped reads % | 91.56% Average mapped length | 295.18 Number of splices: Total | 42485544 Number of splices: Annotated (sjdb) | 40205742 Number of splices: GT/AG | 41860446 Number of splices: GC/AG | 523289 Number of splices: AT/AC | 13103 Number of splices: Non-canonical | 88706 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.02% Deletion average length | 3.04 Insertion rate per base | 0.02% Insertion average length | 2.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 571986 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 40506 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.60% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3341067 3341067 3341067 N_multimapping 571986 571986 571986 N_noFeature 1317321 41071809 1686997 N_ambiguous 1202291 5621 211824 UnstrandedReadsAssigned:39912682 PositiveStrandReadsAssigned:1354864 NegativeStrandReadsAssigned:40533473 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814812 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814812-trimmed-pair1.fastq SRR7814812-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 46,345,347 reads, 41,262,511 reads pseudoaligned [quant] estimated average fragment length: 263.796 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52973 SRR7814812.ke.tsv 35125 SRR7814812.se.tsv 88098 total ==> SRR7814812.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 673.723 0 0 PNS24247 1044 781.204 61.443 2.45155 PNS24249 1928 1665.2 175.294 3.28119 PNS24246 1044 781.204 61.443 2.45155 PNS24248 1044 781.204 61.443 2.45155 PNS24244 1471 1208.2 154.377 3.98267 PNS24243 293 96.1876 2 0.648102 KQK14069 1603 1340.2 1052.61 24.4809 KQK14071 474 236.041 4.91158 0.648584 ==> SRR7814812.se.tsv <== BRADI_1g14170v3 1040 BRADI_1g53295v3 1622 BRADI_1g59795v3 396 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 733 BRADI_1g74790v3 340 BRADI_1g09890v3 0 BRADI_1g77505v3 539 BRADI_1g48960v3 0 SRR7814812 completed mapping pipeline successfully