Starting /dee2/code/volunteer_pipeline.sh SRR7814813 current disk space = 1551530307584 free memory = 1605423560 SRR7814813 SRAfilesize 5907776774fddc27542e045a58800eb7 SRR7814813.sra SRR7814813.sra file validated SRR7814813 is paired end SRR7814813 is conventional basespace SRR7814813 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814813_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.394 37.0 37.0 37.0 37.0 37.0 2 36.4015 37.0 37.0 37.0 37.0 37.0 3 36.582 37.0 37.0 37.0 37.0 37.0 4 36.5925 37.0 37.0 37.0 37.0 37.0 5 36.617 37.0 37.0 37.0 37.0 37.0 6 36.5825 37.0 37.0 37.0 37.0 37.0 7 36.4945 37.0 37.0 37.0 37.0 37.0 8 36.5525 37.0 37.0 37.0 37.0 37.0 9 36.5085 37.0 37.0 37.0 37.0 37.0 10-14 36.56179999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.51480000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5059 37.0 37.0 37.0 37.0 37.0 25-29 36.489999999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.3211 37.0 37.0 37.0 37.0 37.0 35-39 36.2848 37.0 37.0 37.0 37.0 37.0 40-44 36.1796 37.0 37.0 37.0 37.0 37.0 45-49 36.3856 37.0 37.0 37.0 37.0 37.0 50-54 36.35889999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.35000000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.297900000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.201499999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.114700000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.0829 37.0 37.0 37.0 37.0 37.0 80-84 36.0851 37.0 37.0 37.0 37.0 37.0 85-89 36.1316 37.0 37.0 37.0 37.0 37.0 90-94 36.05040000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.728 37.0 37.0 37.0 37.0 37.0 100-104 35.394400000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.5125 37.0 37.0 37.0 37.0 37.0 110-114 35.706900000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.5364 37.0 37.0 37.0 37.0 37.0 120-124 34.876999999999995 37.0 37.0 37.0 25.0 37.0 125-129 34.63589999999999 37.0 37.0 37.0 25.0 37.0 130-134 35.232600000000005 37.0 37.0 37.0 29.8 37.0 135-139 35.056 37.0 37.0 37.0 25.0 37.0 140-144 35.10119999999999 37.0 37.0 37.0 27.4 37.0 145-149 35.035700000000006 37.0 37.0 37.0 25.0 37.0 150-151 34.353750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 2.0 26 2.0 27 10.0 28 15.0 29 25.0 30 33.0 31 47.0 32 88.0 33 163.0 34 253.0 35 583.0 36 2570.0 37 205.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.46670005007511 11.191787681522284 6.284426639959941 38.057085628442664 2 24.9 15.174999999999999 32.525 27.400000000000002 3 22.625 19.975 22.45 34.949999999999996 4 28.050000000000004 26.0 19.725 26.224999999999998 5 26.05 31.275 22.475 20.200000000000003 6 20.974999999999998 32.4 24.025 22.6 7 16.775000000000002 23.7 38.925 20.599999999999998 8 18.975 23.474999999999998 29.4 28.15 9 20.7 21.425 33.074999999999996 24.8 10-14 23.794999999999998 25.669999999999998 25.205 25.330000000000002 15-19 23.98 25.655 24.834999999999997 25.53 20-24 23.595 24.9 25.45 26.055 25-29 23.625 25.385 25.130000000000003 25.86 30-34 23.04 25.46 24.565 26.935 35-39 24.035 25.05 25.009999999999998 25.905 40-44 24.135 25.805 24.08 25.979999999999997 45-49 23.655 24.39 25.180000000000003 26.775 50-54 24.154999999999998 24.72 25.03 26.095000000000002 55-59 23.849999999999998 25.369999999999997 24.875 25.905 60-64 23.815 25.515 24.27 26.400000000000002 65-69 23.89 25.455 25.019999999999996 25.635 70-74 23.575 25.965 24.025 26.435 75-79 24.610000000000003 24.805 23.985 26.6 80-84 24.64 25.03 24.52 25.81 85-89 24.335 24.7 24.415 26.55 90-94 24.855 24.815 24.555 25.775 95-99 25.19 23.985 25.180000000000003 25.645 100-104 24.205 24.62 24.83 26.345000000000002 105-109 24.63 25.2 24.104999999999997 26.064999999999998 110-114 24.815 25.055 24.19 25.94 115-119 24.2 25.195 24.044999999999998 26.56 120-124 24.895 24.715 24.13 26.26 125-129 24.709999999999997 25.264999999999997 23.655 26.369999999999997 130-134 24.395 24.834999999999997 23.95 26.82 135-139 24.47 24.995 23.97 26.565 140-144 24.815 25.264999999999997 23.28 26.640000000000004 145-149 24.955 24.73 23.76 26.555 150-151 25.362499999999997 24.7375 22.375 27.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 2.5 28 2.5 29 4.0 30 6.5 31 8.0 32 10.0 33 19.0 34 30.5 35 47.0 36 56.5 37 63.0 38 73.5 39 91.0 40 111.0 41 132.5 42 159.5 43 173.5 44 180.0 45 174.5 46 177.5 47 192.5 48 199.0 49 183.5 50 159.0 51 154.0 52 143.5 53 123.0 54 105.0 55 89.5 56 87.5 57 78.5 58 67.0 59 68.5 60 71.5 61 80.0 62 72.5 63 60.0 64 60.0 65 60.0 66 51.5 67 53.0 68 56.5 69 44.0 70 38.0 71 39.0 72 32.0 73 22.0 74 20.5 75 15.0 76 10.5 77 12.0 78 10.5 79 7.0 80 5.5 81 2.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.425 #Duplication Level Percentage of deduplicated Percentage of total 1 90.51700304119436 81.85 2 8.515344207907106 15.4 3 0.8294166436273155 2.25 4 0.13823610727121927 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.9750000000000001 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.5125 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.3875 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 3.0625 0.0 0.0 0.0 0.0 114-115 3.4625 0.0 0.0 0.0 0.0 116-117 3.9 0.0 0.0 0.0 0.0 118-119 4.3625 0.0 0.0 0.0 0.0 120-121 4.825 0.0 0.0 0.0 0.0 122-123 5.112500000000001 0.0 0.0 0.0 0.0 124-125 5.65 0.0 0.0 0.0 0.0 126-127 6.1375 0.0 0.0 0.0 0.0 128-129 6.625 0.0 0.0 0.0 0.0 130-131 7.0125 0.0 0.0 0.0 0.0 132-133 7.5 0.0 0.0 0.0 0.0 134-135 8.2625 0.0 0.0 0.0 0.0 136-137 8.7625 0.0 0.0 0.0 0.0 138-139 9.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGAAAT 10 0.006830828 145.0 5 >>END_MODULE SRR7814813 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814813_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0555 37.0 37.0 37.0 37.0 37.0 2 35.828 37.0 37.0 37.0 37.0 37.0 3 35.665 37.0 37.0 37.0 37.0 37.0 4 35.841 37.0 37.0 37.0 37.0 37.0 5 35.8035 37.0 37.0 37.0 37.0 37.0 6 35.7395 37.0 37.0 37.0 37.0 37.0 7 35.517 37.0 37.0 37.0 37.0 37.0 8 35.623 37.0 37.0 37.0 37.0 37.0 9 35.9755 37.0 37.0 37.0 37.0 37.0 10-14 35.7772 37.0 37.0 37.0 37.0 37.0 15-19 35.4281 37.0 37.0 37.0 37.0 37.0 20-24 35.6302 37.0 37.0 37.0 37.0 37.0 25-29 35.4916 37.0 37.0 37.0 37.0 37.0 30-34 35.26630000000001 37.0 37.0 37.0 34.6 37.0 35-39 35.277100000000004 37.0 37.0 37.0 32.2 37.0 40-44 34.9222 37.0 37.0 37.0 27.4 37.0 45-49 35.1638 37.0 37.0 37.0 29.8 37.0 50-54 34.3818 37.0 37.0 37.0 25.0 37.0 55-59 34.3124 37.0 37.0 37.0 25.0 37.0 60-64 34.5313 37.0 37.0 37.0 25.0 37.0 65-69 34.5632 37.0 37.0 37.0 25.0 37.0 70-74 34.1166 37.0 37.0 37.0 25.0 37.0 75-79 33.8492 37.0 37.0 37.0 22.2 37.0 80-84 33.91449999999999 37.0 37.0 37.0 25.0 37.0 85-89 34.2252 37.0 37.0 37.0 25.0 37.0 90-94 33.743399999999994 37.0 37.0 37.0 25.0 37.0 95-99 32.8876 37.0 37.0 37.0 11.0 37.0 100-104 33.1772 37.0 37.0 37.0 16.6 37.0 105-109 32.7012 37.0 37.0 37.0 11.0 37.0 110-114 33.1154 37.0 37.0 37.0 16.6 37.0 115-119 33.2453 37.0 37.0 37.0 19.4 37.0 120-124 32.4434 37.0 34.6 37.0 11.0 37.0 125-129 32.6358 37.0 34.6 37.0 11.0 37.0 130-134 32.1609 37.0 29.8 37.0 11.0 37.0 135-139 32.1472 37.0 29.8 37.0 11.0 37.0 140-144 32.3257 37.0 34.6 37.0 11.0 37.0 145-149 31.869799999999998 37.0 27.4 37.0 11.0 37.0 150-151 31.392000000000003 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 2.0 16 1.0 17 0.0 18 2.0 19 6.0 20 1.0 21 6.0 22 18.0 23 44.0 24 46.0 25 75.0 26 53.0 27 100.0 28 107.0 29 123.0 30 124.0 31 150.0 32 178.0 33 222.0 34 357.0 35 792.0 36 1551.0 37 37.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.625 18.55 8.375 32.45 2 29.675 22.7 28.675 18.95 3 23.425 25.45 26.625 24.5 4 26.05 30.85 20.275000000000002 22.825 5 27.875 34.050000000000004 18.45 19.625 6 24.224999999999998 34.275 19.125 22.375 7 22.275 19.075 34.9 23.75 8 24.425 23.3 23.175 29.099999999999998 9 24.325 21.175 27.875 26.625 10-14 26.68 24.32 22.875 26.125 15-19 26.334999999999997 25.05 23.215 25.4 20-24 25.89 25.069999999999997 23.465 25.575 25-29 26.424999999999997 24.505 23.56 25.509999999999998 30-34 25.545 24.965 24.22 25.27 35-39 26.02 24.595 23.715 25.669999999999998 40-44 26.395000000000003 25.324999999999996 23.44 24.84 45-49 25.865 24.82 24.115000000000002 25.2 50-54 25.915 25.115 24.04 24.93 55-59 26.265 24.67 23.805 25.259999999999998 60-64 26.169999999999998 25.055 23.505000000000003 25.27 65-69 26.529999999999998 25.085 23.105 25.28 70-74 26.685 25.61 24.19 23.515 75-79 26.35 25.25 23.919999999999998 24.48 80-84 26.055 25.83 23.830000000000002 24.285 85-89 27.125 24.725 23.455000000000002 24.695 90-94 26.02 25.840000000000003 23.745 24.395 95-99 26.19 26.1 23.72 23.990000000000002 100-104 26.484999999999996 25.790000000000003 23.84 23.885 105-109 25.685000000000002 26.729999999999997 23.895 23.69 110-114 26.924999999999997 25.56 23.945 23.57 115-119 26.58 25.595000000000002 23.445 24.38 120-124 26.625 26.540000000000003 23.885 22.95 125-129 27.11 27.05 23.005 22.835 130-134 27.01 26.590000000000003 23.44 22.96 135-139 27.66 27.305 22.97 22.065 140-144 27.775 26.915 23.115 22.195 145-149 28.18 27.279999999999998 23.0 21.54 150-151 29.7375 25.6 23.674999999999997 20.9875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 2.5 21 2.0 22 0.5 23 1.0 24 0.5 25 0.0 26 1.5 27 4.0 28 4.5 29 5.5 30 6.0 31 12.5 32 16.0 33 20.0 34 27.5 35 32.0 36 46.0 37 59.5 38 70.0 39 84.0 40 99.5 41 114.0 42 144.0 43 165.5 44 155.0 45 163.5 46 183.0 47 183.0 48 170.5 49 160.5 50 149.0 51 129.0 52 127.5 53 114.5 54 103.5 55 110.0 56 99.0 57 86.0 58 84.0 59 83.0 60 80.5 61 79.5 62 77.5 63 84.5 64 80.0 65 67.0 66 69.5 67 69.5 68 58.0 69 44.0 70 44.5 71 49.0 72 44.0 73 39.5 74 30.0 75 19.5 76 13.5 77 8.0 78 6.0 79 4.5 80 2.0 81 1.5 82 1.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 1.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.525 #Duplication Level Percentage of deduplicated Percentage of total 1 91.7235727943185 83.95 2 7.429664026222343 13.600000000000001 3 0.7101884730947828 1.95 4 0.13657470636438132 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.7374999999999998 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.2875 0.0 0.0 0.0 0.0 112-113 2.6624999999999996 0.0 0.0 0.0 0.0 114-115 3.0625 0.0 0.0 0.0 0.0 116-117 3.45 0.0 0.0 0.0 0.0 118-119 3.825 0.0 0.0 0.0 0.0 120-121 4.175000000000001 0.0 0.0 0.0 0.0 122-123 4.375 0.0 0.0 0.0 0.0 124-125 4.825 0.0 0.0 0.0 0.0 126-127 5.25 0.0 0.0 0.0 0.0 128-129 5.675 0.0 0.0 0.0 0.0 130-131 6.0 0.0 0.0 0.0 0.0 132-133 6.35 0.0 0.0 0.0 0.0 134-135 7.0 0.0 0.0 0.0 0.0 136-137 7.362500000000001 0.0 0.0 0.0 0.0 138-139 7.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAAATC 10 0.006830828 145.0 2 TATCATA 10 0.006830828 145.0 3 CGACGCG 10 0.006830828 145.0 6 >>END_MODULE Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755526 spots for SRR7814813.sra Written 1755526 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra Read 1755525 spots for SRR7814813.sra Written 1755525 spots for SRR7814813.sra SRR ids: ['SRR7814813.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fy9ss_om SRR7814813.sra spots: 35110501 blocks: [[1, 1755525], [1755526, 3511050], [3511051, 5266575], [5266576, 7022100], [7022101, 8777625], [8777626, 10533150], [10533151, 12288675], [12288676, 14044200], [14044201, 15799725], [15799726, 17555250], [17555251, 19310775], [19310776, 21066300], [21066301, 22821825], [22821826, 24577350], [24577351, 26332875], [26332876, 28088400], [28088401, 29843925], [29843926, 31599450], [31599451, 33354975], [33354976, 35110501]] SRR7814813 file size 11876096 SRR7814813 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814813 SRR7814813_1.fastq SRR7814813_2.fastq Input file: SRR7814813_1.fastq Paired file: SRR7814813_2.fastq trimmed: SRR7814813-trimmed-pair1.fastq, SRR7814813-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:48:58 2024 >> started Fri Dec 6 10:49:53 2024 >> done (54.987s) 35110501 read pairs processed; of these: 163 ( 0.00%) short read pairs filtered out after trimming by size control 4379 ( 0.01%) empty read pairs filtered out after trimming by size control 35105959 (99.99%) read pairs available; of these: 4087671 (11.64%) trimmed read pairs available after processing 31018288 (88.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 13 0.00% 20 10 0.00% 21 16 0.00% 22 24 0.00% 23 25 0.00% 24 29 0.00% 25 31 0.00% 26 26 0.00% 27 28 0.00% 28 35 0.00% 29 42 0.00% 30 56 0.00% 31 46 0.00% 32 49 0.00% 33 46 0.00% 34 65 0.00% 35 63 0.00% 36 56 0.00% 37 68 0.00% 38 107 0.00% 39 83 0.00% 40 106 0.00% 41 85 0.00% 42 116 0.00% 43 105 0.00% 44 79 0.00% 45 104 0.00% 46 126 0.00% 47 140 0.00% 48 152 0.00% 49 177 0.00% 50 196 0.00% 51 209 0.00% 52 275 0.00% 53 281 0.00% 54 282 0.00% 55 303 0.00% 56 354 0.00% 57 385 0.00% 58 469 0.00% 59 539 0.00% 60 602 0.00% 61 688 0.00% 62 747 0.00% 63 822 0.00% 64 897 0.00% 65 997 0.00% 66 1048 0.00% 67 1248 0.00% 68 1386 0.00% 69 1490 0.00% 70 1794 0.01% 71 2082 0.01% 72 2330 0.01% 73 2678 0.01% 74 3057 0.01% 75 3239 0.01% 76 3587 0.01% 77 4030 0.01% 78 4558 0.01% 79 5154 0.01% 80 5647 0.02% 81 6397 0.02% 82 7239 0.02% 83 8102 0.02% 84 9052 0.03% 85 10097 0.03% 86 10918 0.03% 87 11598 0.03% 88 12909 0.04% 89 13614 0.04% 90 14856 0.04% 91 16452 0.05% 92 18213 0.05% 93 19581 0.06% 94 21587 0.06% 95 22464 0.06% 96 24391 0.07% 97 26130 0.07% 98 27017 0.08% 99 28200 0.08% 100 30151 0.09% 101 31940 0.09% 102 34180 0.10% 103 36076 0.10% 104 37816 0.11% 105 38891 0.11% 106 41467 0.12% 107 42485 0.12% 108 44101 0.13% 109 46097 0.13% 110 47417 0.14% 111 49053 0.14% 112 52037 0.15% 113 53314 0.15% 114 55616 0.16% 115 57683 0.16% 116 59159 0.17% 117 60660 0.17% 118 62254 0.18% 119 63082 0.18% 120 64979 0.19% 121 66538 0.19% 122 68616 0.20% 123 70765 0.20% 124 72485 0.21% 125 75133 0.21% 126 76921 0.22% 127 78479 0.22% 128 79138 0.23% 129 80736 0.23% 130 82396 0.23% 131 83069 0.24% 132 85575 0.24% 133 87156 0.25% 134 89071 0.25% 135 90419 0.26% 136 92871 0.26% 137 93044 0.27% 138 94044 0.27% 139 96375 0.27% 140 96833 0.28% 141 98401 0.28% 142 100496 0.29% 143 101516 0.29% 144 104224 0.30% 145 105375 0.30% 146 106610 0.30% 147 109042 0.31% 148 110094 0.31% 149 109858 0.31% 150 111625 0.32% 151 31018288 88.36% 35105959 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.62 fanout-score-rank=20 prefix-density=0.56 prefix-fanout=2.9 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.15 sequence-density-rank=9 fanout-score=44.96 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=10.6 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGCGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTG criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.14 fanout-score-rank=25 prefix-density=0.57 prefix-fanout=2.1 sequence=CAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=119.91 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=17.7 sequence=CCGCCGCCGCCA SRR7814813 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:52:31 Started mapping on | Dec 06 10:52:31 Finished on | Dec 06 10:56:57 Mapping speed, Million of reads per hour | 475.12 Number of input reads | 35105959 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 33225906 Uniquely mapped reads % | 94.64% Average mapped length | 294.46 Number of splices: Total | 33828559 Number of splices: Annotated (sjdb) | 31888184 Number of splices: GT/AG | 33329466 Number of splices: GC/AG | 409810 Number of splices: AT/AC | 13837 Number of splices: Non-canonical | 75446 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 501975 % of reads mapped to multiple loci | 1.43% Number of reads mapped to too many loci | 27730 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.37% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1378078 1378078 1378078 N_multimapping 501975 501975 501975 N_noFeature 1047782 32090400 1401014 N_ambiguous 911281 5080 129982 UnstrandedReadsAssigned:31266843 PositiveStrandReadsAssigned:1130426 NegativeStrandReadsAssigned:31694910 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814813 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814813-trimmed-pair1.fastq SRR7814813-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,105,959 reads, 32,099,796 reads pseudoaligned [quant] estimated average fragment length: 260.903 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52973 SRR7814813.ke.tsv 35125 SRR7814813.se.tsv 88098 total ==> SRR7814813.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 676.544 0 0 PNS24247 1044 784.097 115.84 6.14378 PNS24249 1928 1668.1 124.633 3.10712 PNS24246 1044 784.097 115.84 6.14378 PNS24248 1044 784.097 115.84 6.14378 PNS24244 1471 1211.1 335.847 11.5321 PNS24243 293 96.7975 1 0.429618 KQK14069 1603 1343.1 2318.5 71.7872 KQK14071 474 236.604 76.3013 13.4109 ==> SRR7814813.se.tsv <== BRADI_1g14170v3 2729 BRADI_1g53295v3 1784 BRADI_1g59795v3 201 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 985 BRADI_1g74790v3 1070 BRADI_1g09890v3 0 BRADI_1g77505v3 660 BRADI_1g48960v3 0 SRR7814813 completed mapping pipeline successfully