Starting /dee2/code/volunteer_pipeline.sh SRR7814815 current disk space = 2825397784576 free memory = 1575303444 SRR7814815_1.fastq is conventional basespace SRR7814815_1.fastq read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814815_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 38296859 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10-14 30.0 30.0 30.0 30.0 30.0 30.0 15-19 30.0 30.0 30.0 30.0 30.0 30.0 20-24 30.0 30.0 30.0 30.0 30.0 30.0 25-29 30.0 30.0 30.0 30.0 30.0 30.0 30-34 30.0 30.0 30.0 30.0 30.0 30.0 35-39 30.0 30.0 30.0 30.0 30.0 30.0 40-44 30.0 30.0 30.0 30.0 30.0 30.0 45-49 30.0 30.0 30.0 30.0 30.0 30.0 50-54 30.0 30.0 30.0 30.0 30.0 30.0 55-59 30.0 30.0 30.0 30.0 30.0 30.0 60-64 30.0 30.0 30.0 30.0 30.0 30.0 65-69 30.0 30.0 30.0 30.0 30.0 30.0 70-74 30.0 30.0 30.0 30.0 30.0 30.0 75-79 30.0 30.0 30.0 30.0 30.0 30.0 80-84 30.0 30.0 30.0 30.0 30.0 30.0 85-89 30.0 30.0 30.0 30.0 30.0 30.0 90-94 30.0 30.0 30.0 30.0 30.0 30.0 95-99 30.0 30.0 30.0 30.0 30.0 30.0 100-104 30.0 30.0 30.0 30.0 30.0 30.0 105-109 30.0 30.0 30.0 30.0 30.0 30.0 110-114 30.0 30.0 30.0 30.0 30.0 30.0 115-119 30.0 30.0 30.0 30.0 30.0 30.0 120-124 30.0 30.0 30.0 30.0 30.0 30.0 125-129 30.0 30.0 30.0 30.0 30.0 30.0 130-134 30.0 30.0 30.0 30.0 30.0 30.0 135-139 30.0 30.0 30.0 30.0 30.0 30.0 140-144 30.0 30.0 30.0 30.0 30.0 30.0 145-149 30.0 30.0 30.0 30.0 30.0 30.0 150-151 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 3.8296859E7 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.84716296243137 11.393614264175943 5.8306254459827 34.92859732740998 2 25.859105418619176 13.58445096135688 31.382088164052785 29.174355455971156 3 22.378777852251538 18.574862758326997 23.268751622685297 35.77760776673617 4 27.261465489898274 25.45076346861762 20.17613768272745 27.111633358756652 5 26.89248222680612 29.312900047494754 22.144787383215945 21.649830342483178 6 22.769290296104963 31.773046974949043 22.82612002201016 22.631542706935832 7 18.450064011777048 23.38849512436516 38.44217093626399 19.719269927593803 8 20.49425776667481 23.009061918106653 29.107525502287274 27.389154812931267 9 20.65364420617367 21.31393595490429 32.16908989846922 25.863329940452818 10-14 23.755540891747806 26.19799968451721 24.733190259806946 25.313269163928037 15-19 23.78210756135379 25.177331644874585 25.117874549450647 25.922686244320975 20-24 23.684297973366434 25.322946719990796 25.12686379841229 25.865891508230483 25-29 23.739121790640848 25.333675537202673 24.927508023569246 25.99969464858724 30-34 23.679497057447975 25.28757201732915 24.941335789444246 26.09159513577863 35-39 23.71162136299481 25.196129008909057 24.92375105749534 26.16849857060079 40-44 23.891115978989294 25.271933659102437 24.78527964917436 26.05167071273391 45-49 23.85479506135558 25.124530061960282 24.760552936443045 26.260121940241092 50-54 23.852093457586168 25.12700845779546 24.883408845618384 26.137489238999994 55-59 24.04905043697371 25.103466974794298 24.730059314318257 26.11742327391373 60-64 24.020095747277864 25.03823616448545 24.692493449658627 26.24917463857806 65-69 24.032625234356686 25.041897561363974 24.77066174017039 26.15481546410895 70-74 24.18200112129417 25.04877023859344 24.67111380712847 26.09811483298391 75-79 24.189003594263436 24.90650525673659 24.645920439584877 26.258570709415096 80-84 24.18322870812982 24.90348777689575 24.72097985894875 26.19230365602568 85-89 24.3283210249697 24.897776603559056 24.657689028752987 26.116213342718265 90-94 24.34069175229227 24.86805406156155 24.5847430986442 26.206511087501983 95-99 24.318640024556377 24.825016315569005 24.669345574115297 26.18699808575932 100-104 24.477431948139664 24.97335982567134 24.451470027868343 26.097738198320652 105-109 24.522513452082322 24.88374882128062 24.42474982086651 26.168987905770546 110-114 24.506468271980218 24.911999179880524 24.481800974852792 26.099731573286466 115-119 24.63782264754402 24.96009085235946 24.32796381551813 26.074122684578388 120-124 24.66186286798018 24.956361172890766 24.203178251266916 26.17859770786214 125-129 24.631074048459944 25.005269753378673 24.233638839505232 26.13001735865615 130-134 24.757466924376224 25.02071148968118 24.082803762052656 26.139017823889944 135-139 24.738338171511348 24.98842241733346 23.998056487908016 26.275182923247176 140-144 24.77752496621198 24.978078228295434 23.9960603557592 26.248336449733383 145-149 24.868778005104815 25.019884399286944 23.85410362080573 26.257233974802507 150-151 24.892196772586495 24.844246364956458 23.76689822003418 26.496658642422865 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1383.0 1 918.5 2 404.5 3 349.0 4 354.0 5 362.5 6 355.0 7 352.0 8 335.0 9 326.0 10 333.5 11 332.5 12 340.0 13 359.0 14 392.0 15 438.5 16 529.5 17 621.0 18 758.5 19 951.5 20 1253.0 21 1746.0 22 2356.5 23 3281.5 24 4934.0 25 7306.0 26 10954.5 27 17088.5 28 26712.5 29 40130.0 30 58913.5 31 84806.0 32 119177.0 33 165913.5 34 228951.0 35 309605.0 36 414252.5 37 545711.5 38 699784.5 39 874155.0 40 1068103.5 41 1274639.5 42 1462598.5 43 1619637.5 44 1736695.0 45 1800368.0 46 1829972.5 47 1822101.0 48 1771577.0 49 1692189.5 50 1593478.5 51 1484472.5 52 1367080.5 53 1245774.5 54 1133385.5 55 1037297.0 56 931979.5 57 831720.0 58 768734.5 59 728006.0 60 694890.5 61 652918.5 62 610239.0 63 583792.0 64 570805.5 65 565022.5 66 532164.0 67 491869.5 68 462241.0 69 415830.5 70 362640.5 71 314555.5 72 271704.5 73 228541.5 74 187594.0 75 149441.5 76 115050.5 77 84835.0 78 60036.0 79 41852.5 80 28221.0 81 18738.0 82 12647.5 83 7549.5 84 3451.5 85 1684.0 86 789.5 87 430.0 88 257.5 89 154.0 90 92.0 91 61.0 92 37.5 93 26.0 94 22.5 95 22.5 96 25.0 97 38.0 98 97.0 99 102.5 100 35.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.013095068710465263 2 0.014935950752514715 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 4.700124362679456E-6 50-54 0.0 55-59 3.6556522820840213E-6 60-64 0.0 65-69 0.0 70-74 1.0444720805954348E-4 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 7.311304564168043E-6 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 5.222360402977174E-7 125-129 1.0444720805954348E-6 130-134 0.0 135-139 1.1489192886549782E-5 140-144 0.0 145-149 4.700124362679456E-6 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 3.8296859E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 35.8542083192361 #Duplication Level Percentage of deduplicated Percentage of total 1 61.12752961747078 21.916791809450718 2 17.035340792034248 12.21577315093553 3 7.202248515486478 7.746927559234836 4 3.9128223455926383 5.611645899801619 5 2.462514403913579 4.414575221351848 6 1.6042145143070163 3.451070483082355 7 1.1720593527858707 2.941628213810555 8 0.8467149936478476 2.428663661541648 9 0.6724416924817898 2.1698878072303613 >10 3.6479499623783913 23.351076749731504 >50 0.20880989287861434 5.113219261439393 >100 0.101172464203308 6.535020804219953 >500 0.004556429200079963 1.1082719198899205 >1k 0.0016001886644043343 0.9378509831171914 >5k 2.4834954979408848E-5 0.057596475162678566 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.001770380176609262 7.83354060446576E-6 2.611180201488587E-6 7.83354060446576E-6 0.0 2 0.0017860472578181935 1.566708120893152E-5 2.611180201488587E-6 2.0889441611908696E-5 5.222360402977174E-6 3 0.0018095478796315908 1.827826141042011E-5 2.611180201488587E-6 3.133416241786304E-5 3.655652282084022E-5 4 0.0018565491232583851 1.827826141042011E-5 2.611180201488587E-6 3.133416241786304E-5 4.700124362679456E-5 5 0.0018748273846688054 1.827826141042011E-5 2.611180201488587E-6 4.4390063425305976E-5 5.4834784231260325E-5 6 0.0019139950876911342 1.827826141042011E-5 2.611180201488587E-6 4.700124362679456E-5 5.4834784231260325E-5 7 0.0019296621689000658 2.0889441611908696E-5 5.222360402977174E-6 4.961242382828315E-5 5.744596443274891E-5 8 0.001960996331317929 2.350062181339728E-5 7.83354060446576E-6 4.961242382828315E-5 6.00571446342375E-5 9 0.0020079975749447234 2.6111802014885867E-5 1.827826141042011E-5 5.744596443274891E-5 6.00571446342375E-5 10-11 0.0020354149670603534 3.786211292158451E-5 2.4806211914141575E-5 6.136273473498179E-5 7.572422584316902E-5 12-13 0.0020784994403849153 4.830683372753885E-5 4.961242382828315E-5 6.527950503721467E-5 1.1358633876475352E-4 14-15 0.0021333342246161752 7.180745554093613E-5 5.4834784231260325E-5 7.050186544019184E-5 1.4883727148484944E-4 16-17 0.0021881690088474356 7.572422584316902E-5 5.4834784231260325E-5 7.572422584316902E-5 1.6972671309675814E-4 18-19 0.0022534485138846505 8.094658624614619E-5 5.4834784231260325E-5 7.572422584316902E-5 2.0889441611908694E-4 20-21 0.002348756591238984 8.486335654837907E-5 6.00571446342375E-5 8.355776644763477E-5 2.2456149732801847E-4 22-23 0.002437536718089596 1.0575279816028777E-4 6.136273473498179E-5 1.0575279816028777E-4 2.3631180823471712E-4 24-25 0.0025837628093729565 1.175031090669864E-4 6.397391493647038E-5 1.175031090669864E-4 2.5589565974588153E-4 26-27 0.002745655981865249 1.2403105957070788E-4 9.139130705210054E-5 1.2141987936921929E-4 2.872298221637446E-4 28-29 0.0029206050553649845 1.3969814077963941E-4 1.2403105957070788E-4 1.3055901007442934E-4 3.185639845816076E-4 30-31 0.0031308050615848158 1.4883727148484944E-4 1.2794782987294077E-4 1.3578137047740653E-4 3.3814783609277196E-4 32-33 0.003401062212438884 1.5536522198857092E-4 1.2794782987294077E-4 1.6842112299601385E-4 3.5250932720095923E-4 34-35 0.0036830696741996516 1.6319876259303666E-4 1.2794782987294077E-4 1.7364348339899102E-4 3.642596381076579E-4 36-37 0.0039833553973708385 1.7625466360047962E-4 1.3447578037666222E-4 1.749490734997353E-4 3.6817640840989077E-4 38-39 0.00429669702154947 1.9061615470866684E-4 1.566708120893152E-4 1.8278261410420107E-4 3.864546698203108E-4 40-41 0.004668790200261593 1.9061615470866684E-4 1.618931724922924E-4 1.8669938440643395E-4 4.008161609284981E-4 42-43 0.0050408833789737165 1.9322733491015543E-4 1.6450435269378097E-4 2.3108944783173992E-4 4.2301119264115107E-4 44-45 0.005469116932017845 1.9322733491015543E-4 1.6580994279452528E-4 2.6895156075332444E-4 4.478174045552926E-4 46-47 0.005986130611912586 1.9322733491015543E-4 1.7103230319750242E-4 2.872298221637446E-4 4.752347966709228E-4 48-49 0.00660759149986687 2.0106087551462117E-4 1.801714339027125E-4 2.911465924659775E-4 4.9873541848432E-4 50-51 0.007402695871220144 2.1542236662280842E-4 2.0106087551462117E-4 3.042024934734204E-4 5.209304501969731E-4 52-53 0.008400166708188782 2.3239503793248423E-4 2.4153416863769429E-4 3.590372777046807E-4 5.352919413051604E-4 54-55 0.009555613947347483 2.350062181339728E-4 2.572012498466258E-4 3.9820498072700946E-4 5.548757928163248E-4 56-57 0.010773729511341909 2.3631180823471712E-4 2.585068399473701E-4 4.151776520366853E-4 5.692372839245119E-4 58-59 0.0123887444659626 2.4022857853695E-4 2.585068399473701E-4 4.2170560254040676E-4 5.849043651334435E-4 60-61 0.014634359439242784 2.4153416863769429E-4 2.598124300481144E-4 4.3215032334636115E-4 6.123217572490736E-4 62-63 0.017665939653171037 2.4545093893992714E-4 2.7417392115630163E-4 4.36067093648594E-4 6.449615097676809E-4 64-65 0.021230200628202953 2.6503479045109155E-4 3.472869667979821E-4 4.4259504415231543E-4 6.54100640472891E-4 66-67 0.025560842992371775 2.8461864196225597E-4 3.7078758861137934E-4 4.4390063425305974E-4 6.684621315810782E-4 68-69 0.030895484144012962 3.0550808357416464E-4 3.786211292158451E-4 4.465118144545483E-4 6.919627533944755E-4 70-71 0.03770935887979743 3.133416241786304E-4 4.0473293123073097E-4 4.556509451597584E-4 7.180745554093614E-4 72-73 0.04667615169170923 3.2117516478309617E-4 4.0864970153296385E-4 4.6740125606645704E-4 7.415751772227587E-4 74-75 0.058448657630120526 3.277031152868177E-4 4.164832421374296E-4 4.8176274717464426E-4 7.585478485324345E-4 76-77 0.07289892886515836 3.316198855890505E-4 4.2301119264115107E-4 5.065689590887858E-4 7.716037495398774E-4 78-79 0.09078420765525444 3.3423106579053913E-4 4.2562237284263964E-4 5.117913194917631E-4 7.833540604465761E-4 80-81 0.11284606917763151 3.3423106579053913E-4 4.465118144545483E-4 5.183192699954845E-4 7.964099614540189E-4 82-83 0.14191372718060247 3.368422459920277E-4 4.804571570739E-4 5.43125481909626E-4 8.120770426629505E-4 84-85 0.17845197174003224 3.459813766972377E-4 4.882906976783658E-4 5.509590225140919E-4 8.368832545770921E-4 86-87 0.22360841655447514 3.6164845790616926E-4 4.948186481820872E-4 5.692372839245119E-4 8.486335654837908E-4 88-89 0.2775423436162219 3.760099490143565E-4 5.000410085850644E-4 5.770708245289777E-4 8.682174169949552E-4 90-91 0.3427265405760822 3.8123230941733367E-4 5.039577788872973E-4 5.966546760401421E-4 8.85190088304631E-4 92-93 0.42116508823869864 3.838434896188223E-4 5.183192699954845E-4 5.979602661408864E-4 8.982459893120739E-4 94-95 0.5152524388488362 3.8645466982031087E-4 5.261528105999502E-4 6.031826265438635E-4 9.073851200172839E-4 96-97 0.6242992408333018 3.8645466982031087E-4 5.274584007006946E-4 6.110161671483293E-4 9.165242507224939E-4 98-99 0.7489674283731729 3.877602599210552E-4 5.379031215066489E-4 6.306000186594937E-4 9.361081022336583E-4 100-101 0.8903954760362984 4.0342734112998666E-4 5.379031215066489E-4 6.345167889617266E-4 9.517751834425899E-4 102-103 1.0501474807633702 4.1256647183519673E-4 5.43125481909626E-4 6.345167889617266E-4 9.556919537448228E-4 104-105 1.2324444153500944 4.177888322381739E-4 5.548757928163248E-4 6.345167889617266E-4 9.7005344485301E-4 106-107 1.4372928077469749 4.2170560254040676E-4 5.888211354356764E-4 6.397391493647038E-4 9.909428864649187E-4 108-109 1.6609443087747744 4.243167827418954E-4 6.162385275513065E-4 6.475726899691695E-4 0.0010026931973716173 110-111 1.9006023444376992 4.2562237284263964E-4 6.371279691632152E-4 6.501838701706581E-4 0.0010118323280768273 112-113 2.1621838490723224 4.2562237284263964E-4 6.410447394654481E-4 6.501838701706581E-4 0.0010261938191850146 114-115 2.4484383954308107 4.2692796294338395E-4 6.462670998684252E-4 6.501838701706581E-4 0.0010496944409984117 116-117 2.7592093127010755 4.386782738500826E-4 6.501838701706581E-4 6.501838701706581E-4 0.001090167734121485 118-119 3.090662082757231 4.5173417485752556E-4 6.54100640472891E-4 6.501838701706581E-4 0.0011006124549274394 120-121 3.4328650817029143 4.569565352605027E-4 6.554062305736353E-4 6.501838701706581E-4 0.0011201963064386038 122-123 3.7951963632317733 4.569565352605027E-4 6.593230008758681E-4 6.501838701706581E-4 0.0011410857480505126 124-125 4.1869021164372775 4.569565352605027E-4 6.645453612788453E-4 6.736844919840554E-4 0.0011580584193601883 126-127 4.600308082707253 4.6217889566347984E-4 6.658509513795896E-4 6.971851137974527E-4 0.0011711143203676313 128-129 5.034905081902409 4.700124362679456E-4 6.736844919840554E-4 6.98490703898197E-4 0.00120114289268475 130-131 5.482584093907023 4.791515669731557E-4 6.828236226892655E-4 6.997962939989412E-4 0.0012141987936921928 132-133 5.9474982008315616 4.974298283835758E-4 6.841292127900098E-4 6.997962939989412E-4 0.001218115563994426 134-135 6.437031820285836 5.065689590887858E-4 7.311304564168043E-4 7.259080960138271E-4 0.0012272546946996358 136-137 6.952417429324948 5.170136798947402E-4 7.481031277264802E-4 7.311304564168043E-4 0.0012403105957070788 138-139 7.479928053629672 5.183192699954845E-4 7.611590287339231E-4 7.467975376257358E-4 0.0012559776769160104 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCGTT 8700 0.0 14.671152 1 GTCCGCT 12005 0.0 12.625684 1 GTCGGTT 11225 0.0 12.017036 1 GTCGCAT 13380 0.0 10.731981 1 GCCCTAT 8825 0.0 10.600975 1 CTTATCG 26515 0.0 10.472336 145 GTCCGAT 12600 0.0 10.417868 1 GTCCAGT 33370 0.0 10.409986 1 GTCGGAT 17965 0.0 10.374728 1 GTCGTTT 10835 0.0 10.039988 1 GTCCATT 33480 0.0 9.920895 1 GTCCGGT 13505 0.0 9.880844 1 GTCGTAT 9190 0.0 9.706449 1 TTTTTTT 136300 0.0 9.687855 2 GTCCGGA 14235 0.0 9.57792 1 GCCCAAT 24570 0.0 9.563363 1 CCCGTAT 8600 0.0 9.360419 1 GCCGTTT 13185 0.0 9.350602 1 GTCCTGT 23850 0.0 9.304731 1 GTCGGAA 15355 0.0 9.209915 1 >>END_MODULE SRR7814815 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814815_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 38296859 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10-14 30.0 30.0 30.0 30.0 30.0 30.0 15-19 30.0 30.0 30.0 30.0 30.0 30.0 20-24 30.0 30.0 30.0 30.0 30.0 30.0 25-29 30.0 30.0 30.0 30.0 30.0 30.0 30-34 30.0 30.0 30.0 30.0 30.0 30.0 35-39 30.0 30.0 30.0 30.0 30.0 30.0 40-44 30.0 30.0 30.0 30.0 30.0 30.0 45-49 30.0 30.0 30.0 30.0 30.0 30.0 50-54 30.0 30.0 30.0 30.0 30.0 30.0 55-59 30.0 30.0 30.0 30.0 30.0 30.0 60-64 30.0 30.0 30.0 30.0 30.0 30.0 65-69 30.0 30.0 30.0 30.0 30.0 30.0 70-74 30.0 30.0 30.0 30.0 30.0 30.0 75-79 30.0 30.0 30.0 30.0 30.0 30.0 80-84 30.0 30.0 30.0 30.0 30.0 30.0 85-89 30.0 30.0 30.0 30.0 30.0 30.0 90-94 30.0 30.0 30.0 30.0 30.0 30.0 95-99 30.0 30.0 30.0 30.0 30.0 30.0 100-104 30.0 30.0 30.0 30.0 30.0 30.0 105-109 30.0 30.0 30.0 30.0 30.0 30.0 110-114 30.0 30.0 30.0 30.0 30.0 30.0 115-119 30.0 30.0 30.0 30.0 30.0 30.0 120-124 30.0 30.0 30.0 30.0 30.0 30.0 125-129 30.0 30.0 30.0 30.0 30.0 30.0 130-134 30.0 30.0 30.0 30.0 30.0 30.0 135-139 30.0 30.0 30.0 30.0 30.0 30.0 140-144 30.0 30.0 30.0 30.0 30.0 30.0 145-149 30.0 30.0 30.0 30.0 30.0 30.0 150-151 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 3.8296859E7 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.508536813720696 18.71997890547722 8.68441584421555 30.087068436586534 2 29.662048785776403 22.764300330739918 26.91441352931842 20.659237354165256 3 23.36667349142132 24.578785952132524 27.83720461252449 24.217335943921668 4 27.261713552017415 30.181945208613588 19.577733515952314 22.97860772341669 5 28.02794349270263 32.40058146805199 19.124738141057467 20.44673689818792 6 23.60839305385332 34.67419873781294 19.624533698703594 22.09287450963015 7 23.122290525183804 18.929964987468033 33.74078798472742 24.20695650262075 8 23.545651615971952 22.695822129955882 23.846895642277087 29.911630611795083 9 24.252743547453854 22.05829987258224 26.311690470490024 27.377266109473887 10-14 26.406679931482525 25.28885494349397 22.592466733512985 25.711998391510516 15-19 26.00340252447335 24.900170533567778 23.73172745054627 25.3646994914126 20-24 25.828025217420574 25.18327416877713 23.59882934524735 25.38987126855495 25-29 25.961659675536314 24.922766120323338 23.644326026842045 25.4712481772983 30-34 25.78200918025167 25.017197624663655 23.924488678557047 25.27630451652763 35-39 25.849893432206862 25.020534721575196 23.865959644412044 25.263612201805902 40-44 26.05954707669368 24.84249269633314 23.717419227514196 25.38054099945899 45-49 26.0752658592706 24.9282370650815 23.917833052574885 25.078664023073017 50-54 26.04160304634905 25.123408162533643 23.904248126458622 24.93074066465869 55-59 26.340779540170644 25.007591875876816 23.67134808627517 24.980280497677366 60-64 26.307650254001175 24.968515932326348 23.866817448161452 24.857016365511022 65-69 26.237126653128396 25.121771997019387 23.90568740898568 24.735413940866536 70-74 26.44870066237025 25.007791370044213 23.840895150174067 24.702612817411477 75-79 26.326670811305963 24.982918834152954 24.01394641790336 24.676463936637727 80-84 26.37341250362073 25.17498941623385 23.861306745809102 24.59029133433632 85-89 26.57251421967917 24.93352482964685 23.84221904630729 24.651741904366688 90-94 26.418822937576998 25.046988711679568 23.89903395102579 24.635154399717642 95-99 26.537467733319854 25.289375820612335 23.80018685083286 24.37296959523495 100-104 26.687517636890274 25.24915320078861 23.725547309245385 24.337781853075732 105-109 26.547429908024572 25.308901181686988 23.780986320575273 24.362682589713167 110-114 26.766187010027302 25.382544352847535 23.69450540811272 24.15676322901244 115-119 27.0187432342689 25.32293784197811 23.534977111308265 24.123341812444725 120-124 26.911539142152623 25.652702222915984 23.575577830025175 23.86018080490622 125-129 27.068695633759415 25.630132747962435 23.53079086720924 23.770380751068906 130-134 27.514606354531583 25.588969058794092 23.37908808657128 23.51733650010305 135-139 27.584769702375887 25.75954563273247 23.374609633621183 23.28107503127046 140-144 27.78989524963392 25.712492504933632 23.357747955256592 23.13986429017586 145-149 28.10483648280398 25.722553382249963 23.152955180998003 23.019654953948052 150-151 28.378899167683702 25.436516869438304 23.316617166958782 22.867966795919216 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2060.0 1 1883.0 2 1932.0 3 2487.0 4 3250.0 5 4078.5 6 4908.0 7 5648.0 8 6304.5 9 6890.0 10 7349.5 11 7828.0 12 8298.5 13 8659.5 14 9040.0 15 9244.5 16 9510.0 17 9855.0 18 10107.5 19 10527.5 20 11070.0 21 11832.0 22 12832.0 23 14091.5 24 15975.5 25 18898.0 26 23217.0 27 29615.0 28 38085.5 29 49230.0 30 66069.0 31 88154.0 32 115294.0 33 152302.0 34 205085.5 35 273352.5 36 362192.0 37 479534.0 38 620631.0 39 786632.0 40 981499.5 41 1211542.5 42 1378142.0 43 1483178.5 44 1600481.5 45 1673619.0 46 1691217.5 47 1666709.0 48 1611788.5 49 1533936.5 50 1449012.5 51 1383085.5 52 1283444.5 53 1171144.5 54 1085620.0 55 1004885.0 56 923410.0 57 853524.0 58 835991.0 59 825290.5 60 794337.5 61 755548.0 62 724057.0 63 699406.0 64 675030.5 65 656733.5 66 629096.0 67 601676.0 68 564734.5 69 512506.0 70 459930.5 71 403687.5 72 349866.5 73 297724.0 74 242329.0 75 190966.0 76 147394.5 77 108579.5 78 77025.5 79 53626.5 80 36239.5 81 25157.0 82 17920.5 83 12292.0 84 8154.0 85 5957.0 86 4880.0 87 4347.0 88 4004.5 89 3741.0 90 3585.5 91 3563.0 92 3513.0 93 3478.0 94 3559.0 95 3690.0 96 3865.5 97 4158.5 98 4730.5 99 6153.0 100 21387.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0017286012933854444 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 1.5405963188782663E-4 15-19 0.0 20-24 0.0 25-29 0.0 30-34 1.0444720805954348E-6 35-39 4.2823355304412824E-5 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 7.467975376257358E-5 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 8.878012685061194E-6 90-94 3.6556522820840213E-6 95-99 0.0 100-104 0.0 105-109 0.0 110-114 1.4622609128336085E-5 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 4.125664718351967E-5 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 3.8296859E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 42.0856442311575 #Duplication Level Percentage of deduplicated Percentage of total 1 69.96090059809774 29.443495726629155 2 12.827354013032712 10.796949148392104 3 5.773074878557584 7.2889072637642185 4 3.1557628825537782 5.312492558122015 5 1.9735878178241926 4.152985737994773 6 1.2972834113269438 3.2758204869652876 7 0.9478714699485198 2.7924247022782396 8 0.6785355712710648 2.2845285320559396 9 0.5104846118092253 1.9335666382275245 >10 2.6455189284884564 19.58092282099099 >50 0.1485418117686643 4.2963758076415655 >100 0.07534539940535746 5.750529958943877 >500 0.0041191208154874774 1.1703673924896774 >1k 0.0014819268871344065 1.0650348303592752 >5k 9.629074932697254E-5 0.3083197047405147 >10k+ 4.126746378349602E-5 0.5472786904049317 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCCGTTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 72563 0.18947506896061633 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 61276 0.16000267802641466 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0017416571943928874 0.0 5.222360402977174E-6 0.0 0.0 2 0.0017599354558033074 0.0 1.566708120893152E-5 0.0 2.611180201488587E-6 3 0.0017834360776167047 1.566708120893152E-5 1.566708120893152E-5 0.0 5.222360402977174E-6 4 0.0018121590598330793 1.566708120893152E-5 1.566708120893152E-5 0.0 7.83354060446576E-6 5 0.0018278261410420108 1.566708120893152E-5 1.827826141042011E-5 0.0 7.83354060446576E-6 6 0.0019009391866836912 1.566708120893152E-5 2.0889441611908696E-5 0.0 7.83354060446576E-6 7 0.0019139950876911342 1.827826141042011E-5 2.350062181339728E-5 0.0 7.83354060446576E-6 8 0.00194010688970602 1.827826141042011E-5 2.350062181339728E-5 5.222360402977174E-6 7.83354060446576E-6 9 0.001984496953131326 1.827826141042011E-5 2.8722982216374455E-5 5.222360402977174E-6 7.83354060446576E-6 10-11 0.002006691984843979 2.2195031712652988E-5 3.002857231711875E-5 5.222360402977174E-6 7.83354060446576E-6 12-13 0.002045859687866308 2.6111802014885867E-5 3.133416241786304E-5 5.222360402977174E-6 1.0444720805954346E-5 14-15 0.0021033056522990565 2.8722982216374455E-5 3.525093272009592E-5 5.222360402977174E-6 1.566708120893152E-5 16-17 0.0021607516167318056 3.133416241786304E-5 4.700124362679456E-5 5.222360402977174E-6 2.6111802014885867E-5 18-19 0.002215586400963066 3.2639752518607334E-5 4.961242382828315E-5 5.222360402977174E-6 2.8722982216374455E-5 20-21 0.002313505658518888 3.3945342619351626E-5 5.87515545334932E-5 5.222360402977174E-6 2.8722982216374455E-5 22-23 0.0024205640467799203 3.3945342619351626E-5 7.702981594391332E-5 5.222360402977174E-6 2.8722982216374455E-5 24-25 0.002575929268768491 3.525093272009592E-5 9.008571695135625E-5 5.222360402977174E-6 2.8722982216374455E-5 26-27 0.002763934243275669 4.4390063425305976E-5 1.0705838826103207E-4 5.222360402977174E-6 2.8722982216374455E-5 28-29 0.0029845789703014545 4.830683372753885E-5 1.175031090669864E-4 5.222360402977174E-6 2.8722982216374455E-5 30-31 0.0032587528914577563 6.00571446342375E-5 1.5014286158559375E-4 5.222360402977174E-6 3.133416241786304E-5 32-33 0.003602123087953505 6.00571446342375E-5 1.6711553289526954E-4 5.222360402977174E-6 3.133416241786304E-5 34-35 0.003937659743844789 6.00571446342375E-5 1.788658438019682E-4 7.83354060446576E-6 3.133416241786304E-5 36-37 0.004311058512657657 6.00571446342375E-5 1.8539379430568967E-4 7.83354060446576E-6 3.525093272009592E-5 38-39 0.004707957903283922 6.00571446342375E-5 2.0497764581685405E-4 9.139130705210054E-6 3.91677030223288E-5 40-41 0.005159692078141448 6.00571446342375E-5 2.1150559632057554E-4 1.0444720805954348E-5 4.4390063425305976E-5 42-43 0.005654510726323534 6.266832483572608E-5 2.193391369250413E-4 1.0444720805954348E-5 4.4390063425305976E-5 44-45 0.006193719437930928 6.527950503721467E-5 2.2847826763025135E-4 1.3055901007442934E-5 4.700124362679456E-5 46-47 0.006820402686288189 6.789068523870325E-5 2.376173983354614E-4 1.3055901007442934E-5 5.87515545334932E-5 48-49 0.00753847724169755 6.789068523870325E-5 2.4022857853695E-4 1.6972671309675816E-5 7.311304564168043E-5 50-51 0.008430195280505903 7.96409961454019E-5 2.4283975873843857E-4 2.350062181339728E-5 9.008571695135625E-5 52-53 0.009504695933418456 9.139130705210054E-5 2.572012498466258E-4 2.350062181339728E-5 1.0444720805954347E-4 54-55 0.010738478578621813 9.400248725358912E-5 2.950633627682103E-4 2.6111802014885867E-5 1.0966956846252065E-4 56-57 0.012079319612086203 9.400248725358912E-5 3.2639752518607337E-4 2.8722982216374455E-5 1.1619751896624212E-4 58-59 0.013854922149098442 9.400248725358912E-5 3.277031152868177E-4 2.8722982216374455E-5 1.2664223977219645E-4 60-61 0.01621673464134487 9.400248725358912E-5 3.368422459920277E-4 2.8722982216374455E-5 1.2794782987294077E-4 62-63 0.019368429144541593 1.0053043775731059E-4 3.498981469994706E-4 3.002857231711875E-5 1.3447578037666222E-4 64-65 0.023034526147431567 1.0183602785805488E-4 3.577316876039364E-4 3.133416241786304E-5 1.410037308803837E-4 66-67 0.027450031868148768 1.0183602785805488E-4 3.6817640840989077E-4 3.3945342619351626E-5 1.5144845168633804E-4 68-69 0.03293873265167778 1.0575279816028777E-4 3.6817640840989077E-4 3.655652282084022E-5 1.7103230319750242E-4 70-71 0.039941917952070166 1.1228074866400923E-4 3.773155391151008E-4 3.655652282084022E-5 1.984496953131326E-4 72-73 0.04901707474234375 1.1358633876475352E-4 3.8253789951807793E-4 3.655652282084022E-5 2.1411677652206413E-4 74-75 0.06088097198780715 1.2272546946996357E-4 3.9559380052552095E-4 3.655652282084022E-5 2.2456149732801847E-4 76-77 0.07545919105271792 1.396981407796394E-4 4.099552916337081E-4 3.786211292158451E-5 2.4022857853695E-4 78-79 0.09339669344684377 1.4361491108187227E-4 4.151776520366853E-4 4.177888322381739E-5 2.6111802014885867E-4 80-81 0.1155460295059707 1.5144845168633804E-4 4.2823355304412827E-4 4.177888322381739E-5 2.859242320630002E-4 82-83 0.14465024403176252 1.566708120893152E-4 4.4651181445454837E-4 4.177888322381739E-5 3.042024934734204E-4 84-85 0.18114409852776697 1.6450435269378097E-4 4.595677154619913E-4 4.177888322381739E-5 3.577316876039364E-4 86-87 0.22606162035377364 1.6842112299601385E-4 4.700124362679456E-4 4.4390063425305976E-5 3.6295404800691357E-4 88-89 0.27970701200325593 1.7625466360047962E-4 4.739292065701785E-4 4.700124362679456E-5 3.6817640840989077E-4 90-91 0.34449561516259075 1.801714339027125E-4 4.752347966709228E-4 4.961242382828315E-5 3.799267193165894E-4 92-93 0.42243542740672285 1.8278261410420107E-4 4.909018778798543E-4 4.961242382828315E-5 3.8123230941733367E-4 94-95 0.5158033978713502 1.8278261410420107E-4 4.935130580813429E-4 4.961242382828315E-5 3.968993906262652E-4 96-97 0.623715642058269 1.8539379430568967E-4 5.026521887865529E-4 4.961242382828315E-5 4.0473293123073097E-4 98-99 0.7472009649668658 1.8800497450717824E-4 5.157080897939959E-4 4.961242382828315E-5 4.0473293123073097E-4 100-101 0.8872476983034039 1.9061615470866684E-4 5.274584007006946E-4 5.4834784231260325E-5 4.099552916337081E-4 102-103 1.0451784048399375 1.9061615470866684E-4 5.405143017081374E-4 5.744596443274891E-5 4.1256647183519673E-4 104-105 1.2251017766235084 1.932273349101554E-4 5.548757928163248E-4 5.744596443274891E-5 4.177888322381739E-4 106-107 1.427412101864542 2.0367205571610977E-4 5.600981532193018E-4 5.744596443274891E-5 4.2692796294338395E-4 108-109 1.6487096239406998 2.0497764581685405E-4 5.614037433200462E-4 6.00571446342375E-5 4.3084473324561684E-4 110-111 1.885234243361838 2.0758882601834265E-4 5.640149235215348E-4 6.266832483572608E-5 4.4390063425305974E-4 112-113 2.143756750390417 2.1411677652206413E-4 5.653205136222791E-4 6.527950503721467E-5 4.4651181445454837E-4 114-115 2.426695097893015 2.1411677652206413E-4 5.679316938237676E-4 6.789068523870325E-5 4.478174045552927E-4 116-117 2.733873031206032 2.1411677652206413E-4 6.018770364431193E-4 6.919627533944755E-5 4.504285847567812E-4 118-119 3.061583980033454 2.1542236662280842E-4 6.227664780550279E-4 7.702981594391332E-5 4.530397649582698E-4 120-121 3.3998728198571064 2.2325590722727416E-4 6.54100640472891E-4 8.355776644763478E-5 4.634844857642242E-4 122-123 3.7575862291996325 2.2847826763025135E-4 6.736844919840554E-4 8.355776644763478E-5 4.922074679805986E-4 124-125 4.142847589667863 2.3370062803322852E-4 6.828236226892655E-4 8.616894664912337E-5 5.065689590887858E-4 126-127 4.548493128379015 2.4022857853695E-4 6.893515731929869E-4 8.878012685061195E-5 5.170136798947402E-4 128-129 4.973467928531685 2.441453488391829E-4 6.98490703898197E-4 1.0314161795879918E-4 5.326807611036716E-4 130-131 5.410135593626621 2.4936770924216E-4 7.141577851071285E-4 1.0444720805954347E-4 5.862099552341877E-4 132-133 5.864518810798557 2.5067329934290434E-4 7.285192762153158E-4 1.0444720805954347E-4 6.057938067453521E-4 134-135 6.342202894498476 2.5197888944364865E-4 7.363528168197815E-4 1.0575279816028777E-4 6.175441176520508E-4 136-137 6.844016894440351 2.532844795443929E-4 7.494087178272243E-4 1.0705838826103207E-4 6.358223790624709E-4 138-139 7.358253584190808 2.545900696451372E-4 7.546310782302016E-4 1.0836397836177635E-4 6.736844919840554E-4 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCGTT 28285 0.0 38.65327 8 TCCGTTT 31925 0.0 34.35968 9 CATCCGT 36820 0.0 30.027817 7 TCATCCG 43295 0.0 25.520248 6 ATCATCC 60485 0.0 18.902605 5 CTCATCA 67635 0.0 17.311659 2 CCAGACC 57620 0.0 16.206165 145 GCTCATC 76205 0.0 15.916823 1 TCATCAT 83515 0.0 13.828943 3 AGCACAC 34295 0.0 12.261429 1 CGTTTTA 21620 0.0 11.978346 10-14 GCACACA 35090 0.0 11.900818 2 CACACAC 57570 0.0 11.485141 3 CATCATC 110880 0.0 10.6448345 4 TAATACC 24640 0.0 10.521909 15-19 TTTAATA 31700 0.0 10.48856 10-14 GGTTAGA 31565 0.0 10.372584 60-64 ACACAAG 47795 0.0 10.057007 6 TTAATAC 24260 0.0 9.73639 15-19 ACACACA 63265 0.0 9.694927 4 >>END_MODULE skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814815 SRR7814815_1.fastq SRR7814815_2.fastq Input file: SRR7814815_1.fastq Paired file: SRR7814815_2.fastq trimmed: SRR7814815-trimmed-pair1.fastq, SRR7814815-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 11:12:36 2025 >> started Thu Apr 10 11:13:18 2025 >> done (41.882s) 38296859 read pairs processed; of these: 202 ( 0.00%) short read pairs filtered out after trimming by size control 13203 ( 0.03%) empty read pairs filtered out after trimming by size control 38283454 (99.96%) read pairs available; of these: 4320070 (11.28%) trimmed read pairs available after processing 33963384 (88.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 19 0.00% 20 23 0.00% 21 16 0.00% 22 19 0.00% 23 32 0.00% 24 35 0.00% 25 22 0.00% 26 47 0.00% 27 27 0.00% 28 49 0.00% 29 44 0.00% 30 56 0.00% 31 62 0.00% 32 63 0.00% 33 59 0.00% 34 59 0.00% 35 68 0.00% 36 71 0.00% 37 49 0.00% 38 100 0.00% 39 67 0.00% 40 82 0.00% 41 69 0.00% 42 101 0.00% 43 91 0.00% 44 80 0.00% 45 113 0.00% 46 125 0.00% 47 130 0.00% 48 133 0.00% 49 162 0.00% 50 187 0.00% 51 185 0.00% 52 230 0.00% 53 219 0.00% 54 253 0.00% 55 237 0.00% 56 267 0.00% 57 337 0.00% 58 368 0.00% 59 448 0.00% 60 520 0.00% 61 618 0.00% 62 633 0.00% 63 692 0.00% 64 758 0.00% 65 834 0.00% 66 934 0.00% 67 1028 0.00% 68 1173 0.00% 69 1344 0.00% 70 1475 0.00% 71 1730 0.00% 72 2035 0.01% 73 2332 0.01% 74 2425 0.01% 75 2793 0.01% 76 3218 0.01% 77 3432 0.01% 78 3759 0.01% 79 4229 0.01% 80 4890 0.01% 81 5611 0.01% 82 6377 0.02% 83 6991 0.02% 84 7841 0.02% 85 8720 0.02% 86 9625 0.03% 87 10396 0.03% 88 11342 0.03% 89 12658 0.03% 90 13795 0.04% 91 15190 0.04% 92 16598 0.04% 93 18171 0.05% 94 19912 0.05% 95 21044 0.05% 96 22367 0.06% 97 24084 0.06% 98 25828 0.07% 99 27239 0.07% 100 29086 0.08% 101 30728 0.08% 102 32925 0.09% 103 35227 0.09% 104 37425 0.10% 105 39566 0.10% 106 41711 0.11% 107 43334 0.11% 108 44475 0.12% 109 46331 0.12% 110 47901 0.13% 111 50621 0.13% 112 53252 0.14% 113 55385 0.14% 114 57836 0.15% 115 60318 0.16% 116 62474 0.16% 117 64604 0.17% 118 65870 0.17% 119 65885 0.17% 120 68268 0.18% 121 70214 0.18% 122 72765 0.19% 123 76166 0.20% 124 78521 0.21% 125 79710 0.21% 126 81966 0.21% 127 84377 0.22% 128 85639 0.22% 129 86356 0.23% 130 88191 0.23% 131 89698 0.23% 132 92426 0.24% 133 95002 0.25% 134 96903 0.25% 135 100348 0.26% 136 101418 0.26% 137 101376 0.26% 138 103587 0.27% 139 104579 0.27% 140 105668 0.28% 141 106920 0.28% 142 110026 0.29% 143 111520 0.29% 144 113944 0.30% 145 117784 0.31% 146 117916 0.31% 147 120250 0.31% 148 120726 0.32% 149 121089 0.32% 150 122304 0.32% 151 33963384 88.72% 38283454 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=30.54 fanout-score-rank=8 prefix-density=0.30 prefix-fanout=28.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAACGCTTATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=11 fanout-score=146.02 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=20.4 sequence=GCAGCAGCAGCAA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=5.99 fanout-score-rank=22 prefix-density=0.26 prefix-fanout=4.5 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=1033.66 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=23.5 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR7814815 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 11:14:13 Started mapping on | Apr 10 11:14:13 Finished on | Apr 10 11:25:32 Mapping speed, Million of reads per hour | 202.98 Number of input reads | 38283454 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 34102670 Uniquely mapped reads % | 89.08% Average mapped length | 294.71 Number of splices: Total | 34103204 Number of splices: Annotated (sjdb) | 31938432 Number of splices: GT/AG | 33622421 Number of splices: GC/AG | 381773 Number of splices: AT/AC | 21026 Number of splices: Non-canonical | 77984 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 3.27 Insertion rate per base | 0.03% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 542204 % of reads mapped to multiple loci | 1.42% Number of reads mapped to too many loci | 22661 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.03% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3638580 3638580 3638580 N_multimapping 542204 542204 542204 N_noFeature 1159417 33060759 1581419 N_ambiguous 727165 5083 107770 UnstrandedReadsAssigned:32216088 PositiveStrandReadsAssigned:1036828 NegativeStrandReadsAssigned:32413481 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814815 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814815-trimmed-pair1.fastq SRR7814815-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,283,454 reads, 33,148,522 reads pseudoaligned [quant] estimated average fragment length: 265.143 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52973 SRR7814815.ke.tsv 35125 SRR7814815.se.tsv 88098 total ==> SRR7814815.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.603 0 0 PNS24247 1044 779.857 173.931 9.76778 PNS24249 1928 1663.86 392.56 10.3329 PNS24246 1044 779.857 173.931 9.76778 PNS24248 1044 779.857 173.931 9.76778 PNS24244 1471 1206.86 202.646 7.35387 PNS24243 293 96.8893 19 8.58837 KQK14069 1603 1338.86 14181 463.879 KQK14071 474 234.959 120.638 22.4866 ==> SRR7814815.se.tsv <== BRADI_1g14170v3 14754 BRADI_1g53295v3 2189 BRADI_1g59795v3 194 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 763 BRADI_1g74790v3 775 BRADI_1g09890v3 0 BRADI_1g77505v3 557 BRADI_1g48960v3 0 SRR7814815 completed mapping pipeline successfully