Starting /dee2/code/volunteer_pipeline.sh SRR7814816 current disk space = 1551570485248 free memory = 1598715368 SRR7814816 SRAfilesize ea83c58ed6a4259e8fa417e7919e8310 SRR7814816.sra SRR7814816.sra file validated SRR7814816 is paired end SRR7814816 is conventional basespace SRR7814816 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814816_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4205 37.0 37.0 37.0 37.0 37.0 2 36.375 37.0 37.0 37.0 37.0 37.0 3 36.4965 37.0 37.0 37.0 37.0 37.0 4 36.4465 37.0 37.0 37.0 37.0 37.0 5 36.5395 37.0 37.0 37.0 37.0 37.0 6 36.4975 37.0 37.0 37.0 37.0 37.0 7 36.4925 37.0 37.0 37.0 37.0 37.0 8 36.5705 37.0 37.0 37.0 37.0 37.0 9 36.547 37.0 37.0 37.0 37.0 37.0 10-14 36.5856 37.0 37.0 37.0 37.0 37.0 15-19 36.5287 37.0 37.0 37.0 37.0 37.0 20-24 36.515 37.0 37.0 37.0 37.0 37.0 25-29 36.467699999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.4747 37.0 37.0 37.0 37.0 37.0 35-39 36.4234 37.0 37.0 37.0 37.0 37.0 40-44 36.4029 37.0 37.0 37.0 37.0 37.0 45-49 36.42190000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.3609 37.0 37.0 37.0 37.0 37.0 55-59 36.3815 37.0 37.0 37.0 37.0 37.0 60-64 36.3436 37.0 37.0 37.0 37.0 37.0 65-69 36.333600000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.355599999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.304700000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.221700000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.241200000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.1357 37.0 37.0 37.0 37.0 37.0 95-99 36.203 37.0 37.0 37.0 37.0 37.0 100-104 36.2245 37.0 37.0 37.0 37.0 37.0 105-109 36.1533 37.0 37.0 37.0 37.0 37.0 110-114 36.0979 37.0 37.0 37.0 37.0 37.0 115-119 36.082300000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.031000000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.01370000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.965999999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.91340000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.8979 37.0 37.0 37.0 37.0 37.0 145-149 35.9242 37.0 37.0 37.0 37.0 37.0 150-151 35.45025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 2.0 26 5.0 27 3.0 28 18.0 29 21.0 30 22.0 31 40.0 32 57.0 33 77.0 34 115.0 35 328.0 36 2847.0 37 463.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.50878073256398 11.038635223281485 4.591068740592072 31.86151530356247 2 28.000000000000004 12.3 31.125000000000004 28.575 3 25.05 17.65 22.1 35.199999999999996 4 30.2 23.375 19.400000000000002 27.025 5 27.375 29.45 21.4 21.775 6 23.1 31.624999999999996 22.85 22.425 7 18.625 22.900000000000002 38.925 19.55 8 20.4 20.925 28.575 30.099999999999998 9 21.8 20.175 31.85 26.174999999999997 10-14 25.465 25.240000000000002 23.919999999999998 25.374999999999996 15-19 25.165 24.560000000000002 24.42 25.855 20-24 24.605 23.68 24.63 27.084999999999997 25-29 25.135 24.060000000000002 24.64 26.165 30-34 25.025 24.01 24.42 26.545 35-39 25.080000000000002 23.669999999999998 24.275 26.974999999999998 40-44 24.765 24.435000000000002 23.515 27.284999999999997 45-49 25.56 23.775 24.005000000000003 26.66 50-54 24.555 24.275 24.47 26.700000000000003 55-59 25.1 24.104999999999997 23.775 27.02 60-64 25.619999999999997 24.51 23.835 26.035000000000004 65-69 25.3 23.880000000000003 23.94 26.88 70-74 25.665 23.72 23.375 27.24 75-79 26.11 23.41 23.54 26.939999999999998 80-84 25.22 24.23 23.974999999999998 26.575 85-89 25.355 23.595 23.89 27.16 90-94 25.590000000000003 23.835 24.16 26.415 95-99 25.69 24.145 23.41 26.755000000000003 100-104 25.619999999999997 23.56 24.11 26.71 105-109 26.22 23.485 23.3 26.995 110-114 25.855 23.485 23.494999999999997 27.165 115-119 26.275 23.25 23.455000000000002 27.02 120-124 25.929999999999996 23.56 23.3 27.21 125-129 26.055 24.355 22.795 26.795 130-134 26.47 23.69 22.765 27.075 135-139 25.545 24.169999999999998 22.78 27.505000000000003 140-144 26.025 23.89 22.400000000000002 27.685 145-149 25.505 23.419999999999998 23.645 27.43 150-151 25.624999999999996 22.625 23.8125 27.9375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 2.0 29 4.5 30 7.0 31 10.5 32 11.5 33 19.0 34 25.0 35 29.5 36 43.5 37 50.5 38 59.0 39 85.5 40 103.0 41 124.5 42 152.5 43 157.0 44 150.5 45 150.5 46 162.0 47 159.5 48 151.0 49 148.5 50 144.5 51 130.5 52 126.0 53 114.5 54 92.0 55 89.0 56 91.5 57 90.0 58 82.5 59 91.0 60 101.5 61 98.5 62 80.0 63 71.5 64 77.5 65 86.5 66 82.5 67 75.0 68 75.5 69 71.5 70 67.0 71 50.0 72 45.5 73 42.5 74 29.5 75 25.5 76 22.0 77 12.5 78 6.0 79 4.0 80 4.0 81 4.5 82 2.5 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.625 #Duplication Level Percentage of deduplicated Percentage of total 1 90.95172413793104 82.425 2 7.9172413793103456 14.35 3 0.9931034482758622 2.7 4 0.1103448275862069 0.4 5 0.027586206896551724 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTAGAGTTGGTCGTATGAATGCGTAATAGTGACCACCATGTACTCCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.05 0.0 58-59 0.0 0.0 0.0 0.05 0.0 60-61 0.0 0.0 0.0 0.05 0.0 62-63 0.0 0.0 0.0 0.05 0.0 64-65 0.0 0.0 0.0 0.05 0.0 66-67 0.0 0.0 0.0 0.05 0.0 68-69 0.0 0.0 0.0 0.05 0.0 70-71 0.0 0.0 0.0 0.05 0.0 72-73 0.0 0.0 0.0 0.05 0.0 74-75 0.025 0.0 0.0 0.05 0.0 76-77 0.025 0.0 0.0 0.05 0.0 78-79 0.05 0.0 0.0 0.05 0.0 80-81 0.0875 0.0 0.0 0.05 0.0 82-83 0.1375 0.0 0.0 0.05 0.0 84-85 0.175 0.0 0.0 0.05 0.0 86-87 0.25 0.0 0.0 0.05 0.0 88-89 0.325 0.0 0.0 0.05 0.0 90-91 0.4 0.0 0.0 0.05 0.0 92-93 0.425 0.0 0.0 0.05 0.0 94-95 0.4625 0.0 0.0 0.05 0.0 96-97 0.5 0.0 0.0 0.05 0.0 98-99 0.5875 0.0 0.0 0.05 0.0 100-101 0.7250000000000001 0.0 0.0 0.05 0.0 102-103 0.8374999999999999 0.0 0.0 0.05 0.0 104-105 1.0125 0.0 0.0 0.05 0.0 106-107 1.15 0.0 0.0 0.05 0.0 108-109 1.3375 0.0 0.0 0.05 0.0 110-111 1.625 0.0 0.0 0.05 0.0 112-113 1.925 0.0 0.0 0.05 0.0 114-115 2.25 0.0 0.0 0.05 0.0 116-117 2.4875 0.0 0.0 0.05 0.0 118-119 2.7 0.0 0.0 0.05 0.0 120-121 3.0250000000000004 0.0 0.0 0.05 0.0 122-123 3.475 0.0 0.0 0.05 0.0 124-125 3.925 0.0 0.0 0.05 0.0 126-127 4.2625 0.0 0.0 0.05 0.0 128-129 4.8875 0.0 0.0 0.05 0.0 130-131 5.425000000000001 0.0 0.0 0.05 0.0 132-133 5.9875 0.0 0.0 0.05 0.0 134-135 6.4625 0.0 0.0 0.05 0.0 136-137 6.8375 0.0 0.0 0.05 0.0 138-139 7.35 0.0 0.0 0.05 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814816 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814816_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1985 37.0 37.0 37.0 37.0 37.0 2 35.725 37.0 37.0 37.0 37.0 37.0 3 35.964 37.0 37.0 37.0 37.0 37.0 4 35.928 37.0 37.0 37.0 37.0 37.0 5 35.9565 37.0 37.0 37.0 37.0 37.0 6 36.1265 37.0 37.0 37.0 37.0 37.0 7 35.928 37.0 37.0 37.0 37.0 37.0 8 36.159 37.0 37.0 37.0 37.0 37.0 9 35.9785 37.0 37.0 37.0 37.0 37.0 10-14 36.087 37.0 37.0 37.0 37.0 37.0 15-19 35.9799 37.0 37.0 37.0 37.0 37.0 20-24 35.9816 37.0 37.0 37.0 37.0 37.0 25-29 35.927499999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.922999999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.883500000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.8636 37.0 37.0 37.0 37.0 37.0 45-49 35.84439999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.8246 37.0 37.0 37.0 37.0 37.0 55-59 35.7051 37.0 37.0 37.0 37.0 37.0 60-64 35.6545 37.0 37.0 37.0 37.0 37.0 65-69 35.6871 37.0 37.0 37.0 37.0 37.0 70-74 35.6489 37.0 37.0 37.0 37.0 37.0 75-79 35.637600000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.5448 37.0 37.0 37.0 37.0 37.0 85-89 35.486900000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.4313 37.0 37.0 37.0 37.0 37.0 95-99 35.456900000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.4264 37.0 37.0 37.0 37.0 37.0 105-109 35.44500000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.382000000000005 37.0 37.0 37.0 34.6 37.0 115-119 35.22240000000001 37.0 37.0 37.0 29.8 37.0 120-124 35.1956 37.0 37.0 37.0 29.8 37.0 125-129 35.1675 37.0 37.0 37.0 29.8 37.0 130-134 35.2418 37.0 37.0 37.0 32.2 37.0 135-139 34.971500000000006 37.0 37.0 37.0 27.4 37.0 140-144 34.795 37.0 37.0 37.0 25.0 37.0 145-149 34.8284 37.0 37.0 37.0 25.0 37.0 150-151 34.027 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 0.0 15 6.0 16 3.0 17 2.0 18 2.0 19 1.0 20 7.0 21 3.0 22 6.0 23 10.0 24 11.0 25 10.0 26 11.0 27 16.0 28 26.0 29 29.0 30 25.0 31 61.0 32 92.0 33 132.0 34 259.0 35 687.0 36 2432.0 37 164.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.05 19.45 5.525 27.975 2 29.7 22.6 26.400000000000002 21.3 3 23.474999999999998 23.724999999999998 25.75 27.05 4 27.425 29.725 17.45 25.4 5 28.425 32.125 18.325 21.125 6 24.224999999999998 33.525 18.625 23.625 7 23.674999999999997 18.525 32.95 24.85 8 23.175 23.125 23.400000000000002 30.3 9 23.150000000000002 21.775 27.025 28.050000000000004 10-14 27.155 24.279999999999998 21.845 26.72 15-19 26.555 23.995 23.125 26.325 20-24 26.334999999999997 24.485 22.115000000000002 27.065 25-29 26.5 24.575 22.259999999999998 26.665 30-34 26.66 24.474999999999998 22.745 26.119999999999997 35-39 26.779999999999998 24.33 22.73 26.16 40-44 26.56 24.26 22.35 26.83 45-49 27.015 23.755000000000003 22.515 26.715 50-54 27.150000000000002 23.575 22.189999999999998 27.084999999999997 55-59 27.42 23.395 22.185 27.0 60-64 26.35 23.345 23.31 26.995 65-69 26.56 23.625 23.169999999999998 26.645000000000003 70-74 27.224999999999998 23.015 23.305 26.455000000000002 75-79 26.68 23.235 22.535 27.55 80-84 27.145000000000003 23.54 22.435 26.88 85-89 27.005000000000003 23.36 23.13 26.505000000000003 90-94 27.435 23.685000000000002 22.495 26.384999999999998 95-99 28.110000000000003 23.445 22.99 25.455 100-104 27.54 23.115 23.485 25.86 105-109 27.33 23.189999999999998 22.615 26.865 110-114 27.534999999999997 24.07 22.46 25.935000000000002 115-119 27.66 23.435 23.0 25.905 120-124 27.939999999999998 23.630000000000003 22.6 25.83 125-129 28.28 23.425 22.63 25.665 130-134 28.185 24.16 22.35 25.305 135-139 27.935 24.41 22.27 25.385 140-144 28.38 24.065 22.255 25.3 145-149 28.26 23.995 22.71 25.035 150-151 28.449999999999996 23.5625 23.1125 24.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 1.5 7 1.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.5 20 1.5 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 0.5 29 4.5 30 5.0 31 3.5 32 12.5 33 17.5 34 21.0 35 30.0 36 33.5 37 41.5 38 51.5 39 59.0 40 84.5 41 100.5 42 114.0 43 135.0 44 140.5 45 146.5 46 148.5 47 137.0 48 132.0 49 135.0 50 139.0 51 131.5 52 115.0 53 107.5 54 111.5 55 102.0 56 81.5 57 96.5 58 117.5 59 108.0 60 102.5 61 109.0 62 119.0 63 123.0 64 103.5 65 85.5 66 78.5 67 74.0 68 71.5 69 70.0 70 75.5 71 67.5 72 47.5 73 47.0 74 41.5 75 29.5 76 23.5 77 17.0 78 11.0 79 5.5 80 3.0 81 3.5 82 3.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 1.0 95 1.5 96 1.0 97 1.0 98 1.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.775 #Duplication Level Percentage of deduplicated Percentage of total 1 90.81035923141187 81.525 2 7.685881370091896 13.8 3 1.113895850737956 3.0 4 0.2506265664160401 0.8999999999999999 5 0.0556947925368978 0.25 6 0.0278473962684489 0.15 7 0.0278473962684489 0.17500000000000002 8 0.0278473962684489 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 8 0.2 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GCTCATCATCCGTTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 6 0.15 No Hit GTTTACAGGATGCAAAAAAGGGTGTTCTCTTCCTCGATTTCCCCCCTGTT 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.8875 0.0 0.0 0.0 0.0 114-115 2.2125000000000004 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.6500000000000004 0.0 0.0 0.0 0.0 120-121 2.9749999999999996 0.0 0.0 0.0 0.0 122-123 3.4 0.0 0.0 0.0 0.0 124-125 3.825 0.0 0.0 0.0 0.0 126-127 4.175 0.0 0.0 0.0 0.0 128-129 4.7875 0.0 0.0 0.0 0.0 130-131 5.325 0.0 0.0 0.0 0.0 132-133 5.9125 0.0 0.0 0.0 0.0 134-135 6.425 0.0 0.0 0.0 0.0 136-137 6.8125 0.0 0.0 0.0 0.0 138-139 7.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCCCAT 10 0.006830828 145.0 9 CCTCCAC 10 0.006830828 145.0 9 >>END_MODULE Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155426 spots for SRR7814816.sra Written 3155426 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra Read 3155412 spots for SRR7814816.sra Written 3155412 spots for SRR7814816.sra SRR ids: ['SRR7814816.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t96mjah6 SRR7814816.sra spots: 63108254 blocks: [[1, 3155412], [3155413, 6310824], [6310825, 9466236], [9466237, 12621648], [12621649, 15777060], [15777061, 18932472], [18932473, 22087884], [22087885, 25243296], [25243297, 28398708], [28398709, 31554120], [31554121, 34709532], [34709533, 37864944], [37864945, 41020356], [41020357, 44175768], [44175769, 47331180], [47331181, 50486592], [50486593, 53642004], [53642005, 56797416], [56797417, 59952828], [59952829, 63108254]] SRR7814816 file size 21363616 SRR7814816 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814816 SRR7814816_1.fastq SRR7814816_2.fastq Input file: SRR7814816_1.fastq Paired file: SRR7814816_2.fastq trimmed: SRR7814816-trimmed-pair1.fastq, SRR7814816-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:07:43 2024 >> started Fri Dec 6 11:08:50 2024 >> done (67.159s) 63108254 read pairs processed; of these: 400 ( 0.00%) short read pairs filtered out after trimming by size control 8741 ( 0.01%) empty read pairs filtered out after trimming by size control 63099113 (99.99%) read pairs available; of these: 6903686 (10.94%) trimmed read pairs available after processing 56195427 (89.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 28 0.00% 19 23 0.00% 20 40 0.00% 21 31 0.00% 22 31 0.00% 23 42 0.00% 24 44 0.00% 25 55 0.00% 26 57 0.00% 27 83 0.00% 28 56 0.00% 29 97 0.00% 30 81 0.00% 31 87 0.00% 32 76 0.00% 33 88 0.00% 34 82 0.00% 35 112 0.00% 36 89 0.00% 37 113 0.00% 38 116 0.00% 39 114 0.00% 40 120 0.00% 41 154 0.00% 42 145 0.00% 43 163 0.00% 44 143 0.00% 45 155 0.00% 46 181 0.00% 47 255 0.00% 48 229 0.00% 49 268 0.00% 50 278 0.00% 51 348 0.00% 52 353 0.00% 53 359 0.00% 54 426 0.00% 55 440 0.00% 56 444 0.00% 57 524 0.00% 58 614 0.00% 59 736 0.00% 60 818 0.00% 61 890 0.00% 62 996 0.00% 63 1142 0.00% 64 1176 0.00% 65 1370 0.00% 66 1440 0.00% 67 1630 0.00% 68 1925 0.00% 69 2122 0.00% 70 2414 0.00% 71 2843 0.00% 72 3221 0.01% 73 3634 0.01% 74 4074 0.01% 75 4641 0.01% 76 4985 0.01% 77 5504 0.01% 78 6166 0.01% 79 7100 0.01% 80 7977 0.01% 81 9108 0.01% 82 10105 0.02% 83 11598 0.02% 84 12438 0.02% 85 13912 0.02% 86 15133 0.02% 87 16232 0.03% 88 17803 0.03% 89 19706 0.03% 90 21516 0.03% 91 24232 0.04% 92 26376 0.04% 93 28472 0.05% 94 31220 0.05% 95 33343 0.05% 96 35868 0.06% 97 38490 0.06% 98 40194 0.06% 99 43321 0.07% 100 46168 0.07% 101 48679 0.08% 102 52480 0.08% 103 56020 0.09% 104 58823 0.09% 105 61378 0.10% 106 65020 0.10% 107 67655 0.11% 108 69972 0.11% 109 73204 0.12% 110 76267 0.12% 111 79343 0.13% 112 83536 0.13% 113 87945 0.14% 114 91720 0.15% 115 96250 0.15% 116 97934 0.16% 117 101649 0.16% 118 102545 0.16% 119 104616 0.17% 120 109250 0.17% 121 111294 0.18% 122 114337 0.18% 123 119482 0.19% 124 125311 0.20% 125 127633 0.20% 126 131738 0.21% 127 134371 0.21% 128 134395 0.21% 129 138370 0.22% 130 141253 0.22% 131 143914 0.23% 132 148536 0.24% 133 151874 0.24% 134 155748 0.25% 135 159185 0.25% 136 160717 0.25% 137 162214 0.26% 138 164746 0.26% 139 168684 0.27% 140 169959 0.27% 141 173456 0.27% 142 178430 0.28% 143 180616 0.29% 144 186864 0.30% 145 190432 0.30% 146 189932 0.30% 147 194108 0.31% 148 196625 0.31% 149 196469 0.31% 150 199524 0.32% 151 56195427 89.06% 63099113 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=12 prefix-density=0.88 prefix-fanout=3.2 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=36 fanout-score=20.83 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=5.3 sequence=TTCTTGGCGAACGTCTCTGGGTCAGCTGACAACCCCGCGGTGTCCCAGCCGTAGTCACCGGGGAACTCGCCGGTCAGGTA criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=15 prefix-density=0.83 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=67.37 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=4.7 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7814816 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:09:37 Started mapping on | Dec 06 11:09:37 Finished on | Dec 06 11:19:04 Mapping speed, Million of reads per hour | 400.63 Number of input reads | 63099113 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 59025602 Uniquely mapped reads % | 93.54% Average mapped length | 295.54 Number of splices: Total | 54403471 Number of splices: Annotated (sjdb) | 51319534 Number of splices: GT/AG | 53655197 Number of splices: GC/AG | 602545 Number of splices: AT/AC | 21733 Number of splices: Non-canonical | 123996 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.03% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 831686 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 39347 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.72% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3241825 3241825 3241825 N_multimapping 831686 831686 831686 N_noFeature 1818755 57290159 2408686 N_ambiguous 1469216 7667 325717 UnstrandedReadsAssigned:55737631 PositiveStrandReadsAssigned:1727776 NegativeStrandReadsAssigned:56291199 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814816 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814816-trimmed-pair1.fastq SRR7814816-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 63,099,113 reads, 56,850,225 reads pseudoaligned [quant] estimated average fragment length: 260.939 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR7814816.ke.tsv 35125 SRR7814816.se.tsv 88098 total ==> SRR7814816.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 676.537 0 0 PNS24247 1044 784.061 111.982 3.35587 PNS24249 1928 1668.06 335.918 4.73182 PNS24246 1044 784.061 111.982 3.35587 PNS24248 1044 784.061 111.982 3.35587 PNS24244 1471 1211.06 165.136 3.20393 PNS24243 293 96.5364 2 0.486794 KQK14069 1603 1343.06 16632.8 290.989 KQK14071 474 237.505 289.1 28.601 ==> SRR7814816.se.tsv <== BRADI_1g14170v3 18237 BRADI_1g53295v3 5191 BRADI_1g59795v3 167 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 716 BRADI_1g74790v3 978 BRADI_1g09890v3 0 BRADI_1g77505v3 720 BRADI_1g48960v3 0 SRR7814816 completed mapping pipeline successfully