Starting /dee2/code/volunteer_pipeline.sh SRR7814817 current disk space = 1551576535040 free memory = 1601116444 SRR7814817 SRAfilesize a08dabea9535b6cf76ac924c2eb888d5 SRR7814817.sra SRR7814817.sra file validated SRR7814817 is paired end SRR7814817 is conventional basespace SRR7814817 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814817_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3855 37.0 37.0 37.0 37.0 37.0 2 36.368 37.0 37.0 37.0 37.0 37.0 3 36.469 37.0 37.0 37.0 37.0 37.0 4 36.585 37.0 37.0 37.0 37.0 37.0 5 36.557 37.0 37.0 37.0 37.0 37.0 6 36.629 37.0 37.0 37.0 37.0 37.0 7 36.5645 37.0 37.0 37.0 37.0 37.0 8 36.604 37.0 37.0 37.0 37.0 37.0 9 36.6005 37.0 37.0 37.0 37.0 37.0 10-14 36.581 37.0 37.0 37.0 37.0 37.0 15-19 36.535900000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.4759 37.0 37.0 37.0 37.0 37.0 25-29 36.495599999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.279399999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.2017 37.0 37.0 37.0 37.0 37.0 40-44 36.173899999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.2895 37.0 37.0 37.0 37.0 37.0 50-54 36.2537 37.0 37.0 37.0 37.0 37.0 55-59 36.2478 37.0 37.0 37.0 37.0 37.0 60-64 36.269 37.0 37.0 37.0 37.0 37.0 65-69 36.134 37.0 37.0 37.0 37.0 37.0 70-74 36.030499999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.0116 37.0 37.0 37.0 37.0 37.0 80-84 36.0101 37.0 37.0 37.0 37.0 37.0 85-89 36.0392 37.0 37.0 37.0 37.0 37.0 90-94 35.9083 37.0 37.0 37.0 37.0 37.0 95-99 35.5581 37.0 37.0 37.0 37.0 37.0 100-104 35.29480000000001 37.0 37.0 37.0 32.2 37.0 105-109 35.42989999999999 37.0 37.0 37.0 34.6 37.0 110-114 35.594 37.0 37.0 37.0 37.0 37.0 115-119 35.419200000000004 37.0 37.0 37.0 37.0 37.0 120-124 34.8168 37.0 37.0 37.0 25.0 37.0 125-129 34.4894 37.0 37.0 37.0 25.0 37.0 130-134 35.076800000000006 37.0 37.0 37.0 27.4 37.0 135-139 34.8784 37.0 37.0 37.0 25.0 37.0 140-144 35.016200000000005 37.0 37.0 37.0 25.0 37.0 145-149 34.8902 37.0 37.0 37.0 25.0 37.0 150-151 34.129 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 0.0 25 5.0 26 6.0 27 10.0 28 16.0 29 30.0 30 49.0 31 62.0 32 92.0 33 138.0 34 272.0 35 581.0 36 2546.0 37 188.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.34752128192289 10.99148723084627 6.86029043565348 33.80070105157736 2 27.1 13.05 29.75 30.099999999999998 3 23.1 18.525 23.1 35.275 4 28.775000000000002 24.825 19.15 27.250000000000004 5 28.249999999999996 27.825 22.075 21.85 6 23.875 31.5 22.025 22.6 7 19.625 22.975 38.45 18.95 8 21.25 23.275000000000002 27.85 27.625 9 21.4 21.325 31.825 25.45 10-14 24.26 25.900000000000002 24.41 25.430000000000003 15-19 24.735 24.834999999999997 24.355 26.075 20-24 24.585 24.82 24.07 26.525 25-29 24.73 24.310000000000002 23.86 27.1 30-34 24.455 24.779999999999998 24.125 26.640000000000004 35-39 24.759999999999998 24.245 23.885 27.11 40-44 24.81 24.57 24.15 26.47 45-49 25.205 24.8 23.5 26.495 50-54 25.52 24.275 23.465 26.740000000000002 55-59 25.064999999999998 24.46 23.525 26.950000000000003 60-64 24.44 24.07 24.035 27.455000000000002 65-69 25.775 23.544999999999998 23.555 27.125 70-74 24.905 24.515 23.565 27.015 75-79 25.28 23.34 24.11 27.27 80-84 25.924999999999997 24.075 22.99 27.01 85-89 25.674999999999997 23.549999999999997 23.57 27.205000000000002 90-94 25.81 23.565 23.455000000000002 27.169999999999998 95-99 26.205000000000002 23.205000000000002 23.485 27.105 100-104 25.619999999999997 24.0 22.865 27.515 105-109 26.415 23.73 22.67 27.185 110-114 26.07 24.04 22.535 27.355 115-119 26.090000000000003 23.425 23.185 27.3 120-124 25.96 23.41 23.235 27.395000000000003 125-129 25.435000000000002 23.93 23.105 27.529999999999998 130-134 26.11 23.1 23.1 27.689999999999998 135-139 26.41 23.3 23.01 27.279999999999998 140-144 26.240000000000002 23.53 22.435 27.794999999999998 145-149 26.1 23.415 22.8 27.685 150-151 26.4125 23.5625 22.3625 27.6625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 2.5 28 1.5 29 4.0 30 7.5 31 8.5 32 12.5 33 21.5 34 27.0 35 29.5 36 33.5 37 49.5 38 75.5 39 92.5 40 106.5 41 116.0 42 132.5 43 154.5 44 159.0 45 161.5 46 154.5 47 149.5 48 161.0 49 141.0 50 116.0 51 119.0 52 132.0 53 136.0 54 116.0 55 95.5 56 88.0 57 83.5 58 80.5 59 87.5 60 96.5 61 105.5 62 100.0 63 82.5 64 79.5 65 81.5 66 91.0 67 93.0 68 70.5 69 54.0 70 50.5 71 41.5 72 35.5 73 40.0 74 32.5 75 22.5 76 17.0 77 13.5 78 11.5 79 6.5 80 6.5 81 6.0 82 3.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 87.79235596120935 76.95 2 10.610382201939531 18.6 3 1.3405590416428979 3.5249999999999995 4 0.22818026240730174 0.8 5 0.028522532800912718 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAAATTCACAAAGCGGAAAGAACAGATGATCTAAATACATATTCTAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0750000000000002 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.65 0.0 0.0 0.0 0.0 112-113 3.025 0.0 0.0 0.0 0.0 114-115 3.4625 0.0 0.0 0.0 0.0 116-117 3.7750000000000004 0.0 0.0 0.0 0.0 118-119 4.5125 0.0 0.0 0.0 0.0 120-121 4.9 0.0 0.0 0.0 0.0 122-123 5.475 0.0 0.0 0.0 0.0 124-125 6.0 0.0 0.0 0.0 0.0 126-127 6.4125 0.0 0.0 0.0 0.0 128-129 6.775 0.0 0.0 0.0 0.0 130-131 7.1625 0.0 0.0 0.0 0.0 132-133 7.8125 0.0 0.0 0.0 0.0 134-135 8.45 0.0 0.0 0.0 0.0 136-137 9.0 0.0 0.0 0.0 0.0 138-139 9.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814817 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814817_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0585 37.0 37.0 37.0 37.0 37.0 2 35.8535 37.0 37.0 37.0 37.0 37.0 3 35.848 37.0 37.0 37.0 37.0 37.0 4 35.875 37.0 37.0 37.0 37.0 37.0 5 35.8855 37.0 37.0 37.0 37.0 37.0 6 35.667 37.0 37.0 37.0 37.0 37.0 7 35.612 37.0 37.0 37.0 37.0 37.0 8 35.5285 37.0 37.0 37.0 37.0 37.0 9 35.8535 37.0 37.0 37.0 37.0 37.0 10-14 35.7784 37.0 37.0 37.0 37.0 37.0 15-19 35.309999999999995 37.0 37.0 37.0 34.6 37.0 20-24 35.5072 37.0 37.0 37.0 37.0 37.0 25-29 35.3715 37.0 37.0 37.0 34.6 37.0 30-34 35.12349999999999 37.0 37.0 37.0 29.8 37.0 35-39 35.125800000000005 37.0 37.0 37.0 32.2 37.0 40-44 34.859 37.0 37.0 37.0 25.0 37.0 45-49 34.9957 37.0 37.0 37.0 27.4 37.0 50-54 34.26809999999999 37.0 37.0 37.0 25.0 37.0 55-59 34.1241 37.0 37.0 37.0 25.0 37.0 60-64 34.531 37.0 37.0 37.0 25.0 37.0 65-69 34.436400000000006 37.0 37.0 37.0 25.0 37.0 70-74 34.0152 37.0 37.0 37.0 25.0 37.0 75-79 33.8934 37.0 37.0 37.0 25.0 37.0 80-84 33.7277 37.0 37.0 37.0 22.2 37.0 85-89 34.0976 37.0 37.0 37.0 25.0 37.0 90-94 33.5825 37.0 37.0 37.0 19.4 37.0 95-99 32.7681 37.0 37.0 37.0 11.0 37.0 100-104 33.1246 37.0 37.0 37.0 16.6 37.0 105-109 32.6339 37.0 37.0 37.0 11.0 37.0 110-114 33.0179 37.0 37.0 37.0 11.0 37.0 115-119 33.2335 37.0 37.0 37.0 16.6 37.0 120-124 32.3651 37.0 34.6 37.0 11.0 37.0 125-129 32.6055 37.0 37.0 37.0 11.0 37.0 130-134 32.056 37.0 29.8 37.0 11.0 37.0 135-139 32.0784 37.0 29.8 37.0 11.0 37.0 140-144 32.1883 37.0 29.8 37.0 11.0 37.0 145-149 31.798099999999998 37.0 27.4 37.0 11.0 37.0 150-151 31.139249999999997 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 4.0 15 1.0 16 8.0 17 5.0 18 7.0 19 7.0 20 9.0 21 17.0 22 19.0 23 35.0 24 44.0 25 72.0 26 71.0 27 90.0 28 98.0 29 108.0 30 137.0 31 148.0 32 173.0 33 227.0 34 332.0 35 708.0 36 1637.0 37 40.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.025000000000006 18.7 8.85 29.425 2 31.974999999999998 21.325 23.625 23.075000000000003 3 26.224999999999998 25.3 23.474999999999998 25.0 4 28.1 28.999999999999996 18.55 24.349999999999998 5 28.95 31.225 17.5 22.325 6 26.400000000000002 34.050000000000004 16.725 22.825 7 24.349999999999998 19.725 29.9 26.025 8 25.75 21.925 20.925 31.4 9 26.224999999999998 22.0 23.75 28.025 10-14 28.43 24.625 20.825 26.119999999999997 15-19 27.705000000000002 23.925 21.759999999999998 26.61 20-24 27.339999999999996 23.810000000000002 22.345000000000002 26.505000000000003 25-29 27.88 24.015 21.93 26.174999999999997 30-34 27.275 24.865000000000002 21.425 26.435 35-39 28.144999999999996 24.224999999999998 21.54 26.090000000000003 40-44 27.505000000000003 23.885 21.995 26.615 45-49 27.58 23.735 22.765 25.919999999999998 50-54 27.275 24.275 21.965 26.484999999999996 55-59 28.115000000000002 24.015 21.925 25.945 60-64 27.334999999999997 23.965 22.375 26.325 65-69 27.735 24.240000000000002 21.64 26.384999999999998 70-74 27.575 23.835 21.925 26.665 75-79 27.63 24.4 22.06 25.91 80-84 27.295 24.73 22.29 25.685000000000002 85-89 27.405 23.505000000000003 22.03 27.060000000000002 90-94 27.42 24.45 22.395 25.735000000000003 95-99 27.185 25.19 22.14 25.485000000000003 100-104 27.839999999999996 24.22 22.24 25.7 105-109 27.125 25.605 21.84 25.430000000000003 110-114 27.62 25.495 21.985 24.9 115-119 28.175 24.985 21.36 25.480000000000004 120-124 26.939999999999998 26.545 21.95 24.565 125-129 27.639999999999997 25.34 21.975 25.045 130-134 28.144999999999996 26.21 22.02 23.625 135-139 28.560000000000002 26.505000000000003 21.404999999999998 23.53 140-144 29.485 25.5 21.51 23.505000000000003 145-149 29.685 26.51 20.985 22.82 150-151 28.6125 26.3625 22.35 22.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 1.5 24 0.0 25 0.5 26 2.5 27 2.5 28 3.0 29 4.0 30 5.5 31 8.0 32 9.0 33 12.5 34 17.5 35 19.0 36 27.0 37 42.0 38 55.0 39 73.0 40 87.5 41 92.0 42 105.5 43 119.0 44 129.5 45 145.0 46 139.5 47 133.5 48 137.5 49 130.5 50 132.0 51 136.5 52 123.5 53 110.0 54 107.0 55 109.0 56 98.0 57 92.0 58 97.5 59 97.0 60 112.5 61 115.5 62 105.0 63 106.0 64 104.5 65 106.0 66 103.5 67 84.5 68 76.0 69 78.5 70 75.0 71 66.0 72 57.0 73 45.0 74 30.0 75 26.5 76 21.0 77 13.5 78 11.0 79 9.5 80 7.5 81 5.5 82 3.0 83 2.0 84 2.0 85 0.5 86 0.0 87 1.0 88 1.0 89 0.5 90 0.5 91 0.0 92 0.5 93 1.0 94 1.0 95 2.5 96 3.0 97 1.5 98 0.5 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.375 #Duplication Level Percentage of deduplicated Percentage of total 1 90.01398601398601 80.45 2 8.615384615384615 15.4 3 1.034965034965035 2.775 4 0.2517482517482518 0.8999999999999999 5 0.055944055944055944 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027972027972027972 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit AAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGA 5 0.125 No Hit GCTGAGGCGAATGCTGGGGAAGCCGGTGCAGCCGCAGGATCAAAGGACTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2125 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.1125 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.5875000000000004 0.0 0.0 0.0 0.0 114-115 2.9875 0.0 0.0 0.0 0.0 116-117 3.3125 0.0 0.0 0.0 0.0 118-119 3.8875 0.0 0.0 0.0 0.0 120-121 4.25 0.0 0.0 0.0 0.0 122-123 4.7125 0.0 0.0 0.0 0.0 124-125 5.175 0.0 0.0 0.0 0.0 126-127 5.55 0.0 0.0 0.0 0.0 128-129 5.8875 0.0 0.0 0.0 0.0 130-131 6.2 0.0 0.0 0.0 0.0 132-133 6.8125 0.0 0.0 0.0 0.0 134-135 7.375 0.0 0.0 0.0 0.0 136-137 7.8375 0.0 0.0 0.0 0.0 138-139 8.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCCTC 10 0.006830828 145.0 4 CCCCCCC 35 0.0035366106 20.714287 70-74 >>END_MODULE Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387998 spots for SRR7814817.sra Written 1387998 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra Read 1387995 spots for SRR7814817.sra Written 1387995 spots for SRR7814817.sra SRR ids: ['SRR7814817.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0cni99s1 SRR7814817.sra spots: 27759903 blocks: [[1, 1387995], [1387996, 2775990], [2775991, 4163985], [4163986, 5551980], [5551981, 6939975], [6939976, 8327970], [8327971, 9715965], [9715966, 11103960], [11103961, 12491955], [12491956, 13879950], [13879951, 15267945], [15267946, 16655940], [16655941, 18043935], [18043936, 19431930], [19431931, 20819925], [20819926, 22207920], [22207921, 23595915], [23595916, 24983910], [24983911, 26371905], [26371906, 27759903]] SRR7814817 file size 9385219 SRR7814817 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814817 SRR7814817_1.fastq SRR7814817_2.fastq Input file: SRR7814817_1.fastq Paired file: SRR7814817_2.fastq trimmed: SRR7814817-trimmed-pair1.fastq, SRR7814817-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:07:58 2024 >> started Fri Dec 6 11:08:27 2024 >> done (28.901s) 27759903 read pairs processed; of these: 131 ( 0.00%) short read pairs filtered out after trimming by size control 21221 ( 0.08%) empty read pairs filtered out after trimming by size control 27738551 (99.92%) read pairs available; of these: 3910419 (14.10%) trimmed read pairs available after processing 23828132 (85.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 17 0.00% 20 8 0.00% 21 17 0.00% 22 20 0.00% 23 28 0.00% 24 25 0.00% 25 26 0.00% 26 26 0.00% 27 26 0.00% 28 36 0.00% 29 42 0.00% 30 47 0.00% 31 40 0.00% 32 48 0.00% 33 50 0.00% 34 46 0.00% 35 50 0.00% 36 38 0.00% 37 55 0.00% 38 92 0.00% 39 82 0.00% 40 89 0.00% 41 94 0.00% 42 93 0.00% 43 89 0.00% 44 113 0.00% 45 108 0.00% 46 125 0.00% 47 131 0.00% 48 157 0.00% 49 200 0.00% 50 182 0.00% 51 226 0.00% 52 220 0.00% 53 304 0.00% 54 282 0.00% 55 318 0.00% 56 344 0.00% 57 425 0.00% 58 442 0.00% 59 516 0.00% 60 657 0.00% 61 808 0.00% 62 901 0.00% 63 909 0.00% 64 982 0.00% 65 1074 0.00% 66 1205 0.00% 67 1276 0.00% 68 1516 0.01% 69 1851 0.01% 70 2014 0.01% 71 2271 0.01% 72 2638 0.01% 73 3117 0.01% 74 3412 0.01% 75 3625 0.01% 76 4115 0.01% 77 4575 0.02% 78 4876 0.02% 79 5678 0.02% 80 6173 0.02% 81 6907 0.02% 82 7943 0.03% 83 8891 0.03% 84 9928 0.04% 85 10872 0.04% 86 11544 0.04% 87 12371 0.04% 88 13561 0.05% 89 14464 0.05% 90 15683 0.06% 91 17085 0.06% 92 18732 0.07% 93 20436 0.07% 94 22195 0.08% 95 23709 0.09% 96 24842 0.09% 97 26184 0.09% 98 27148 0.10% 99 28839 0.10% 100 29876 0.11% 101 31970 0.12% 102 33845 0.12% 103 35696 0.13% 104 37679 0.14% 105 39249 0.14% 106 40765 0.15% 107 41675 0.15% 108 43088 0.16% 109 43988 0.16% 110 45656 0.16% 111 47387 0.17% 112 49602 0.18% 113 51821 0.19% 114 53445 0.19% 115 56147 0.20% 116 56906 0.21% 117 58884 0.21% 118 60172 0.22% 119 61122 0.22% 120 61732 0.22% 121 62830 0.23% 122 64180 0.23% 123 66553 0.24% 124 69033 0.25% 125 70562 0.25% 126 72981 0.26% 127 74391 0.27% 128 75629 0.27% 129 76509 0.28% 130 76833 0.28% 131 78149 0.28% 132 80026 0.29% 133 82120 0.30% 134 84512 0.30% 135 85309 0.31% 136 87262 0.31% 137 87633 0.32% 138 88814 0.32% 139 90472 0.33% 140 90596 0.33% 141 91900 0.33% 142 93129 0.34% 143 95380 0.34% 144 97854 0.35% 145 98966 0.36% 146 99739 0.36% 147 102171 0.37% 148 101500 0.37% 149 101728 0.37% 150 102661 0.37% 151 23828132 85.90% 27738551 reads passed initial QC criterion=sequence-density sequence-density=1.12 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=24 prefix-density=1.13 prefix-fanout=2.2 sequence=CGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=133.81 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.7 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=1.63 fanout-score-rank=38 prefix-density=0.69 prefix-fanout=1.4 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTACCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTAAGAATCAAGTCATCTCATTCTCATCTATGCAATTGCAAACACAACACAGGGCCGGGTATCTCTCTGCATGTACGTATGCCTGTAATGTACGTAGCTACCTGCTGTGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=85.19 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.0 sequence=CAACAACCACAAAGCAATTAAGCAAAAGCAATGGCCTCCCAGCTCTCCGCCATGGCCTCCGTGCCGCAGTTCCACGGCCTCCGGAGCTACTCGGCGCCGAGGTCATCCATGGCGATGCTGCCAACGCTTAGAGCGTCCAGGAAGAGGTCCCAGGGCATCCGGTGCGACTTCATCGGCTCCTCCACCAACCTCATCATGGTGACGACGACGA SRR7814817 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:09:27 Started mapping on | Dec 06 11:09:27 Finished on | Dec 06 11:12:21 Mapping speed, Million of reads per hour | 573.90 Number of input reads | 27738551 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 25910005 Uniquely mapped reads % | 93.41% Average mapped length | 292.88 Number of splices: Total | 22463861 Number of splices: Annotated (sjdb) | 21256198 Number of splices: GT/AG | 22135471 Number of splices: GC/AG | 267828 Number of splices: AT/AC | 6707 Number of splices: Non-canonical | 53855 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.03% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300848 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 13732 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.21% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1527698 1527698 1527698 N_multimapping 300848 300848 300848 N_noFeature 455537 24980830 653445 N_ambiguous 880575 2768 149765 UnstrandedReadsAssigned:24573893 PositiveStrandReadsAssigned:926407 NegativeStrandReadsAssigned:25106795 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814817 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814817-trimmed-pair1.fastq SRR7814817-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,738,551 reads, 25,455,065 reads pseudoaligned [quant] estimated average fragment length: 245.431 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR7814817.ke.tsv 35125 SRR7814817.se.tsv 88098 total ==> SRR7814817.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.701 24.0506 1.56602 PNS24247 1044 799.569 7.79724 0.439213 PNS24249 1928 1683.57 33.1807 0.887656 PNS24246 1044 799.569 7.79724 0.439213 PNS24248 1044 799.569 7.79724 0.439213 PNS24244 1471 1226.57 170.377 6.25618 PNS24243 293 102.001 1 0.441556 KQK14069 1603 1358.57 1720.87 57.0501 KQK14071 474 244.417 60.264 11.105 ==> SRR7814817.se.tsv <== BRADI_1g14170v3 1999 BRADI_1g53295v3 790 BRADI_1g59795v3 131 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 274 BRADI_1g74790v3 344 BRADI_1g09890v3 0 BRADI_1g77505v3 771 BRADI_1g48960v3 0 SRR7814817 completed mapping pipeline successfully