Starting /dee2/code/volunteer_pipeline.sh SRR7814819 current disk space = 1551567142912 free memory = 1605404628 SRR7814819 SRAfilesize 6c989b42355ff7af4316942f0283304c SRR7814819.sra SRR7814819.sra file validated SRR7814819 is paired end SRR7814819 is conventional basespace SRR7814819 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814819_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.361 37.0 37.0 37.0 37.0 37.0 2 36.3205 37.0 37.0 37.0 37.0 37.0 3 36.4455 37.0 37.0 37.0 37.0 37.0 4 36.5145 37.0 37.0 37.0 37.0 37.0 5 36.5815 37.0 37.0 37.0 37.0 37.0 6 36.4275 37.0 37.0 37.0 37.0 37.0 7 36.4905 37.0 37.0 37.0 37.0 37.0 8 36.421 37.0 37.0 37.0 37.0 37.0 9 36.562 37.0 37.0 37.0 37.0 37.0 10-14 36.5501 37.0 37.0 37.0 37.0 37.0 15-19 36.4938 37.0 37.0 37.0 37.0 37.0 20-24 36.47 37.0 37.0 37.0 37.0 37.0 25-29 36.4345 37.0 37.0 37.0 37.0 37.0 30-34 36.40659999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.3696 37.0 37.0 37.0 37.0 37.0 40-44 36.381299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3452 37.0 37.0 37.0 37.0 37.0 50-54 36.3431 37.0 37.0 37.0 37.0 37.0 55-59 36.2488 37.0 37.0 37.0 37.0 37.0 60-64 36.290200000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.306200000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.324799999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.25599999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.214800000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1208 37.0 37.0 37.0 37.0 37.0 90-94 36.09609999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.1537 37.0 37.0 37.0 37.0 37.0 100-104 36.144000000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1466 37.0 37.0 37.0 37.0 37.0 110-114 36.1237 37.0 37.0 37.0 37.0 37.0 115-119 36.0465 37.0 37.0 37.0 37.0 37.0 120-124 35.8965 37.0 37.0 37.0 37.0 37.0 125-129 35.8949 37.0 37.0 37.0 37.0 37.0 130-134 35.8895 37.0 37.0 37.0 37.0 37.0 135-139 35.8637 37.0 37.0 37.0 37.0 37.0 140-144 35.8264 37.0 37.0 37.0 37.0 37.0 145-149 35.8351 37.0 37.0 37.0 37.0 37.0 150-151 35.341499999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 4.0 26 6.0 27 11.0 28 10.0 29 24.0 30 24.0 31 49.0 32 51.0 33 83.0 34 155.0 35 359.0 36 2751.0 37 472.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 55.99899598393574 10.16566265060241 5.421686746987952 28.413654618473892 2 27.224999999999998 11.65 30.875000000000004 30.25 3 22.625 18.85 23.599999999999998 34.925 4 28.15 24.275 21.325 26.25 5 26.5 28.499999999999996 22.375 22.625 6 24.349999999999998 30.75 21.825 23.075000000000003 7 18.975 22.525000000000002 38.1 20.4 8 21.725 21.8 28.775000000000002 27.700000000000003 9 22.775000000000002 20.674999999999997 30.3 26.25 10-14 24.740000000000002 25.324999999999996 24.095 25.840000000000003 15-19 24.815 23.755000000000003 25.14 26.290000000000003 20-24 23.785 25.119999999999997 24.205 26.889999999999997 25-29 24.32 24.545 24.34 26.795 30-34 24.395 24.990000000000002 24.46 26.155 35-39 24.975 23.89 24.785 26.35 40-44 24.86 23.825 24.59 26.724999999999998 45-49 24.43 24.19 24.884999999999998 26.495 50-54 25.155 24.224999999999998 24.165 26.455000000000002 55-59 24.610000000000003 23.885 24.515 26.99 60-64 25.495 23.755000000000003 24.175 26.575 65-69 24.87 24.205 24.275 26.650000000000002 70-74 25.169999999999998 23.94 23.49 27.400000000000002 75-79 25.34 24.215 23.36 27.084999999999997 80-84 25.345000000000002 23.855 24.365000000000002 26.435 85-89 25.624999999999996 24.125 23.580000000000002 26.669999999999998 90-94 25.014999999999997 23.14 23.95 27.894999999999996 95-99 25.52 23.62 24.355 26.505000000000003 100-104 25.669999999999998 24.09 23.645 26.595000000000002 105-109 25.45 23.380000000000003 24.175 26.995 110-114 25.2 23.875 23.705000000000002 27.22 115-119 25.319999999999997 24.23 23.625 26.825 120-124 25.8 24.035 23.015 27.150000000000002 125-129 25.590000000000003 24.104999999999997 23.86 26.445 130-134 25.729999999999997 23.599999999999998 23.415 27.255000000000003 135-139 26.029999999999998 23.43 23.685000000000002 26.855 140-144 25.36 23.585 23.885 27.169999999999998 145-149 26.25 23.549999999999997 23.565 26.634999999999998 150-151 26.0375 23.625 23.175 27.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.5 26 1.0 27 1.0 28 2.0 29 8.5 30 9.0 31 7.0 32 13.0 33 22.5 34 29.0 35 42.5 36 55.0 37 51.5 38 61.5 39 77.5 40 90.5 41 111.5 42 143.0 43 151.0 44 147.5 45 152.0 46 151.5 47 170.5 48 162.5 49 148.0 50 148.0 51 138.0 52 135.0 53 116.5 54 100.5 55 107.5 56 111.0 57 92.0 58 85.0 59 99.5 60 94.5 61 81.5 62 73.5 63 79.0 64 88.5 65 82.0 66 72.5 67 62.0 68 52.5 69 51.0 70 60.5 71 56.5 72 49.5 73 45.0 74 27.0 75 20.0 76 19.0 77 11.0 78 9.0 79 7.5 80 4.0 81 4.5 82 2.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.91159460203801 82.525 2 8.041861746075462 14.6 3 1.019003029468466 2.775 4 0.02754062241806665 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 3.0250000000000004 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 4.2125 0.0 0.0 0.0 0.0 126-127 4.55 0.0 0.0 0.0 0.0 128-129 5.0375 0.0 0.0 0.0 0.0 130-131 5.55 0.0 0.0 0.0 0.0 132-133 5.9125 0.0 0.0 0.0 0.0 134-135 6.4375 0.0 0.0 0.0 0.0 136-137 6.824999999999999 0.0 0.0 0.0 0.0 138-139 7.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATTC 10 0.006830828 145.0 7 GGTCAGC 10 0.006830828 145.0 4 CGGTCAG 10 0.006830828 145.0 3 >>END_MODULE SRR7814819 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814819_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8945 37.0 37.0 37.0 37.0 37.0 2 35.6125 37.0 37.0 37.0 37.0 37.0 3 35.7155 37.0 37.0 37.0 37.0 37.0 4 35.7595 37.0 37.0 37.0 37.0 37.0 5 35.7605 37.0 37.0 37.0 37.0 37.0 6 35.69 37.0 37.0 37.0 37.0 37.0 7 35.532 37.0 37.0 37.0 37.0 37.0 8 35.796 37.0 37.0 37.0 37.0 37.0 9 35.7375 37.0 37.0 37.0 37.0 37.0 10-14 35.702099999999994 37.0 37.0 37.0 37.0 37.0 15-19 35.675200000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.625099999999996 37.0 37.0 37.0 37.0 37.0 25-29 35.6081 37.0 37.0 37.0 37.0 37.0 30-34 35.6057 37.0 37.0 37.0 37.0 37.0 35-39 35.5681 37.0 37.0 37.0 37.0 37.0 40-44 35.5616 37.0 37.0 37.0 37.0 37.0 45-49 35.3865 37.0 37.0 37.0 37.0 37.0 50-54 35.4468 37.0 37.0 37.0 37.0 37.0 55-59 35.336 37.0 37.0 37.0 37.0 37.0 60-64 35.332100000000004 37.0 37.0 37.0 34.6 37.0 65-69 35.3144 37.0 37.0 37.0 37.0 37.0 70-74 35.2899 37.0 37.0 37.0 34.6 37.0 75-79 35.2226 37.0 37.0 37.0 32.2 37.0 80-84 35.1622 37.0 37.0 37.0 32.2 37.0 85-89 35.105999999999995 37.0 37.0 37.0 29.8 37.0 90-94 35.1564 37.0 37.0 37.0 29.8 37.0 95-99 35.1492 37.0 37.0 37.0 27.4 37.0 100-104 35.1331 37.0 37.0 37.0 27.4 37.0 105-109 35.0928 37.0 37.0 37.0 29.8 37.0 110-114 35.0141 37.0 37.0 37.0 27.4 37.0 115-119 34.9252 37.0 37.0 37.0 25.0 37.0 120-124 34.8895 37.0 37.0 37.0 25.0 37.0 125-129 34.886900000000004 37.0 37.0 37.0 25.0 37.0 130-134 34.762699999999995 37.0 37.0 37.0 25.0 37.0 135-139 34.5666 37.0 37.0 37.0 25.0 37.0 140-144 34.43820000000001 37.0 37.0 37.0 25.0 37.0 145-149 34.379799999999996 37.0 37.0 37.0 25.0 37.0 150-151 33.58625 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 9.0 15 14.0 16 7.0 17 7.0 18 4.0 19 6.0 20 6.0 21 8.0 22 20.0 23 18.0 24 10.0 25 17.0 26 13.0 27 15.0 28 25.0 29 27.0 30 51.0 31 63.0 32 84.0 33 171.0 34 281.0 35 705.0 36 2290.0 37 144.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.4 20.075000000000003 6.525 24.0 2 32.0 20.225 24.375 23.400000000000002 3 24.175 23.400000000000002 27.450000000000003 24.975 4 30.375000000000004 28.549999999999997 18.675 22.400000000000002 5 30.65 31.5 16.7 21.15 6 24.775 33.675 18.325 23.225 7 23.849999999999998 18.975 33.375 23.799999999999997 8 25.15 22.275 22.975 29.599999999999998 9 25.224999999999998 21.525 23.724999999999998 29.525000000000002 10-14 27.500000000000004 24.92 21.224999999999998 26.355 15-19 26.96 24.195 22.455 26.39 20-24 27.16 24.7 22.005 26.135 25-29 26.99 24.735 22.11 26.165 30-34 27.32 24.560000000000002 21.884999999999998 26.235000000000003 35-39 27.46 24.065 22.02 26.455000000000002 40-44 27.05 24.44 22.145 26.365 45-49 26.87 24.245 22.705000000000002 26.179999999999996 50-54 27.46 24.165 22.41 25.965 55-59 27.36 24.02 22.02 26.6 60-64 26.68 24.505 22.82 25.995 65-69 27.365000000000002 24.104999999999997 22.515 26.015 70-74 27.255000000000003 23.990000000000002 22.49 26.265 75-79 27.034999999999997 24.16 22.919999999999998 25.885 80-84 26.584999999999997 24.175 22.46 26.779999999999998 85-89 27.200000000000003 24.745 22.275 25.779999999999998 90-94 27.095000000000002 24.515 22.994999999999997 25.395 95-99 27.084999999999997 24.73 22.33 25.855 100-104 26.845000000000002 24.385 22.41 26.36 105-109 27.325 24.38 22.63 25.665 110-114 27.634999999999998 24.375 22.805 25.185000000000002 115-119 27.555000000000003 24.66 22.28 25.505 120-124 27.41 24.54 22.220000000000002 25.83 125-129 28.060000000000002 24.709999999999997 22.189999999999998 25.040000000000003 130-134 28.835 24.46 22.11 24.595 135-139 28.64 24.89 22.015 24.455 140-144 28.599999999999998 24.529999999999998 22.575 24.295 145-149 28.985 24.52 22.009999999999998 24.485 150-151 29.362500000000004 24.9375 22.175 23.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.5 5 1.0 6 0.5 7 0.5 8 1.0 9 1.5 10 1.0 11 1.0 12 0.5 13 1.5 14 2.0 15 0.5 16 1.0 17 4.0 18 3.5 19 0.5 20 1.5 21 2.0 22 1.0 23 1.5 24 1.5 25 1.5 26 3.5 27 6.5 28 6.5 29 4.5 30 4.5 31 7.5 32 11.0 33 15.0 34 24.5 35 29.5 36 29.5 37 41.0 38 58.0 39 67.5 40 88.0 41 103.5 42 110.5 43 116.0 44 121.5 45 134.5 46 139.5 47 150.5 48 155.5 49 146.0 50 127.5 51 113.0 52 105.0 53 98.5 54 106.5 55 107.5 56 90.5 57 86.0 58 107.5 59 125.0 60 122.5 61 111.0 62 106.0 63 101.5 64 94.5 65 94.0 66 88.0 67 83.0 68 81.5 69 79.0 70 70.5 71 56.5 72 56.0 73 47.0 74 31.5 75 22.0 76 16.0 77 14.0 78 9.5 79 7.5 80 5.0 81 3.0 82 1.5 83 1.5 84 1.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 1.0 93 1.0 94 0.5 95 0.5 96 1.5 97 2.0 98 2.5 99 2.5 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.44591611479028 82.85 2 7.422737306843268 13.450000000000001 3 0.9105960264900662 2.475 4 0.13796909492273732 0.5 5 0.0 0.0 6 0.02759381898454746 0.15 7 0.0 0.0 8 0.02759381898454746 0.2 9 0.0 0.0 >10 0.02759381898454746 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 15 0.375 No Hit GCTCATCATCCGTTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 8 0.2 No Hit GTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.6 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 4.1 0.0 0.0 0.0 0.0 126-127 4.425 0.0 0.0 0.0 0.0 128-129 4.9 0.0 0.0 0.0 0.0 130-131 5.4 0.0 0.0 0.0 0.0 132-133 5.75 0.0 0.0 0.0 0.0 134-135 6.262499999999999 0.0 0.0 0.0 0.0 136-137 6.6375 0.0 0.0 0.0 0.0 138-139 7.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCAAT 10 0.006830828 145.0 9 GGCCCCG 10 0.006830828 145.0 4 CCCCGCG 10 0.006830828 145.0 6 AGGCCCC 10 0.006830828 145.0 3 CGCGGCC 10 0.006830828 145.0 9 GCCCCGC 25 8.7132835E-4 87.0 5 >>END_MODULE Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012099 spots for SRR7814819.sra Written 3012099 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra Read 3012088 spots for SRR7814819.sra Written 3012088 spots for SRR7814819.sra SRR ids: ['SRR7814819.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_twfzk37i SRR7814819.sra spots: 60241771 blocks: [[1, 3012088], [3012089, 6024176], [6024177, 9036264], [9036265, 12048352], [12048353, 15060440], [15060441, 18072528], [18072529, 21084616], [21084617, 24096704], [24096705, 27108792], [27108793, 30120880], [30120881, 33132968], [33132969, 36145056], [36145057, 39157144], [39157145, 42169232], [42169233, 45181320], [45181321, 48193408], [48193409, 51205496], [51205497, 54217584], [54217585, 57229672], [57229673, 60241771]] SRR7814819 file size 20392259 SRR7814819 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814819 SRR7814819_1.fastq SRR7814819_2.fastq Input file: SRR7814819_1.fastq Paired file: SRR7814819_2.fastq trimmed: SRR7814819-trimmed-pair1.fastq, SRR7814819-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:13:46 2024 >> started Fri Dec 6 11:14:51 2024 >> done (65.265s) 60241771 read pairs processed; of these: 346 ( 0.00%) short read pairs filtered out after trimming by size control 26182 ( 0.04%) empty read pairs filtered out after trimming by size control 60215243 (99.96%) read pairs available; of these: 6417763 (10.66%) trimmed read pairs available after processing 53797480 (89.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 22 0.00% 20 29 0.00% 21 37 0.00% 22 38 0.00% 23 40 0.00% 24 34 0.00% 25 57 0.00% 26 47 0.00% 27 63 0.00% 28 46 0.00% 29 76 0.00% 30 88 0.00% 31 89 0.00% 32 78 0.00% 33 71 0.00% 34 87 0.00% 35 98 0.00% 36 89 0.00% 37 86 0.00% 38 127 0.00% 39 126 0.00% 40 122 0.00% 41 134 0.00% 42 143 0.00% 43 125 0.00% 44 147 0.00% 45 167 0.00% 46 168 0.00% 47 213 0.00% 48 232 0.00% 49 247 0.00% 50 299 0.00% 51 302 0.00% 52 334 0.00% 53 340 0.00% 54 363 0.00% 55 463 0.00% 56 496 0.00% 57 516 0.00% 58 610 0.00% 59 745 0.00% 60 813 0.00% 61 973 0.00% 62 1051 0.00% 63 1115 0.00% 64 1243 0.00% 65 1308 0.00% 66 1439 0.00% 67 1560 0.00% 68 1943 0.00% 69 2217 0.00% 70 2510 0.00% 71 2962 0.00% 72 3365 0.01% 73 3587 0.01% 74 4157 0.01% 75 4483 0.01% 76 5173 0.01% 77 5642 0.01% 78 6312 0.01% 79 7164 0.01% 80 7886 0.01% 81 8993 0.01% 82 10306 0.02% 83 11386 0.02% 84 12762 0.02% 85 13901 0.02% 86 15043 0.02% 87 16532 0.03% 88 17510 0.03% 89 19353 0.03% 90 21284 0.04% 91 23727 0.04% 92 25527 0.04% 93 27774 0.05% 94 29995 0.05% 95 32322 0.05% 96 34657 0.06% 97 36936 0.06% 98 38394 0.06% 99 40772 0.07% 100 43816 0.07% 101 46444 0.08% 102 49659 0.08% 103 52285 0.09% 104 55346 0.09% 105 57491 0.10% 106 60657 0.10% 107 62521 0.10% 108 65494 0.11% 109 68480 0.11% 110 71061 0.12% 111 74075 0.12% 112 77170 0.13% 113 82077 0.14% 114 85038 0.14% 115 88737 0.15% 116 91305 0.15% 117 94188 0.16% 118 94707 0.16% 119 96274 0.16% 120 100268 0.17% 121 102673 0.17% 122 106209 0.18% 123 111022 0.18% 124 116144 0.19% 125 118367 0.20% 126 120809 0.20% 127 123378 0.20% 128 123696 0.21% 129 128661 0.21% 130 129964 0.22% 131 132222 0.22% 132 136312 0.23% 133 139818 0.23% 134 144026 0.24% 135 147731 0.25% 136 148423 0.25% 137 150181 0.25% 138 152393 0.25% 139 155875 0.26% 140 157026 0.26% 141 160001 0.27% 142 165365 0.27% 143 166345 0.28% 144 172316 0.29% 145 175675 0.29% 146 177522 0.29% 147 180402 0.30% 148 181023 0.30% 149 180873 0.30% 150 184522 0.31% 151 53797480 89.34% 60215243 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=17 prefix-density=0.80 prefix-fanout=3.3 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=31.65 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.8 sequence=CCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=4.07 fanout-score-rank=14 prefix-density=0.74 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=77.41 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=5.5 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7814819 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:16:29 Started mapping on | Dec 06 11:16:29 Finished on | Dec 06 11:28:44 Mapping speed, Million of reads per hour | 294.93 Number of input reads | 60215243 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 54200897 Uniquely mapped reads % | 90.01% Average mapped length | 295.50 Number of splices: Total | 51173657 Number of splices: Annotated (sjdb) | 48288480 Number of splices: GT/AG | 50481368 Number of splices: GC/AG | 556159 Number of splices: AT/AC | 16997 Number of splices: Non-canonical | 119133 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 3.02 Insertion rate per base | 0.03% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1183731 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 107320 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.67% % of reads unmapped: other | 1.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4830615 4830615 4830615 N_multimapping 1183731 1183731 1183731 N_noFeature 2079303 52452383 2747185 N_ambiguous 1377271 9567 297184 UnstrandedReadsAssigned:50744323 PositiveStrandReadsAssigned:1738947 NegativeStrandReadsAssigned:51156528 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814819 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814819-trimmed-pair1.fastq SRR7814819-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 60,215,243 reads, 52,237,430 reads pseudoaligned [quant] estimated average fragment length: 265.795 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR7814819.ke.tsv 35125 SRR7814819.se.tsv 88098 total ==> SRR7814819.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.678 0 0 PNS24247 1044 779.205 190.162 5.94021 PNS24249 1928 1663.21 497.078 7.27458 PNS24246 1044 779.205 190.162 5.94021 PNS24248 1044 779.205 190.162 5.94021 PNS24244 1471 1206.21 205.435 4.14556 PNS24243 293 96.3886 1 0.252525 KQK14069 1603 1338.21 27049.1 491.994 KQK14071 474 234.937 690.173 71.5051 ==> SRR7814819.se.tsv <== BRADI_1g14170v3 30446 BRADI_1g53295v3 6783 BRADI_1g59795v3 340 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 1272 BRADI_1g74790v3 2428 BRADI_1g09890v3 4 BRADI_1g77505v3 706 BRADI_1g48960v3 0 SRR7814819 completed mapping pipeline successfully