Starting /dee2/code/volunteer_pipeline.sh SRR7814820 current disk space = 1551418638336 free memory = 1602671836 SRR7814820 SRAfilesize d3da8c98e3f2170f745095489d92c7b1 SRR7814820.sra SRR7814820.sra file validated SRR7814820 is paired end SRR7814820 is conventional basespace SRR7814820 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814820_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41975 37.0 37.0 37.0 37.0 37.0 2 36.34 37.0 37.0 37.0 37.0 37.0 3 36.4945 37.0 37.0 37.0 37.0 37.0 4 36.549 37.0 37.0 37.0 37.0 37.0 5 36.5745 37.0 37.0 37.0 37.0 37.0 6 36.4755 37.0 37.0 37.0 37.0 37.0 7 36.451 37.0 37.0 37.0 37.0 37.0 8 36.5175 37.0 37.0 37.0 37.0 37.0 9 36.552 37.0 37.0 37.0 37.0 37.0 10-14 36.5464 37.0 37.0 37.0 37.0 37.0 15-19 36.5007 37.0 37.0 37.0 37.0 37.0 20-24 36.5372 37.0 37.0 37.0 37.0 37.0 25-29 36.4687 37.0 37.0 37.0 37.0 37.0 30-34 36.425399999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.403099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.382099999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.354200000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.332800000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.2526 37.0 37.0 37.0 37.0 37.0 60-64 36.289699999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3061 37.0 37.0 37.0 37.0 37.0 70-74 36.322700000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.2955 37.0 37.0 37.0 37.0 37.0 80-84 36.2307 37.0 37.0 37.0 37.0 37.0 85-89 36.252300000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.1654 37.0 37.0 37.0 37.0 37.0 95-99 36.142999999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.1924 37.0 37.0 37.0 37.0 37.0 105-109 36.1221 37.0 37.0 37.0 37.0 37.0 110-114 36.1057 37.0 37.0 37.0 37.0 37.0 115-119 36.1181 37.0 37.0 37.0 37.0 37.0 120-124 35.993399999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.969300000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.9349 37.0 37.0 37.0 37.0 37.0 135-139 35.88890000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.9126 37.0 37.0 37.0 37.0 37.0 145-149 35.8928 37.0 37.0 37.0 37.0 37.0 150-151 35.380250000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 2.0 25 2.0 26 5.0 27 6.0 28 20.0 29 19.0 30 25.0 31 43.0 32 45.0 33 84.0 34 124.0 35 331.0 36 2803.0 37 488.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.85069008782936 11.191969887076537 5.520702634880803 36.4366373902133 2 25.575 14.475 30.625000000000004 29.325000000000003 3 22.425 18.25 22.2 37.125 4 28.749999999999996 24.375 18.9 27.975 5 25.924999999999997 28.375 23.125 22.575 6 24.675 30.225 21.95 23.150000000000002 7 17.7 22.825 38.6 20.875 8 21.825 23.75 28.1 26.325 9 22.45 20.325 31.65 25.575 10-14 24.01 26.314999999999998 24.11 25.564999999999998 15-19 24.215 24.42 24.77 26.595000000000002 20-24 24.36 24.825 24.404999999999998 26.41 25-29 24.345 24.62 24.55 26.484999999999996 30-34 24.16 24.87 24.765 26.205000000000002 35-39 23.82 24.465 24.560000000000002 27.155 40-44 24.63 24.404999999999998 24.125 26.840000000000003 45-49 24.44 24.15 24.545 26.865 50-54 24.575 23.895 24.42 27.11 55-59 24.995 25.005 23.755000000000003 26.245 60-64 24.815 24.905 23.5 26.779999999999998 65-69 24.495 24.04 24.035 27.43 70-74 25.28 23.75 23.935000000000002 27.034999999999997 75-79 25.19 23.525 24.08 27.205000000000002 80-84 25.16 23.990000000000002 24.16 26.69 85-89 25.595000000000002 23.925 23.44 27.04 90-94 25.169999999999998 24.19 23.75 26.889999999999997 95-99 24.985 24.759999999999998 24.04 26.215 100-104 24.905 24.154999999999998 23.855 27.084999999999997 105-109 25.624999999999996 23.69 24.265 26.419999999999998 110-114 25.295 24.09 23.76 26.855 115-119 25.05 24.33 23.419999999999998 27.200000000000003 120-124 25.355 24.015 23.39 27.24 125-129 25.814999999999998 24.11 23.57 26.505000000000003 130-134 25.345000000000002 24.305 23.26 27.089999999999996 135-139 26.005 23.9 23.200000000000003 26.895000000000003 140-144 25.27 24.44 23.195 27.095000000000002 145-149 25.740000000000002 23.995 23.044999999999998 27.22 150-151 26.375 22.9625 23.125 27.537499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.0 29 3.5 30 8.5 31 9.0 32 8.0 33 15.5 34 27.0 35 34.5 36 47.0 37 56.5 38 62.0 39 77.5 40 94.5 41 119.5 42 154.0 43 164.5 44 155.0 45 168.5 46 184.0 47 164.0 48 145.0 49 152.0 50 147.5 51 143.5 52 135.0 53 122.0 54 103.5 55 91.0 56 108.0 57 104.0 58 88.0 59 86.5 60 87.0 61 85.5 62 86.0 63 72.5 64 76.5 65 76.0 66 63.0 67 62.0 68 60.5 69 62.5 70 52.5 71 47.0 72 45.5 73 34.5 74 25.5 75 22.5 76 16.5 77 13.5 78 10.5 79 5.5 80 4.0 81 1.5 82 0.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.125 #Duplication Level Percentage of deduplicated Percentage of total 1 91.19341563786008 83.1 2 8.010973936899862 14.6 3 0.6858710562414266 1.875 4 0.0823045267489712 0.3 5 0.027434842249657067 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCATAACATCTCGTAT 5 0.125 TruSeq Adapter, Index 6 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.9875 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.65 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 4.0125 0.0 0.0 0.0 0.0 124-125 4.3375 0.0 0.0 0.0 0.0 126-127 4.8 0.0 0.0 0.0 0.0 128-129 5.25 0.0 0.0 0.0 0.0 130-131 5.775 0.0 0.0 0.0 0.0 132-133 6.2625 0.0 0.0 0.0 0.0 134-135 6.725 0.0 0.0 0.0 0.0 136-137 7.300000000000001 0.0 0.0 0.0 0.0 138-139 7.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTGGT 10 0.006830828 145.0 7 CACGTTT 10 0.006830828 145.0 3 GTTTTGG 10 0.006830828 145.0 6 TTTGGTG 10 0.006830828 145.0 8 ATCACGT 10 0.006830828 145.0 1 CGTTTTG 10 0.006830828 145.0 5 >>END_MODULE SRR7814820 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814820_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.297 37.0 37.0 37.0 37.0 37.0 2 35.929 37.0 37.0 37.0 37.0 37.0 3 35.958 37.0 37.0 37.0 37.0 37.0 4 36.059 37.0 37.0 37.0 37.0 37.0 5 36.1285 37.0 37.0 37.0 37.0 37.0 6 36.116 37.0 37.0 37.0 37.0 37.0 7 35.9765 37.0 37.0 37.0 37.0 37.0 8 36.2365 37.0 37.0 37.0 37.0 37.0 9 36.1915 37.0 37.0 37.0 37.0 37.0 10-14 36.1473 37.0 37.0 37.0 37.0 37.0 15-19 36.0543 37.0 37.0 37.0 37.0 37.0 20-24 36.035199999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.004200000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.0196 37.0 37.0 37.0 37.0 37.0 35-39 35.9582 37.0 37.0 37.0 37.0 37.0 40-44 35.9362 37.0 37.0 37.0 37.0 37.0 45-49 35.8859 37.0 37.0 37.0 37.0 37.0 50-54 35.8267 37.0 37.0 37.0 37.0 37.0 55-59 35.733399999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.735 37.0 37.0 37.0 37.0 37.0 65-69 35.7568 37.0 37.0 37.0 37.0 37.0 70-74 35.799 37.0 37.0 37.0 37.0 37.0 75-79 35.7427 37.0 37.0 37.0 37.0 37.0 80-84 35.6324 37.0 37.0 37.0 37.0 37.0 85-89 35.58 37.0 37.0 37.0 37.0 37.0 90-94 35.599900000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.6428 37.0 37.0 37.0 37.0 37.0 100-104 35.5686 37.0 37.0 37.0 37.0 37.0 105-109 35.60260000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.4999 37.0 37.0 37.0 37.0 37.0 115-119 35.3589 37.0 37.0 37.0 37.0 37.0 120-124 35.30050000000001 37.0 37.0 37.0 32.2 37.0 125-129 35.292500000000004 37.0 37.0 37.0 29.8 37.0 130-134 35.2976 37.0 37.0 37.0 32.2 37.0 135-139 35.0643 37.0 37.0 37.0 27.4 37.0 140-144 34.9919 37.0 37.0 37.0 25.0 37.0 145-149 34.9013 37.0 37.0 37.0 25.0 37.0 150-151 34.154250000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 4.0 16 3.0 17 0.0 18 2.0 19 1.0 20 4.0 21 3.0 22 8.0 23 17.0 24 11.0 25 12.0 26 8.0 27 11.0 28 21.0 29 21.0 30 21.0 31 55.0 32 94.0 33 122.0 34 229.0 35 649.0 36 2503.0 37 196.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.0 18.45 8.924999999999999 32.625 2 29.299999999999997 22.650000000000002 27.200000000000003 20.849999999999998 3 23.674999999999997 23.65 26.974999999999998 25.7 4 27.500000000000004 28.599999999999998 19.375 24.525 5 28.349999999999998 30.599999999999998 19.55 21.5 6 24.224999999999998 34.425 18.65 22.7 7 24.375 18.275 31.8 25.55 8 23.9 21.525 24.025 30.55 9 25.0 21.175 25.124999999999996 28.7 10-14 26.619999999999997 24.565 21.955 26.86 15-19 26.490000000000002 24.335 23.115 26.06 20-24 26.595000000000002 24.495 22.575 26.334999999999997 25-29 26.83 24.305 22.470000000000002 26.395000000000003 30-34 26.36 24.89 22.470000000000002 26.279999999999998 35-39 26.91 23.849999999999998 22.97 26.27 40-44 27.450000000000003 23.84 22.63 26.08 45-49 27.224999999999998 24.12 22.689999999999998 25.965 50-54 26.705000000000002 23.674999999999997 23.305 26.314999999999998 55-59 27.794999999999998 23.54 22.720000000000002 25.945 60-64 27.685 23.669999999999998 22.99 25.655 65-69 26.935 23.765 23.23 26.07 70-74 28.305000000000003 23.73 22.335 25.629999999999995 75-79 27.255000000000003 23.799999999999997 22.775000000000002 26.169999999999998 80-84 27.38 24.27 22.465 25.885 85-89 27.115000000000002 23.755000000000003 23.035 26.095000000000002 90-94 27.284999999999997 24.11 23.13 25.474999999999998 95-99 26.88 24.099999999999998 23.27 25.75 100-104 27.400000000000002 23.7 22.765 26.135 105-109 27.944999999999997 23.765 23.515 24.775 110-114 27.73 24.265 22.54 25.465 115-119 27.815 23.794999999999998 23.285 25.105 120-124 27.74 24.8 22.33 25.130000000000003 125-129 28.13 24.19 22.62 25.06 130-134 28.895 24.675 22.34 24.09 135-139 28.88 24.645 22.23 24.245 140-144 28.785 24.87 21.9 24.445 145-149 28.910000000000004 24.75 22.34 24.0 150-151 29.525000000000002 24.2375 22.5875 23.65 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 0.5 27 1.5 28 3.0 29 5.0 30 5.5 31 4.0 32 12.0 33 16.5 34 24.0 35 30.5 36 36.0 37 56.5 38 56.5 39 63.0 40 84.5 41 93.0 42 119.0 43 129.5 44 141.5 45 153.0 46 135.0 47 141.5 48 145.0 49 148.0 50 146.0 51 125.5 52 122.5 53 114.5 54 99.5 55 102.0 56 108.5 57 112.5 58 109.5 59 116.0 60 118.0 61 89.0 62 80.5 63 94.5 64 103.0 65 97.5 66 83.5 67 83.5 68 75.5 69 71.5 70 69.5 71 50.0 72 38.5 73 36.5 74 33.0 75 23.5 76 19.0 77 16.0 78 11.5 79 10.5 80 7.0 81 2.5 82 1.5 83 1.5 84 0.5 85 0.5 86 1.5 87 1.0 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 1.0 97 1.5 98 1.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.44502330682754 83.375 2 7.732382780367425 14.099999999999998 3 0.6306553331505347 1.725 4 0.13709898546750754 0.5 5 0.027419797093501508 0.125 6 0.0 0.0 7 0.027419797093501508 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 3.025 0.0 0.0 0.0 0.0 120-121 3.3499999999999996 0.0 0.0 0.0 0.0 122-123 3.9875 0.0 0.0 0.0 0.0 124-125 4.3125 0.0 0.0 0.0 0.0 126-127 4.7875 0.0 0.0 0.0 0.0 128-129 5.199999999999999 0.0 0.0 0.0 0.0 130-131 5.699999999999999 0.0 0.0 0.0 0.0 132-133 6.1875 0.0 0.0 0.0 0.0 134-135 6.65 0.0 0.0 0.0 0.0 136-137 7.199999999999999 0.0 0.0 0.0 0.0 138-139 7.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Read 2848267 spots for SRR7814820.sra Written 2848267 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Read 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra Written 2848263 spots for SRR7814820.sra SRR ids: ['SRR7814820.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1w3a2ynt SRR7814820.sra spots: 56965264 blocks: [[1, 2848263], [2848264, 5696526], [5696527, 8544789], [8544790, 11393052], [11393053, 14241315], [14241316, 17089578], [17089579, 19937841], [19937842, 22786104], [22786105, 25634367], [25634368, 28482630], [28482631, 31330893], [31330894, 34179156], [34179157, 37027419], [37027420, 39875682], [39875683, 42723945], [42723946, 45572208], [45572209, 48420471], [48420472, 51268734], [51268735, 54116997], [54116998, 56965264]] SRR7814820 file size 19281958 SRR7814820 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814820 SRR7814820_1.fastq SRR7814820_2.fastq Input file: SRR7814820_1.fastq Paired file: SRR7814820_2.fastq trimmed: SRR7814820-trimmed-pair1.fastq, SRR7814820-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:15:35 2024 >> started Fri Dec 6 11:16:57 2024 >> done (82.218s) 56965264 read pairs processed; of these: 268 ( 0.00%) short read pairs filtered out after trimming by size control 46172 ( 0.08%) empty read pairs filtered out after trimming by size control 56918824 (99.92%) read pairs available; of these: 5875596 (10.32%) trimmed read pairs available after processing 51043228 (89.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 16 0.00% 20 23 0.00% 21 20 0.00% 22 28 0.00% 23 22 0.00% 24 25 0.00% 25 31 0.00% 26 37 0.00% 27 48 0.00% 28 47 0.00% 29 40 0.00% 30 46 0.00% 31 68 0.00% 32 64 0.00% 33 45 0.00% 34 65 0.00% 35 81 0.00% 36 59 0.00% 37 70 0.00% 38 88 0.00% 39 94 0.00% 40 96 0.00% 41 111 0.00% 42 126 0.00% 43 134 0.00% 44 132 0.00% 45 128 0.00% 46 143 0.00% 47 155 0.00% 48 189 0.00% 49 222 0.00% 50 261 0.00% 51 260 0.00% 52 312 0.00% 53 329 0.00% 54 347 0.00% 55 377 0.00% 56 413 0.00% 57 523 0.00% 58 520 0.00% 59 647 0.00% 60 758 0.00% 61 841 0.00% 62 970 0.00% 63 985 0.00% 64 1141 0.00% 65 1144 0.00% 66 1282 0.00% 67 1565 0.00% 68 1656 0.00% 69 1906 0.00% 70 2319 0.00% 71 2560 0.00% 72 2950 0.01% 73 3376 0.01% 74 3658 0.01% 75 4106 0.01% 76 4405 0.01% 77 4889 0.01% 78 5634 0.01% 79 6439 0.01% 80 7117 0.01% 81 8055 0.01% 82 9027 0.02% 83 10122 0.02% 84 11192 0.02% 85 12605 0.02% 86 13599 0.02% 87 14723 0.03% 88 16232 0.03% 89 17383 0.03% 90 19368 0.03% 91 21480 0.04% 92 23283 0.04% 93 25322 0.04% 94 27485 0.05% 95 30121 0.05% 96 31755 0.06% 97 34389 0.06% 98 35873 0.06% 99 38097 0.07% 100 40700 0.07% 101 42700 0.08% 102 45651 0.08% 103 48978 0.09% 104 51802 0.09% 105 53691 0.09% 106 57169 0.10% 107 59074 0.10% 108 61857 0.11% 109 64134 0.11% 110 66734 0.12% 111 69526 0.12% 112 73482 0.13% 113 75329 0.13% 114 78822 0.14% 115 81651 0.14% 116 84448 0.15% 117 87294 0.15% 118 88618 0.16% 119 90725 0.16% 120 93336 0.16% 121 95901 0.17% 122 98080 0.17% 123 101865 0.18% 124 104559 0.18% 125 107733 0.19% 126 110706 0.19% 127 113661 0.20% 128 115111 0.20% 129 117958 0.21% 130 119847 0.21% 131 121041 0.21% 132 125461 0.22% 133 127947 0.22% 134 130073 0.23% 135 133071 0.23% 136 135985 0.24% 137 137883 0.24% 138 137824 0.24% 139 142145 0.25% 140 142894 0.25% 141 145324 0.26% 142 149090 0.26% 143 151668 0.27% 144 154776 0.27% 145 158184 0.28% 146 158554 0.28% 147 161854 0.28% 148 163645 0.29% 149 163677 0.29% 150 167095 0.29% 151 51043228 89.68% 56918824 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=15 prefix-density=0.82 prefix-fanout=3.2 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=32.31 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=4.6 sequence=CCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.95 fanout-score-rank=12 prefix-density=0.80 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=18.18 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.1 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7814820 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:17:51 Started mapping on | Dec 06 11:17:51 Finished on | Dec 06 11:24:09 Mapping speed, Million of reads per hour | 542.08 Number of input reads | 56918824 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 53324729 Uniquely mapped reads % | 93.69% Average mapped length | 295.80 Number of splices: Total | 50881536 Number of splices: Annotated (sjdb) | 48070303 Number of splices: GT/AG | 50191021 Number of splices: GC/AG | 559072 Number of splices: AT/AC | 17043 Number of splices: Non-canonical | 114400 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.02 Insertion rate per base | 0.03% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1117013 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 113885 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.90% % of reads unmapped: other | 1.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2477082 2477082 2477082 N_multimapping 1117013 1117013 1117013 N_noFeature 2045336 51648478 2607195 N_ambiguous 1377170 6650 263459 UnstrandedReadsAssigned:49902223 PositiveStrandReadsAssigned:1669601 NegativeStrandReadsAssigned:50454075 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814820 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814820-trimmed-pair1.fastq SRR7814820-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 56,918,824 reads, 51,000,344 reads pseudoaligned [quant] estimated average fragment length: 267.071 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,246 rounds 52973 SRR7814820.ke.tsv 35125 SRR7814820.se.tsv 88098 total ==> SRR7814820.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.35 0 0 PNS24247 1044 777.929 206.799 6.66818 PNS24249 1928 1661.93 360.109 5.43525 PNS24246 1044 777.929 206.799 6.66818 PNS24248 1044 777.929 206.799 6.66818 PNS24244 1471 1204.93 357.494 7.44228 PNS24243 293 95.4337 2 0.525687 KQK14069 1603 1336.93 26492.8 497.072 KQK14071 474 232.801 582.074 62.718 ==> SRR7814820.se.tsv <== BRADI_1g14170v3 30360 BRADI_1g53295v3 8452 BRADI_1g59795v3 329 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 2183 BRADI_1g74790v3 2108 BRADI_1g09890v3 15 BRADI_1g77505v3 681 BRADI_1g48960v3 1 SRR7814820 completed mapping pipeline successfully