Starting /dee2/code/volunteer_pipeline.sh SRR7814821 current disk space = 1551464861696 free memory = 1599961396 SRR7814821 SRAfilesize 43eba3c541241353af93d7105a5e1137 SRR7814821.sra SRR7814821.sra file validated SRR7814821 is paired end SRR7814821 is conventional basespace SRR7814821 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814821_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4235 37.0 37.0 37.0 37.0 37.0 2 36.5015 37.0 37.0 37.0 37.0 37.0 3 36.5355 37.0 37.0 37.0 37.0 37.0 4 36.5555 37.0 37.0 37.0 37.0 37.0 5 36.6125 37.0 37.0 37.0 37.0 37.0 6 36.606 37.0 37.0 37.0 37.0 37.0 7 36.5685 37.0 37.0 37.0 37.0 37.0 8 36.6105 37.0 37.0 37.0 37.0 37.0 9 36.59 37.0 37.0 37.0 37.0 37.0 10-14 36.567099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5649 37.0 37.0 37.0 37.0 37.0 20-24 36.49720000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.446299999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.3003 37.0 37.0 37.0 37.0 37.0 35-39 36.2165 37.0 37.0 37.0 37.0 37.0 40-44 36.1678 37.0 37.0 37.0 37.0 37.0 45-49 36.3107 37.0 37.0 37.0 37.0 37.0 50-54 36.2957 37.0 37.0 37.0 37.0 37.0 55-59 36.2881 37.0 37.0 37.0 37.0 37.0 60-64 36.257799999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.1912 37.0 37.0 37.0 37.0 37.0 70-74 36.036500000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.0282 37.0 37.0 37.0 37.0 37.0 80-84 36.003 37.0 37.0 37.0 37.0 37.0 85-89 36.1344 37.0 37.0 37.0 37.0 37.0 90-94 35.9987 37.0 37.0 37.0 37.0 37.0 95-99 35.7188 37.0 37.0 37.0 37.0 37.0 100-104 35.3861 37.0 37.0 37.0 32.2 37.0 105-109 35.5486 37.0 37.0 37.0 37.0 37.0 110-114 35.659 37.0 37.0 37.0 37.0 37.0 115-119 35.4603 37.0 37.0 37.0 37.0 37.0 120-124 34.8512 37.0 37.0 37.0 25.0 37.0 125-129 34.622699999999995 37.0 37.0 37.0 25.0 37.0 130-134 35.0601 37.0 37.0 37.0 25.0 37.0 135-139 34.9692 37.0 37.0 37.0 25.0 37.0 140-144 34.98309999999999 37.0 37.0 37.0 25.0 37.0 145-149 34.8831 37.0 37.0 37.0 25.0 37.0 150-151 34.03775 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 5.0 26 8.0 27 9.0 28 20.0 29 26.0 30 35.0 31 52.0 32 80.0 33 154.0 34 252.0 35 626.0 36 2577.0 37 155.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.6966966966967 10.96096096096096 5.33033033033033 37.012012012012015 2 24.575 13.55 32.5 29.375 3 23.075000000000003 17.375 23.5 36.05 4 28.175 22.05 21.125 28.65 5 26.375 30.425 21.85 21.349999999999998 6 23.95 30.65 23.3 22.1 7 18.625 22.900000000000002 37.974999999999994 20.5 8 19.85 22.8 29.625 27.725 9 20.474999999999998 20.5 32.675 26.35 10-14 24.245 25.135 24.63 25.990000000000002 15-19 24.285 24.64 25.380000000000003 25.695 20-24 24.085 24.75 24.775 26.39 25-29 24.654999999999998 24.68 24.3 26.365 30-34 24.72 24.135 24.709999999999997 26.435 35-39 23.755000000000003 25.435000000000002 24.87 25.94 40-44 23.84 24.9 24.845 26.415 45-49 24.224999999999998 24.085 25.035 26.655 50-54 24.38 24.795 23.98 26.845000000000002 55-59 24.595 24.490000000000002 24.169999999999998 26.745 60-64 24.465 24.135 24.235 27.165 65-69 24.645 24.075 24.54 26.740000000000002 70-74 24.654999999999998 24.345 24.185000000000002 26.815 75-79 24.6 23.91 24.47 27.02 80-84 25.019999999999996 24.45 24.425 26.105 85-89 25.669999999999998 23.53 24.240000000000002 26.56 90-94 25.424999999999997 24.21 23.799999999999997 26.565 95-99 25.035 24.2 23.96 26.805 100-104 25.64 24.93 23.169999999999998 26.26 105-109 25.09 24.315 23.805 26.790000000000003 110-114 25.285000000000004 24.23 24.385 26.1 115-119 26.064999999999998 24.34 23.64 25.955000000000002 120-124 25.4 23.71 24.14 26.75 125-129 25.259999999999998 24.735 23.595 26.41 130-134 25.040000000000003 24.52 23.89 26.55 135-139 25.355 24.235 23.52 26.889999999999997 140-144 25.3 23.77 23.880000000000003 27.05 145-149 25.485000000000003 24.59 23.419999999999998 26.505000000000003 150-151 24.525 23.2625 25.087500000000002 27.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 1.0 28 0.5 29 3.5 30 6.0 31 9.0 32 13.5 33 17.5 34 26.0 35 35.5 36 43.0 37 58.0 38 66.5 39 77.0 40 104.5 41 135.5 42 152.0 43 155.5 44 171.0 45 188.5 46 182.5 47 177.5 48 172.5 49 157.5 50 139.5 51 144.0 52 141.5 53 105.5 54 95.5 55 94.0 56 85.5 57 88.0 58 85.5 59 83.5 60 92.0 61 90.0 62 66.5 63 56.0 64 64.5 65 72.5 66 74.0 67 69.0 68 64.5 69 54.5 70 50.5 71 46.0 72 38.0 73 34.0 74 29.0 75 24.0 76 18.0 77 13.0 78 13.0 79 8.5 80 2.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.9 #Duplication Level Percentage of deduplicated Percentage of total 1 90.67656765676567 82.425 2 8.690869086908691 15.8 3 0.5775577557755776 1.575 4 0.055005500550055 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 0.9625 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.4 0.0 0.0 0.0 0.0 108-109 2.6624999999999996 0.0 0.0 0.0 0.0 110-111 2.9124999999999996 0.0 0.0 0.0 0.0 112-113 3.1375 0.0 0.0 0.0 0.0 114-115 3.3499999999999996 0.0 0.0 0.0 0.0 116-117 3.7125000000000004 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.2375 0.0 0.0 0.0 0.0 122-123 4.5875 0.0 0.0 0.0 0.0 124-125 5.012499999999999 0.0 0.0 0.0 0.0 126-127 5.375 0.0 0.0 0.0 0.0 128-129 5.8 0.0 0.0 0.0 0.0 130-131 6.45 0.0 0.0 0.0 0.0 132-133 6.9 0.0 0.0 0.0 0.0 134-135 7.237500000000001 0.0 0.0 0.0 0.0 136-137 7.8125 0.0 0.0 0.0 0.0 138-139 8.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTACT 10 0.006830828 145.0 1 ACTCCTT 10 0.006830828 145.0 5 CTCTATG 10 0.006830828 145.0 4 >>END_MODULE SRR7814821 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814821_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.942 37.0 37.0 37.0 37.0 37.0 2 35.688 37.0 37.0 37.0 37.0 37.0 3 35.579 37.0 37.0 37.0 37.0 37.0 4 35.793 37.0 37.0 37.0 37.0 37.0 5 35.6555 37.0 37.0 37.0 37.0 37.0 6 35.664 37.0 37.0 37.0 37.0 37.0 7 35.454 37.0 37.0 37.0 37.0 37.0 8 35.4735 37.0 37.0 37.0 37.0 37.0 9 35.793 37.0 37.0 37.0 37.0 37.0 10-14 35.701299999999996 37.0 37.0 37.0 37.0 37.0 15-19 35.271300000000004 37.0 37.0 37.0 32.2 37.0 20-24 35.493900000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.3912 37.0 37.0 37.0 34.6 37.0 30-34 35.074799999999996 37.0 37.0 37.0 29.8 37.0 35-39 35.1035 37.0 37.0 37.0 29.8 37.0 40-44 34.8432 37.0 37.0 37.0 25.0 37.0 45-49 34.9597 37.0 37.0 37.0 25.0 37.0 50-54 34.2265 37.0 37.0 37.0 25.0 37.0 55-59 34.104 37.0 37.0 37.0 25.0 37.0 60-64 34.4156 37.0 37.0 37.0 25.0 37.0 65-69 34.352799999999995 37.0 37.0 37.0 25.0 37.0 70-74 34.0519 37.0 37.0 37.0 25.0 37.0 75-79 33.7852 37.0 37.0 37.0 22.2 37.0 80-84 33.644800000000004 37.0 37.0 37.0 22.2 37.0 85-89 34.1082 37.0 37.0 37.0 25.0 37.0 90-94 33.581999999999994 37.0 37.0 37.0 25.0 37.0 95-99 32.7664 37.0 37.0 37.0 11.0 37.0 100-104 33.039699999999996 37.0 37.0 37.0 16.6 37.0 105-109 32.7233 37.0 37.0 37.0 11.0 37.0 110-114 33.0296 37.0 37.0 37.0 16.6 37.0 115-119 33.0755 37.0 37.0 37.0 16.6 37.0 120-124 32.3744 37.0 34.6 37.0 11.0 37.0 125-129 32.573299999999996 37.0 37.0 37.0 11.0 37.0 130-134 32.0207 37.0 29.8 37.0 11.0 37.0 135-139 32.083000000000006 37.0 32.2 37.0 11.0 37.0 140-144 32.185300000000005 37.0 32.2 37.0 11.0 37.0 145-149 31.8382 37.0 27.4 37.0 11.0 37.0 150-151 31.264250000000004 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 3.0 16 6.0 17 3.0 18 2.0 19 4.0 20 2.0 21 15.0 22 25.0 23 46.0 24 52.0 25 84.0 26 82.0 27 100.0 28 83.0 29 98.0 30 129.0 31 161.0 32 178.0 33 203.0 34 338.0 35 827.0 36 1527.0 37 30.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.300000000000004 19.525000000000002 7.375 32.800000000000004 2 29.075 23.425 28.175 19.325 3 24.075 24.25 27.224999999999998 24.45 4 28.349999999999998 29.425 18.7 23.525 5 27.875 32.625 18.575 20.925 6 22.900000000000002 35.275 18.825 23.0 7 22.45 18.95 33.525 25.074999999999996 8 22.5 23.025000000000002 24.05 30.425 9 24.55 21.925 26.625 26.900000000000002 10-14 26.8 24.87 21.77 26.56 15-19 26.115 25.3 22.34 26.245 20-24 25.885 25.424999999999997 22.545 26.145000000000003 25-29 26.669999999999998 24.959999999999997 22.845 25.525 30-34 25.924999999999997 24.65 22.88 26.545 35-39 26.215 24.445 23.75 25.590000000000003 40-44 26.625 24.595 22.545 26.235000000000003 45-49 26.69 24.325 23.22 25.765 50-54 26.3 24.75 23.49 25.46 55-59 26.105 24.64 23.365 25.89 60-64 26.43 24.64 22.79 26.14 65-69 26.950000000000003 24.085 23.215 25.75 70-74 26.345000000000002 25.11 22.715 25.83 75-79 26.105 24.975 23.48 25.44 80-84 26.19 24.8 23.580000000000002 25.430000000000003 85-89 27.08 24.695 22.759999999999998 25.465 90-94 26.950000000000003 24.985 23.580000000000002 24.485 95-99 26.1 26.490000000000002 22.775000000000002 24.635 100-104 26.655 26.055 22.425 24.865000000000002 105-109 26.534999999999997 26.045 23.09 24.33 110-114 26.71 25.540000000000003 22.515 25.235000000000003 115-119 27.005000000000003 25.419999999999998 22.745 24.83 120-124 26.729999999999997 27.185 22.325 23.76 125-129 27.025 26.590000000000003 22.55 23.835 130-134 26.765 27.38 22.585 23.27 135-139 27.185 26.625 22.855 23.335 140-144 27.994999999999997 26.200000000000003 22.64 23.165 145-149 27.334999999999997 27.13 22.97 22.564999999999998 150-151 27.3125 26.424999999999997 23.3 22.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.0 13 1.0 14 1.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 2.5 21 2.0 22 0.5 23 0.5 24 1.5 25 1.5 26 2.5 27 4.5 28 5.5 29 7.0 30 12.0 31 18.5 32 20.0 33 19.0 34 18.5 35 27.5 36 42.5 37 52.5 38 60.0 39 79.5 40 104.5 41 120.0 42 127.0 43 130.0 44 144.0 45 162.5 46 173.0 47 164.0 48 153.5 49 138.5 50 122.0 51 121.5 52 116.5 53 111.5 54 107.5 55 102.0 56 97.5 57 92.0 58 92.0 59 90.0 60 86.0 61 96.0 62 99.5 63 84.5 64 76.0 65 87.5 66 89.0 67 70.5 68 60.5 69 78.5 70 68.5 71 44.0 72 43.0 73 38.0 74 30.5 75 23.0 76 18.0 77 15.5 78 14.5 79 5.5 80 1.0 81 2.5 82 3.0 83 1.5 84 1.0 85 2.0 86 1.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.89115646258503 84.425 2 7.401360544217687 13.600000000000001 3 0.6802721088435374 1.875 4 0.027210884353741496 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.5125 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.85 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.5625 0.0 0.0 0.0 0.0 112-113 2.75 0.0 0.0 0.0 0.0 114-115 2.9375 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.55 0.0 0.0 0.0 0.0 120-121 3.7125 0.0 0.0 0.0 0.0 122-123 4.0125 0.0 0.0 0.0 0.0 124-125 4.425 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 5.1 0.0 0.0 0.0 0.0 130-131 5.6875 0.0 0.0 0.0 0.0 132-133 6.1125 0.0 0.0 0.0 0.0 134-135 6.4375 0.0 0.0 0.0 0.0 136-137 6.875 0.0 0.0 0.0 0.0 138-139 7.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129309 spots for SRR7814821.sra Written 1129309 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra Read 1129296 spots for SRR7814821.sra Written 1129296 spots for SRR7814821.sra SRR ids: ['SRR7814821.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e_ef6wls SRR7814821.sra spots: 22585933 blocks: [[1, 1129296], [1129297, 2258592], [2258593, 3387888], [3387889, 4517184], [4517185, 5646480], [5646481, 6775776], [6775777, 7905072], [7905073, 9034368], [9034369, 10163664], [10163665, 11292960], [11292961, 12422256], [12422257, 13551552], [13551553, 14680848], [14680849, 15810144], [15810145, 16939440], [16939441, 18068736], [18068737, 19198032], [19198033, 20327328], [20327329, 21456624], [21456625, 22585933]] SRR7814821 file size 7631931 SRR7814821 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814821 SRR7814821_1.fastq SRR7814821_2.fastq Input file: SRR7814821_1.fastq Paired file: SRR7814821_2.fastq trimmed: SRR7814821-trimmed-pair1.fastq, SRR7814821-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:13:08 2024 >> started Fri Dec 6 11:13:59 2024 >> done (51.715s) 22585933 read pairs processed; of these: 139 ( 0.00%) short read pairs filtered out after trimming by size control 4722 ( 0.02%) empty read pairs filtered out after trimming by size control 22581072 (99.98%) read pairs available; of these: 2441787 (10.81%) trimmed read pairs available after processing 20139285 (89.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 16 0.00% 20 10 0.00% 21 14 0.00% 22 16 0.00% 23 24 0.00% 24 12 0.00% 25 27 0.00% 26 30 0.00% 27 20 0.00% 28 19 0.00% 29 40 0.00% 30 43 0.00% 31 38 0.00% 32 48 0.00% 33 41 0.00% 34 37 0.00% 35 45 0.00% 36 53 0.00% 37 61 0.00% 38 70 0.00% 39 56 0.00% 40 66 0.00% 41 61 0.00% 42 72 0.00% 43 74 0.00% 44 80 0.00% 45 90 0.00% 46 97 0.00% 47 109 0.00% 48 105 0.00% 49 135 0.00% 50 165 0.00% 51 135 0.00% 52 210 0.00% 53 187 0.00% 54 213 0.00% 55 228 0.00% 56 238 0.00% 57 267 0.00% 58 342 0.00% 59 384 0.00% 60 473 0.00% 61 496 0.00% 62 586 0.00% 63 635 0.00% 64 693 0.00% 65 720 0.00% 66 856 0.00% 67 965 0.00% 68 1100 0.00% 69 1226 0.01% 70 1513 0.01% 71 1563 0.01% 72 1948 0.01% 73 2169 0.01% 74 2411 0.01% 75 2718 0.01% 76 2927 0.01% 77 3296 0.01% 78 3679 0.02% 79 4133 0.02% 80 4453 0.02% 81 5110 0.02% 82 5732 0.03% 83 6210 0.03% 84 6978 0.03% 85 7590 0.03% 86 8090 0.04% 87 8569 0.04% 88 9602 0.04% 89 10327 0.05% 90 10912 0.05% 91 11960 0.05% 92 12785 0.06% 93 13566 0.06% 94 14805 0.07% 95 15718 0.07% 96 16342 0.07% 97 17351 0.08% 98 18029 0.08% 99 18949 0.08% 100 19990 0.09% 101 20983 0.09% 102 21623 0.10% 103 23168 0.10% 104 23856 0.11% 105 24761 0.11% 106 25636 0.11% 107 26697 0.12% 108 27629 0.12% 109 29070 0.13% 110 29728 0.13% 111 30439 0.13% 112 31190 0.14% 113 32531 0.14% 114 33048 0.15% 115 34916 0.15% 116 35458 0.16% 117 36320 0.16% 118 36818 0.16% 119 37525 0.17% 120 38007 0.17% 121 39550 0.18% 122 40923 0.18% 123 41374 0.18% 124 42194 0.19% 125 43209 0.19% 126 44260 0.20% 127 44837 0.20% 128 45904 0.20% 129 46700 0.21% 130 47169 0.21% 131 48423 0.21% 132 49355 0.22% 133 50340 0.22% 134 51657 0.23% 135 51645 0.23% 136 52680 0.23% 137 53224 0.24% 138 53465 0.24% 139 55167 0.24% 140 55279 0.24% 141 56427 0.25% 142 57539 0.25% 143 58328 0.26% 144 59477 0.26% 145 60833 0.27% 146 60614 0.27% 147 61505 0.27% 148 62838 0.28% 149 62892 0.28% 150 63418 0.28% 151 20139285 89.19% 22581072 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=11 prefix-density=0.72 prefix-fanout=3.3 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=58.80 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.2 sequence=TGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=14 prefix-density=0.58 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.19 sequence-density-rank=15 fanout-score=42.64 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=13.0 sequence=CAAGAAGAAGGT SRR7814821 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:15:32 Started mapping on | Dec 06 11:15:34 Finished on | Dec 06 11:19:21 Mapping speed, Million of reads per hour | 358.11 Number of input reads | 22581072 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20828563 Uniquely mapped reads % | 92.24% Average mapped length | 294.52 Number of splices: Total | 20346934 Number of splices: Annotated (sjdb) | 19192693 Number of splices: GT/AG | 20057629 Number of splices: GC/AG | 236172 Number of splices: AT/AC | 7377 Number of splices: Non-canonical | 45756 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.03% Deletion average length | 3.05 Insertion rate per base | 0.02% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 427487 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 32543 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.77% % of reads unmapped: other | 0.96% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1325022 1325022 1325022 N_multimapping 427487 427487 427487 N_noFeature 815943 20232691 1002356 N_ambiguous 498137 2863 89338 UnstrandedReadsAssigned:19514483 PositiveStrandReadsAssigned:593009 NegativeStrandReadsAssigned:19736869 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814821 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814821-trimmed-pair1.fastq SRR7814821-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,581,072 reads, 20,115,830 reads pseudoaligned [quant] estimated average fragment length: 268.072 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52973 SRR7814821.ke.tsv 35125 SRR7814821.se.tsv 88098 total ==> SRR7814821.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.563 0 0 PNS24247 1044 776.928 44.9593 3.89873 PNS24249 1928 1660.93 154.515 6.26764 PNS24246 1044 776.928 44.9593 3.89873 PNS24248 1044 776.928 44.9593 3.89873 PNS24244 1471 1203.93 65.6072 3.67143 PNS24243 293 95.6124 0 0 KQK14069 1603 1335.93 13740.5 692.952 KQK14071 474 231.83 329.188 95.6663 ==> SRR7814821.se.tsv <== BRADI_1g14170v3 15575 BRADI_1g53295v3 2431 BRADI_1g59795v3 160 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 1559 BRADI_1g74790v3 567 BRADI_1g09890v3 19 BRADI_1g77505v3 274 BRADI_1g48960v3 1 SRR7814821 completed mapping pipeline successfully