Starting /dee2/code/volunteer_pipeline.sh SRR7814822 current disk space = 1551557951488 free memory = 1596319892 SRR7814822 SRAfilesize 5324c79758b7e86ebd9ebaa18ffda2d8 SRR7814822.sra SRR7814822.sra file validated SRR7814822 is paired end SRR7814822 is conventional basespace SRR7814822 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814822_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.284 37.0 37.0 37.0 37.0 37.0 2 36.19925 37.0 37.0 37.0 37.0 37.0 3 36.2585 37.0 37.0 37.0 37.0 37.0 4 36.454 37.0 37.0 37.0 37.0 37.0 5 36.4475 37.0 37.0 37.0 37.0 37.0 6 36.4455 37.0 37.0 37.0 37.0 37.0 7 36.421 37.0 37.0 37.0 37.0 37.0 8 36.4285 37.0 37.0 37.0 37.0 37.0 9 36.3615 37.0 37.0 37.0 37.0 37.0 10-14 36.50390000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.4439 37.0 37.0 37.0 37.0 37.0 20-24 36.4286 37.0 37.0 37.0 37.0 37.0 25-29 36.3542 37.0 37.0 37.0 37.0 37.0 30-34 36.335699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.2952 37.0 37.0 37.0 37.0 37.0 40-44 36.3202 37.0 37.0 37.0 37.0 37.0 45-49 36.222699999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.2513 37.0 37.0 37.0 37.0 37.0 55-59 36.161500000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.1431 37.0 37.0 37.0 37.0 37.0 65-69 36.16439999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.0053 37.0 37.0 37.0 37.0 37.0 75-79 36.011199999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.9664 37.0 37.0 37.0 37.0 37.0 85-89 35.9125 37.0 37.0 37.0 37.0 37.0 90-94 35.9154 37.0 37.0 37.0 37.0 37.0 95-99 35.8246 37.0 37.0 37.0 37.0 37.0 100-104 35.7798 37.0 37.0 37.0 37.0 37.0 105-109 35.851 37.0 37.0 37.0 37.0 37.0 110-114 35.7577 37.0 37.0 37.0 37.0 37.0 115-119 35.6352 37.0 37.0 37.0 37.0 37.0 120-124 35.5478 37.0 37.0 37.0 37.0 37.0 125-129 35.531099999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.3943 37.0 37.0 37.0 34.6 37.0 135-139 35.2715 37.0 37.0 37.0 32.2 37.0 140-144 35.211 37.0 37.0 37.0 29.8 37.0 145-149 34.964 37.0 37.0 37.0 27.4 37.0 150-151 34.344750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 4.0 24 3.0 25 9.0 26 3.0 27 15.0 28 18.0 29 31.0 30 45.0 31 74.0 32 78.0 33 119.0 34 183.0 35 382.0 36 2769.0 37 267.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 49.64912280701754 10.300751879699249 4.511278195488721 35.53884711779449 2 25.756439109777446 13.303325831457865 31.182795698924732 29.75743935983996 3 21.4 17.75 22.925 37.925 4 29.325000000000003 24.474999999999998 19.875 26.325 5 28.549999999999997 27.075 23.200000000000003 21.175 6 23.075000000000003 30.85 22.400000000000002 23.674999999999997 7 19.1 22.125 39.725 19.05 8 21.8 20.9 30.049999999999997 27.250000000000004 9 21.55 20.625 31.4 26.424999999999997 10-14 25.040000000000003 24.41 24.22 26.33 15-19 24.665 24.785 24.6 25.95 20-24 24.635 24.115000000000002 24.595 26.655 25-29 24.69 23.995 24.555 26.76 30-34 25.095 24.205 24.725 25.974999999999998 35-39 24.925 24.185000000000002 24.175 26.715 40-44 25.679999999999996 23.695 24.355 26.27 45-49 25.135 23.785 24.279999999999998 26.8 50-54 25.27 23.369999999999997 24.255 27.105 55-59 25.185000000000002 23.525 24.205 27.084999999999997 60-64 25.314999999999998 23.145 24.285 27.255000000000003 65-69 25.52 23.48 23.765 27.235 70-74 24.84 23.9 24.21 27.05 75-79 25.369999999999997 23.419999999999998 24.145 27.065 80-84 25.405 23.54 24.46 26.595000000000002 85-89 25.979999999999997 23.73 23.97 26.32 90-94 26.185000000000002 24.015 23.205000000000002 26.595000000000002 95-99 26.205000000000002 23.31 23.76 26.724999999999998 100-104 25.91 24.18 23.56 26.35 105-109 26.39 23.544999999999998 23.745 26.32 110-114 25.97 24.115000000000002 23.015 26.900000000000002 115-119 26.045 23.855 23.605 26.495 120-124 25.7 23.695 23.815 26.790000000000003 125-129 25.5 23.9 23.830000000000002 26.77 130-134 26.105 24.325 22.795 26.775 135-139 25.540000000000003 24.03 22.955000000000002 27.474999999999998 140-144 25.445 23.91 23.549999999999997 27.095000000000002 145-149 25.61 23.665 23.39 27.334999999999997 150-151 25.650000000000002 24.275 22.912499999999998 27.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 0.5 28 0.0 29 3.0 30 6.5 31 7.0 32 10.0 33 16.5 34 23.0 35 33.5 36 42.5 37 47.5 38 67.0 39 88.0 40 96.0 41 111.0 42 130.0 43 142.0 44 154.5 45 157.0 46 159.5 47 169.5 48 167.5 49 153.0 50 156.0 51 147.0 52 122.0 53 116.5 54 105.5 55 100.0 56 99.5 57 93.5 58 88.0 59 89.5 60 86.5 61 89.0 62 93.5 63 90.5 64 84.5 65 68.5 66 61.5 67 70.5 68 70.0 69 62.5 70 65.0 71 52.0 72 40.5 73 36.5 74 28.5 75 28.0 76 24.5 77 18.0 78 10.0 79 5.5 80 5.0 81 2.0 82 1.0 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.6 #Duplication Level Percentage of deduplicated Percentage of total 1 95.73744769874477 91.525 2 4.0010460251046025 7.6499999999999995 3 0.18305439330543932 0.525 4 0.07845188284518828 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0125 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0125 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.05 0.0 0.025 0.0 0.0 68-69 0.05 0.0 0.025 0.0 0.0 70-71 0.05 0.0 0.025 0.0 0.0 72-73 0.05 0.0 0.025 0.0 0.0 74-75 0.0625 0.0 0.025 0.0 0.0 76-77 0.1125 0.0 0.025 0.0 0.0 78-79 0.125 0.0 0.025 0.0 0.0 80-81 0.125 0.0 0.025 0.0 0.0 82-83 0.1375 0.0 0.025 0.0 0.0 84-85 0.1875 0.0 0.025 0.0 0.0 86-87 0.21250000000000002 0.0 0.025 0.0 0.0 88-89 0.25 0.0 0.025 0.0 0.0 90-91 0.36250000000000004 0.0 0.025 0.0 0.0 92-93 0.5375 0.0 0.025 0.0 0.0 94-95 0.7 0.0 0.025 0.0 0.0 96-97 0.7625 0.0 0.025 0.0 0.0 98-99 1.025 0.0 0.025 0.0 0.0 100-101 1.1124999999999998 0.0 0.025 0.0 0.0 102-103 1.35 0.0 0.025 0.0 0.0 104-105 1.475 0.0 0.025 0.0 0.0 106-107 1.7875 0.0 0.025 0.0 0.0 108-109 2.0250000000000004 0.0 0.025 0.0 0.0 110-111 2.2 0.0 0.025 0.0 0.0 112-113 2.4625 0.0 0.025 0.0 0.0 114-115 2.775 0.0 0.025 0.0 0.0 116-117 3.075 0.0 0.025 0.0 0.0 118-119 3.4625 0.0 0.025 0.0 0.0 120-121 3.7125 0.0 0.025 0.0 0.0 122-123 4.075 0.0 0.025 0.0 0.0 124-125 4.6375 0.0 0.025 0.0 0.0 126-127 5.325 0.0 0.025 0.0 0.0 128-129 5.775 0.0 0.025 0.0 0.0 130-131 6.199999999999999 0.0 0.025 0.0 0.0 132-133 6.725 0.0 0.025 0.0 0.0 134-135 7.225 0.0 0.025 0.0 0.0 136-137 7.6375 0.0 0.025 0.0 0.0 138-139 8.2375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATAC 10 0.006830828 145.0 1 GTTACTG 10 0.006830828 145.0 8 >>END_MODULE SRR7814822 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814822_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2385 37.0 37.0 37.0 37.0 37.0 2 36.008 37.0 37.0 37.0 37.0 37.0 3 36.141 37.0 37.0 37.0 37.0 37.0 4 36.16 37.0 37.0 37.0 37.0 37.0 5 36.2645 37.0 37.0 37.0 37.0 37.0 6 36.2545 37.0 37.0 37.0 37.0 37.0 7 36.138 37.0 37.0 37.0 37.0 37.0 8 36.2505 37.0 37.0 37.0 37.0 37.0 9 36.195 37.0 37.0 37.0 37.0 37.0 10-14 36.233799999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.1859 37.0 37.0 37.0 37.0 37.0 20-24 36.1489 37.0 37.0 37.0 37.0 37.0 25-29 36.129200000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.02460000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.0053 37.0 37.0 37.0 37.0 37.0 40-44 35.99229999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.025999999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.936 37.0 37.0 37.0 37.0 37.0 55-59 35.908100000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.8086 37.0 37.0 37.0 37.0 37.0 65-69 35.7795 37.0 37.0 37.0 37.0 37.0 70-74 35.6716 37.0 37.0 37.0 37.0 37.0 75-79 35.6803 37.0 37.0 37.0 37.0 37.0 80-84 35.628699999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.56529999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.525999999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.4144 37.0 37.0 37.0 37.0 37.0 100-104 35.4238 37.0 37.0 37.0 37.0 37.0 105-109 35.3806 37.0 37.0 37.0 34.6 37.0 110-114 35.2122 37.0 37.0 37.0 29.8 37.0 115-119 35.0823 37.0 37.0 37.0 25.0 37.0 120-124 35.0077 37.0 37.0 37.0 25.0 37.0 125-129 34.9391 37.0 37.0 37.0 25.0 37.0 130-134 34.80650000000001 37.0 37.0 37.0 25.0 37.0 135-139 34.6493 37.0 37.0 37.0 25.0 37.0 140-144 34.492200000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.397800000000004 37.0 37.0 37.0 25.0 37.0 150-151 33.6295 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 1.0 16 0.0 17 1.0 18 0.0 19 0.0 20 3.0 21 6.0 22 5.0 23 4.0 24 11.0 25 13.0 26 8.0 27 26.0 28 24.0 29 28.0 30 35.0 31 55.0 32 78.0 33 168.0 34 275.0 35 804.0 36 2335.0 37 117.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.0 18.175 7.35 31.474999999999998 2 30.15 21.3 26.974999999999998 21.575 3 24.175 22.725 28.1 25.0 4 27.525 29.025000000000002 19.650000000000002 23.799999999999997 5 29.4 32.074999999999996 17.325 21.2 6 23.849999999999998 34.599999999999994 18.825 22.725 7 23.674999999999997 19.15 31.95 25.224999999999998 8 23.775 22.675 23.075000000000003 30.475 9 23.400000000000002 22.025 26.85 27.725 10-14 27.310000000000002 24.63 21.63 26.43 15-19 27.32 24.245 22.814999999999998 25.619999999999997 20-24 26.985 24.585 22.695 25.735000000000003 25-29 27.229999999999997 24.18 22.46 26.13 30-34 26.755000000000003 24.325 22.535 26.384999999999998 35-39 27.075 24.455 22.220000000000002 26.25 40-44 26.99 24.104999999999997 22.455 26.450000000000003 45-49 27.205000000000002 23.799999999999997 22.465 26.529999999999998 50-54 26.25 23.565 23.76 26.424999999999997 55-59 27.384999999999998 23.625 22.305 26.685 60-64 27.544999999999998 23.26 22.79 26.405 65-69 26.174999999999997 24.099999999999998 22.79 26.935 70-74 27.195000000000004 23.735 22.43 26.640000000000004 75-79 26.740000000000002 23.474999999999998 23.04 26.745 80-84 27.245 23.915 22.91 25.929999999999996 85-89 27.395000000000003 23.36 23.02 26.224999999999998 90-94 27.560000000000002 23.47 22.63 26.340000000000003 95-99 27.73 23.990000000000002 22.509999999999998 25.77 100-104 27.939999999999998 23.98 22.36 25.72 105-109 27.74 23.985 22.165000000000003 26.11 110-114 27.735 24.715 22.28 25.27 115-119 27.98 24.37 22.16 25.490000000000002 120-124 28.27 24.21 22.33 25.19 125-129 27.800000000000004 24.615000000000002 22.46 25.124999999999996 130-134 28.499999999999996 24.445 22.11 24.945 135-139 28.560000000000002 24.945 21.62 24.875 140-144 28.79 24.84 21.91 24.46 145-149 29.37 24.62 21.995 24.015 150-151 28.8875 25.0 22.0 24.1125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 0.5 25 0.0 26 1.0 27 2.0 28 2.5 29 5.5 30 8.0 31 7.0 32 12.0 33 17.0 34 18.0 35 22.0 36 24.5 37 33.0 38 48.0 39 62.5 40 78.0 41 100.0 42 118.5 43 130.0 44 149.5 45 164.5 46 157.5 47 152.5 48 159.5 49 148.5 50 135.0 51 131.5 52 112.0 53 95.0 54 102.5 55 102.5 56 103.5 57 112.0 58 101.0 59 92.0 60 91.5 61 101.0 62 104.0 63 96.0 64 95.0 65 92.0 66 87.5 67 78.0 68 81.0 69 84.0 70 72.5 71 60.5 72 48.5 73 44.5 74 39.5 75 24.0 76 17.5 77 18.5 78 12.0 79 8.5 80 7.0 81 5.0 82 3.0 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.85 #Duplication Level Percentage of deduplicated Percentage of total 1 95.30838165524513 90.4 2 4.269899841855562 8.1 3 0.2635740643120717 0.75 4 0.0790722192936215 0.3 5 0.02635740643120717 0.125 6 0.02635740643120717 0.15 7 0.02635740643120717 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.8625 0.0 0.0 0.0 0.0 108-109 2.0999999999999996 0.0 0.0 0.0 0.0 110-111 2.2750000000000004 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 2.875 0.0 0.0 0.0 0.0 116-117 3.1500000000000004 0.0 0.0 0.0 0.0 118-119 3.5375 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.175 0.0 0.0 0.0 0.0 124-125 4.7125 0.0 0.0 0.0 0.0 126-127 5.3875 0.0 0.0 0.0 0.0 128-129 5.9 0.0 0.0 0.0 0.0 130-131 6.3375 0.0 0.0 0.0 0.0 132-133 6.85 0.0 0.0 0.0 0.0 134-135 7.375 0.0 0.0 0.0 0.0 136-137 7.7875 0.0 0.0 0.0 0.0 138-139 8.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515064 spots for SRR7814822.sra Written 1515064 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra Read 1515046 spots for SRR7814822.sra Written 1515046 spots for SRR7814822.sra SRR ids: ['SRR7814822.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_01xvycvx SRR7814822.sra spots: 30300938 blocks: [[1, 1515046], [1515047, 3030092], [3030093, 4545138], [4545139, 6060184], [6060185, 7575230], [7575231, 9090276], [9090277, 10605322], [10605323, 12120368], [12120369, 13635414], [13635415, 15150460], [15150461, 16665506], [16665507, 18180552], [18180553, 19695598], [19695599, 21210644], [21210645, 22725690], [22725691, 24240736], [24240737, 25755782], [25755783, 27270828], [27270829, 28785874], [28785875, 30300938]] SRR7814822 file size 10246293 SRR7814822 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814822 SRR7814822_1.fastq SRR7814822_2.fastq Input file: SRR7814822_1.fastq Paired file: SRR7814822_2.fastq trimmed: SRR7814822-trimmed-pair1.fastq, SRR7814822-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:17:36 2024 >> started Fri Dec 6 11:19:01 2024 >> done (85.057s) 30300938 read pairs processed; of these: 202 ( 0.00%) short read pairs filtered out after trimming by size control 28456 ( 0.09%) empty read pairs filtered out after trimming by size control 30272280 (99.91%) read pairs available; of these: 3543579 (11.71%) trimmed read pairs available after processing 26728701 (88.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 16 0.00% 20 18 0.00% 21 21 0.00% 22 22 0.00% 23 24 0.00% 24 31 0.00% 25 31 0.00% 26 36 0.00% 27 40 0.00% 28 42 0.00% 29 54 0.00% 30 48 0.00% 31 46 0.00% 32 61 0.00% 33 48 0.00% 34 54 0.00% 35 61 0.00% 36 55 0.00% 37 62 0.00% 38 78 0.00% 39 87 0.00% 40 75 0.00% 41 83 0.00% 42 94 0.00% 43 92 0.00% 44 108 0.00% 45 97 0.00% 46 135 0.00% 47 123 0.00% 48 124 0.00% 49 143 0.00% 50 168 0.00% 51 223 0.00% 52 237 0.00% 53 247 0.00% 54 266 0.00% 55 269 0.00% 56 313 0.00% 57 330 0.00% 58 417 0.00% 59 498 0.00% 60 572 0.00% 61 682 0.00% 62 647 0.00% 63 762 0.00% 64 780 0.00% 65 833 0.00% 66 964 0.00% 67 1124 0.00% 68 1293 0.00% 69 1429 0.00% 70 1768 0.01% 71 1946 0.01% 72 2165 0.01% 73 2536 0.01% 74 2718 0.01% 75 3161 0.01% 76 3477 0.01% 77 3877 0.01% 78 4100 0.01% 79 4834 0.02% 80 5394 0.02% 81 5877 0.02% 82 6760 0.02% 83 7323 0.02% 84 8335 0.03% 85 9096 0.03% 86 9906 0.03% 87 10494 0.03% 88 11480 0.04% 89 12563 0.04% 90 13305 0.04% 91 14956 0.05% 92 15993 0.05% 93 17396 0.06% 94 18667 0.06% 95 19636 0.06% 96 21061 0.07% 97 22689 0.07% 98 23425 0.08% 99 24870 0.08% 100 26415 0.09% 101 27506 0.09% 102 28974 0.10% 103 30533 0.10% 104 32327 0.11% 105 33083 0.11% 106 35001 0.12% 107 36367 0.12% 108 37301 0.12% 109 39346 0.13% 110 40450 0.13% 111 41753 0.14% 112 43880 0.14% 113 45208 0.15% 114 46993 0.16% 115 48799 0.16% 116 50536 0.17% 117 51693 0.17% 118 52791 0.17% 119 53890 0.18% 120 55639 0.18% 121 56829 0.19% 122 58376 0.19% 123 59708 0.20% 124 62371 0.21% 125 63521 0.21% 126 65103 0.22% 127 66863 0.22% 128 67377 0.22% 129 69506 0.23% 130 71241 0.24% 131 72384 0.24% 132 73878 0.24% 133 75726 0.25% 134 76821 0.25% 135 78449 0.26% 136 79707 0.26% 137 81010 0.27% 138 81063 0.27% 139 83996 0.28% 140 84584 0.28% 141 85907 0.28% 142 88636 0.29% 143 89305 0.30% 144 91193 0.30% 145 93019 0.31% 146 94158 0.31% 147 96089 0.32% 148 96969 0.32% 149 98263 0.32% 150 99156 0.33% 151 26728701 88.29% 30272280 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=21 prefix-density=0.65 prefix-fanout=3.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=20.10 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=AATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTTGAGCTGACCCACTTGCGCA criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=15 prefix-density=0.60 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=75.76 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=7.2 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7814822 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:19:50 Started mapping on | Dec 06 11:20:07 Finished on | Dec 06 11:25:35 Mapping speed, Million of reads per hour | 332.26 Number of input reads | 30272280 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 28248855 Uniquely mapped reads % | 93.32% Average mapped length | 294.81 Number of splices: Total | 28551459 Number of splices: Annotated (sjdb) | 26977415 Number of splices: GT/AG | 28142838 Number of splices: GC/AG | 340935 Number of splices: AT/AC | 9004 Number of splices: Non-canonical | 58682 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.02% Deletion average length | 3.03 Insertion rate per base | 0.02% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 537961 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 50903 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.76% % of reads unmapped: other | 0.98% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1485464 1485464 1485464 N_multimapping 537961 537961 537961 N_noFeature 1000045 27324757 1308126 N_ambiguous 739267 3980 123991 UnstrandedReadsAssigned:26509543 PositiveStrandReadsAssigned:920118 NegativeStrandReadsAssigned:26816738 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814822 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814822-trimmed-pair1.fastq SRR7814822-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,272,280 reads, 27,098,124 reads pseudoaligned [quant] estimated average fragment length: 259.14 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR7814822.ke.tsv 35125 SRR7814822.se.tsv 88098 total ==> SRR7814822.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.472 0 0 PNS24247 1044 785.86 70.6382 4.44199 PNS24249 1928 1669.86 118.333 3.50194 PNS24246 1044 785.86 70.6382 4.44199 PNS24248 1044 785.86 70.6382 4.44199 PNS24244 1471 1212.86 75.7523 3.08651 PNS24243 293 95.9052 2 1.03055 KQK14069 1603 1344.86 2723.52 100.077 KQK14071 474 237.249 104.295 21.7242 ==> SRR7814822.se.tsv <== BRADI_1g14170v3 3481 BRADI_1g53295v3 1178 BRADI_1g59795v3 194 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 733 BRADI_1g74790v3 278 BRADI_1g09890v3 0 BRADI_1g77505v3 416 BRADI_1g48960v3 0 SRR7814822 completed mapping pipeline successfully