Starting /dee2/code/volunteer_pipeline.sh SRR7814823 current disk space = 1551266623488 free memory = 1604638964 SRR7814823 SRAfilesize cb1f396c48d92a220a7789ebe198b16c SRR7814823.sra SRR7814823.sra file validated SRR7814823 is paired end SRR7814823 is conventional basespace SRR7814823 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814823_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42775 37.0 37.0 37.0 37.0 37.0 2 36.391 37.0 37.0 37.0 37.0 37.0 3 36.5295 37.0 37.0 37.0 37.0 37.0 4 36.531 37.0 37.0 37.0 37.0 37.0 5 36.572 37.0 37.0 37.0 37.0 37.0 6 36.596 37.0 37.0 37.0 37.0 37.0 7 36.5025 37.0 37.0 37.0 37.0 37.0 8 36.4425 37.0 37.0 37.0 37.0 37.0 9 36.5085 37.0 37.0 37.0 37.0 37.0 10-14 36.5218 37.0 37.0 37.0 37.0 37.0 15-19 36.554100000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.500299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4812 37.0 37.0 37.0 37.0 37.0 30-34 36.40689999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.3694 37.0 37.0 37.0 37.0 37.0 40-44 36.3981 37.0 37.0 37.0 37.0 37.0 45-49 36.461800000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.3101 37.0 37.0 37.0 37.0 37.0 55-59 36.3035 37.0 37.0 37.0 37.0 37.0 60-64 36.35379999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.309799999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.2888 37.0 37.0 37.0 37.0 37.0 75-79 36.261900000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.206500000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.1931 37.0 37.0 37.0 37.0 37.0 90-94 36.184799999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.1768 37.0 37.0 37.0 37.0 37.0 100-104 36.168 37.0 37.0 37.0 37.0 37.0 105-109 36.1372 37.0 37.0 37.0 37.0 37.0 110-114 36.068799999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.076 37.0 37.0 37.0 37.0 37.0 120-124 35.9619 37.0 37.0 37.0 37.0 37.0 125-129 35.9664 37.0 37.0 37.0 37.0 37.0 130-134 35.9218 37.0 37.0 37.0 37.0 37.0 135-139 35.904399999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.87 37.0 37.0 37.0 37.0 37.0 145-149 35.9012 37.0 37.0 37.0 37.0 37.0 150-151 35.356 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 4.0 26 5.0 27 9.0 28 14.0 29 19.0 30 31.0 31 27.0 32 50.0 33 92.0 34 141.0 35 327.0 36 2830.0 37 450.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 51.04088286932531 11.78831201404565 5.743666917481816 31.42713819914723 2 26.724999999999998 12.075 30.85 30.349999999999998 3 23.125 17.5 23.5 35.875 4 29.9 24.25 19.975 25.874999999999996 5 28.849999999999998 27.6 22.400000000000002 21.15 6 22.8 30.275000000000002 22.475 24.45 7 20.0 22.675 37.4 19.925 8 20.724999999999998 22.675 28.675 27.925 9 19.525000000000002 21.325 32.475 26.674999999999997 10-14 24.82 25.405 24.3 25.474999999999998 15-19 24.95 24.654999999999998 23.544999999999998 26.85 20-24 24.185000000000002 24.4 24.485 26.93 25-29 24.505 24.224999999999998 24.575 26.695 30-34 24.285 25.174999999999997 24.275 26.265 35-39 24.125 23.87 25.180000000000003 26.825 40-44 24.884999999999998 24.45 24.055 26.61 45-49 23.995 24.165 25.03 26.810000000000002 50-54 24.995 24.165 23.830000000000002 27.01 55-59 24.884999999999998 24.099999999999998 24.099999999999998 26.915 60-64 25.005 23.535 24.72 26.740000000000002 65-69 24.565 24.85 24.095 26.490000000000002 70-74 25.395 24.43 23.47 26.705000000000002 75-79 25.095 23.765 23.810000000000002 27.33 80-84 24.55 23.835 24.215 27.400000000000002 85-89 25.655 23.96 23.805 26.58 90-94 24.9 24.005000000000003 24.13 26.965 95-99 25.405 24.145 23.535 26.915 100-104 24.95 24.395 23.69 26.965 105-109 24.765 23.62 24.63 26.985 110-114 25.405 23.635 24.065 26.895000000000003 115-119 25.575 24.18 23.419999999999998 26.825 120-124 25.135 24.02 23.935000000000002 26.91 125-129 25.924999999999997 23.685000000000002 23.64 26.75 130-134 25.745 24.25 23.47 26.534999999999997 135-139 25.990000000000002 23.599999999999998 23.919999999999998 26.490000000000002 140-144 25.31 23.82 23.925 26.945000000000004 145-149 26.009999999999998 23.615 23.395 26.979999999999997 150-151 25.724999999999998 23.3125 23.95 27.0125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.5 26 3.0 27 2.0 28 3.5 29 5.0 30 4.5 31 6.5 32 15.0 33 22.5 34 28.5 35 29.5 36 35.0 37 55.5 38 72.5 39 90.0 40 108.5 41 127.5 42 137.5 43 137.0 44 146.5 45 167.0 46 189.0 47 185.0 48 173.0 49 154.5 50 129.5 51 128.5 52 128.0 53 108.0 54 96.5 55 93.5 56 87.5 57 86.5 58 85.5 59 95.5 60 93.5 61 79.5 62 75.5 63 73.5 64 71.5 65 69.0 66 87.0 67 88.0 68 69.0 69 61.0 70 54.0 71 49.0 72 37.0 73 30.5 74 24.5 75 21.0 76 21.0 77 18.0 78 13.0 79 8.0 80 8.0 81 5.0 82 1.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.825 #Duplication Level Percentage of deduplicated Percentage of total 1 89.89702198719732 80.75 2 9.017534094071806 16.2 3 0.9462844419704982 2.55 4 0.13915947676036738 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0125 98-99 0.825 0.0 0.0 0.0 0.025 100-101 1.1125 0.0 0.0 0.0 0.025 102-103 1.2000000000000002 0.0 0.0 0.0 0.025 104-105 1.3875000000000002 0.0 0.0 0.0 0.025 106-107 1.6875 0.0 0.0 0.0 0.025 108-109 1.75 0.0 0.0 0.0 0.025 110-111 2.0875 0.0 0.0 0.0 0.025 112-113 2.375 0.0 0.0 0.0 0.025 114-115 2.7 0.0 0.0 0.0 0.025 116-117 2.8499999999999996 0.0 0.0 0.0 0.025 118-119 3.125 0.0 0.0 0.0 0.025 120-121 3.4875 0.0 0.0 0.0 0.025 122-123 3.7875 0.0 0.0 0.0 0.025 124-125 4.3125 0.0 0.0 0.0 0.025 126-127 4.725 0.0 0.0 0.0 0.025 128-129 5.125 0.0 0.0 0.0 0.025 130-131 5.5625 0.0 0.0 0.0 0.025 132-133 6.0625 0.0 0.0 0.0 0.025 134-135 6.5375 0.0 0.0 0.0 0.025 136-137 7.2875 0.0 0.0 0.0 0.025 138-139 7.725 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATATA 10 0.006830828 145.0 4 ATAACAA 10 0.006830828 145.0 8 >>END_MODULE SRR7814823 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814823_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0355 37.0 37.0 37.0 37.0 37.0 2 35.7005 37.0 37.0 37.0 37.0 37.0 3 35.7625 37.0 37.0 37.0 37.0 37.0 4 35.912 37.0 37.0 37.0 37.0 37.0 5 35.918 37.0 37.0 37.0 37.0 37.0 6 35.898 37.0 37.0 37.0 37.0 37.0 7 35.7865 37.0 37.0 37.0 37.0 37.0 8 35.8435 37.0 37.0 37.0 37.0 37.0 9 35.874 37.0 37.0 37.0 37.0 37.0 10-14 35.8981 37.0 37.0 37.0 37.0 37.0 15-19 35.828700000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.7725 37.0 37.0 37.0 37.0 37.0 25-29 35.7653 37.0 37.0 37.0 37.0 37.0 30-34 35.805499999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.7217 37.0 37.0 37.0 37.0 37.0 40-44 35.799 37.0 37.0 37.0 37.0 37.0 45-49 35.668099999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.6908 37.0 37.0 37.0 37.0 37.0 55-59 35.638799999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.523 37.0 37.0 37.0 37.0 37.0 65-69 35.5108 37.0 37.0 37.0 37.0 37.0 70-74 35.4853 37.0 37.0 37.0 37.0 37.0 75-79 35.5136 37.0 37.0 37.0 37.0 37.0 80-84 35.3635 37.0 37.0 37.0 37.0 37.0 85-89 35.38590000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.3858 37.0 37.0 37.0 34.6 37.0 95-99 35.37480000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.2616 37.0 37.0 37.0 37.0 37.0 105-109 35.2864 37.0 37.0 37.0 32.2 37.0 110-114 35.24550000000001 37.0 37.0 37.0 32.2 37.0 115-119 35.105000000000004 37.0 37.0 37.0 27.4 37.0 120-124 35.0646 37.0 37.0 37.0 27.4 37.0 125-129 35.0192 37.0 37.0 37.0 25.0 37.0 130-134 35.0248 37.0 37.0 37.0 25.0 37.0 135-139 34.782799999999995 37.0 37.0 37.0 25.0 37.0 140-144 34.525 37.0 37.0 37.0 25.0 37.0 145-149 34.4644 37.0 37.0 37.0 25.0 37.0 150-151 33.7265 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 8.0 15 5.0 16 2.0 17 3.0 18 6.0 19 1.0 20 7.0 21 9.0 22 5.0 23 15.0 24 7.0 25 14.0 26 11.0 27 15.0 28 22.0 29 32.0 30 35.0 31 63.0 32 99.0 33 152.0 34 301.0 35 708.0 36 2349.0 37 128.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.175 18.5 8.225 29.099999999999998 2 31.2 21.925 26.3 20.575 3 23.25 24.175 27.575 25.0 4 29.299999999999997 28.299999999999997 18.775 23.625 5 29.349999999999998 32.5 17.65 20.5 6 24.3 35.275 17.675 22.75 7 24.8 19.6 31.674999999999997 23.925 8 23.3 22.05 23.325000000000003 31.324999999999996 9 23.5 21.675 26.625 28.199999999999996 10-14 27.744999999999997 24.555 21.265 26.435 15-19 26.590000000000003 25.509999999999998 22.515 25.385 20-24 26.419999999999998 25.1 22.375 26.105 25-29 26.665 24.21 22.795 26.33 30-34 26.025 25.009999999999998 22.770000000000003 26.195 35-39 26.6 24.975 22.625 25.8 40-44 27.115000000000002 24.9 22.525000000000002 25.46 45-49 26.995 23.925 23.06 26.02 50-54 27.595 23.9 22.925 25.580000000000002 55-59 26.790000000000003 23.91 22.84 26.46 60-64 27.365000000000002 23.355 22.855 26.424999999999997 65-69 27.455000000000002 23.62 22.975 25.95 70-74 27.1 23.369999999999997 22.919999999999998 26.61 75-79 26.974999999999998 24.435000000000002 23.064999999999998 25.525 80-84 26.935 24.625 22.869999999999997 25.569999999999997 85-89 27.315 23.43 22.98 26.275 90-94 27.68 24.08 22.475 25.765 95-99 27.67 23.79 23.415 25.124999999999996 100-104 27.105 24.154999999999998 22.564999999999998 26.174999999999997 105-109 27.855 24.32 22.7 25.124999999999996 110-114 27.705000000000002 24.235 22.605 25.455 115-119 28.470000000000002 23.935000000000002 22.105 25.490000000000002 120-124 28.015 24.035 22.845 25.105 125-129 27.994999999999997 24.21 22.650000000000002 25.145 130-134 28.365000000000002 23.919999999999998 22.88 24.834999999999997 135-139 28.265 25.259999999999998 22.33 24.145 140-144 28.99 25.040000000000003 22.27 23.7 145-149 28.904999999999998 24.455 22.58 24.060000000000002 150-151 29.099999999999998 24.1125 22.575 24.212500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.5 7 0.5 8 0.0 9 1.0 10 2.0 11 1.5 12 1.0 13 0.5 14 0.5 15 1.5 16 1.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.0 22 1.0 23 1.0 24 0.5 25 1.5 26 3.0 27 3.5 28 4.5 29 5.5 30 7.0 31 9.5 32 11.0 33 16.5 34 21.5 35 27.5 36 35.5 37 44.5 38 61.0 39 73.5 40 88.0 41 100.0 42 116.0 43 137.5 44 142.0 45 143.0 46 145.5 47 149.0 48 155.0 49 154.0 50 140.5 51 123.5 52 109.0 53 98.5 54 100.0 55 97.0 56 91.0 57 98.0 58 109.0 59 106.5 60 107.0 61 110.5 62 91.5 63 89.5 64 90.5 65 83.0 66 82.5 67 73.0 68 75.0 69 75.5 70 72.0 71 69.0 72 53.0 73 34.5 74 30.0 75 25.0 76 17.5 77 21.0 78 17.0 79 7.0 80 4.5 81 4.5 82 3.0 83 2.5 84 1.5 85 1.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 1.0 92 0.5 93 0.5 94 1.0 95 0.5 96 0.5 97 1.0 98 1.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.4 #Duplication Level Percentage of deduplicated Percentage of total 1 89.90492170022371 80.375 2 8.640939597315436 15.45 3 1.2583892617449663 3.375 4 0.13982102908277405 0.5 5 0.02796420581655481 0.125 6 0.0 0.0 7 0.02796420581655481 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CTGTTTCGTGGGAAGGAGAGGGGGCTCCATTTGATGAAACTGATCAAGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.4 0.0 0.0 0.0 0.0 114-115 2.7249999999999996 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.15 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.7750000000000004 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.7 0.0 0.0 0.0 0.0 128-129 5.1 0.0 0.0 0.0 0.0 130-131 5.5375 0.0 0.0 0.0 0.0 132-133 6.050000000000001 0.0 0.0 0.0 0.0 134-135 6.5 0.0 0.0 0.0 0.0 136-137 7.2625 0.0 0.0 0.0 0.0 138-139 7.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCACC 10 0.006830828 145.0 2 >>END_MODULE Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726078 spots for SRR7814823.sra Written 2726078 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra Read 2726075 spots for SRR7814823.sra Written 2726075 spots for SRR7814823.sra SRR ids: ['SRR7814823.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__vggqsdy SRR7814823.sra spots: 54521503 blocks: [[1, 2726075], [2726076, 5452150], [5452151, 8178225], [8178226, 10904300], [10904301, 13630375], [13630376, 16356450], [16356451, 19082525], [19082526, 21808600], [21808601, 24534675], [24534676, 27260750], [27260751, 29986825], [29986826, 32712900], [32712901, 35438975], [35438976, 38165050], [38165051, 40891125], [40891126, 43617200], [43617201, 46343275], [46343276, 49069350], [49069351, 51795425], [51795426, 54521503]] SRR7814823 file size 18453848 SRR7814823 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814823 SRR7814823_1.fastq SRR7814823_2.fastq Input file: SRR7814823_1.fastq Paired file: SRR7814823_2.fastq trimmed: SRR7814823-trimmed-pair1.fastq, SRR7814823-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:22:08 2024 >> started Fri Dec 6 11:23:10 2024 >> done (61.613s) 54521503 read pairs processed; of these: 245 ( 0.00%) short read pairs filtered out after trimming by size control 24853 ( 0.05%) empty read pairs filtered out after trimming by size control 54496405 (99.95%) read pairs available; of these: 5595226 (10.27%) trimmed read pairs available after processing 48901179 (89.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 19 0.00% 20 27 0.00% 21 28 0.00% 22 27 0.00% 23 30 0.00% 24 27 0.00% 25 28 0.00% 26 50 0.00% 27 41 0.00% 28 65 0.00% 29 53 0.00% 30 61 0.00% 31 64 0.00% 32 75 0.00% 33 67 0.00% 34 76 0.00% 35 86 0.00% 36 78 0.00% 37 75 0.00% 38 92 0.00% 39 78 0.00% 40 102 0.00% 41 109 0.00% 42 115 0.00% 43 107 0.00% 44 93 0.00% 45 109 0.00% 46 139 0.00% 47 138 0.00% 48 174 0.00% 49 215 0.00% 50 217 0.00% 51 238 0.00% 52 259 0.00% 53 337 0.00% 54 287 0.00% 55 302 0.00% 56 346 0.00% 57 423 0.00% 58 463 0.00% 59 615 0.00% 60 663 0.00% 61 787 0.00% 62 789 0.00% 63 941 0.00% 64 1031 0.00% 65 1026 0.00% 66 1191 0.00% 67 1370 0.00% 68 1541 0.00% 69 1709 0.00% 70 2167 0.00% 71 2371 0.00% 72 2732 0.01% 73 2985 0.01% 74 3249 0.01% 75 3709 0.01% 76 4104 0.01% 77 4814 0.01% 78 5430 0.01% 79 5997 0.01% 80 6692 0.01% 81 7463 0.01% 82 8585 0.02% 83 9697 0.02% 84 10742 0.02% 85 11588 0.02% 86 12662 0.02% 87 13717 0.03% 88 14859 0.03% 89 16149 0.03% 90 17989 0.03% 91 20031 0.04% 92 21658 0.04% 93 23460 0.04% 94 25459 0.05% 95 27293 0.05% 96 29324 0.05% 97 31147 0.06% 98 32512 0.06% 99 34268 0.06% 100 37610 0.07% 101 39534 0.07% 102 42037 0.08% 103 44940 0.08% 104 47007 0.09% 105 49016 0.09% 106 51565 0.09% 107 53317 0.10% 108 56084 0.10% 109 58603 0.11% 110 61493 0.11% 111 63898 0.12% 112 67500 0.12% 113 70107 0.13% 114 72350 0.13% 115 75415 0.14% 116 78129 0.14% 117 80492 0.15% 118 81858 0.15% 119 83667 0.15% 120 86608 0.16% 121 89960 0.17% 122 92033 0.17% 123 95798 0.18% 124 99594 0.18% 125 102375 0.19% 126 105767 0.19% 127 107731 0.20% 128 109626 0.20% 129 112138 0.21% 130 113506 0.21% 131 116143 0.21% 132 120269 0.22% 133 123182 0.23% 134 126075 0.23% 135 129086 0.24% 136 131302 0.24% 137 133314 0.24% 138 133646 0.25% 139 138361 0.25% 140 138669 0.25% 141 141793 0.26% 142 145872 0.27% 143 147117 0.27% 144 153124 0.28% 145 155039 0.28% 146 156133 0.29% 147 159481 0.29% 148 160787 0.30% 149 161873 0.30% 150 164352 0.30% 151 48901179 89.73% 54496405 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=10 prefix-density=0.75 prefix-fanout=3.3 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=117.33 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=7.9 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=4.11 fanout-score-rank=9 prefix-density=0.71 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=28 fanout-score=12.63 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=3.8 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC SRR7814823 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:23:53 Started mapping on | Dec 06 11:23:54 Finished on | Dec 06 11:30:22 Mapping speed, Million of reads per hour | 505.64 Number of input reads | 54496405 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 50719433 Uniquely mapped reads % | 93.07% Average mapped length | 295.79 Number of splices: Total | 48021840 Number of splices: Annotated (sjdb) | 45230706 Number of splices: GT/AG | 47357173 Number of splices: GC/AG | 534840 Number of splices: AT/AC | 17258 Number of splices: Non-canonical | 112569 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 3.05 Insertion rate per base | 0.03% Insertion average length | 2.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1039690 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 83770 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.83% % of reads unmapped: other | 1.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2737282 2737282 2737282 N_multimapping 1039690 1039690 1039690 N_noFeature 1944181 49108919 2519577 N_ambiguous 1325575 10718 291922 UnstrandedReadsAssigned:47449677 PositiveStrandReadsAssigned:1599796 NegativeStrandReadsAssigned:47907934 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814823 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814823-trimmed-pair1.fastq SRR7814823-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 54,496,405 reads, 48,684,780 reads pseudoaligned [quant] estimated average fragment length: 266.568 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR7814823.ke.tsv 35125 SRR7814823.se.tsv 88098 total ==> SRR7814823.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.942 0 0 PNS24247 1044 778.432 160.591 5.33071 PNS24249 1928 1662.43 445.953 6.93153 PNS24246 1044 778.432 160.591 5.33071 PNS24248 1044 778.432 160.591 5.33071 PNS24244 1471 1205.43 205.275 4.40024 PNS24243 293 95.4629 0 0 KQK14069 1603 1337.43 47346 914.737 KQK14071 474 232.758 1064.82 118.211 ==> SRR7814823.se.tsv <== BRADI_1g14170v3 53016 BRADI_1g53295v3 5075 BRADI_1g59795v3 330 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 1271 BRADI_1g74790v3 1565 BRADI_1g09890v3 2 BRADI_1g77505v3 673 BRADI_1g48960v3 0 SRR7814823 completed mapping pipeline successfully