Starting /dee2/code/volunteer_pipeline.sh SRR7814824 current disk space = 1551308914688 free memory = 1604626532 SRR7814824 SRAfilesize 2b79a6e36671cebc3dc4e3b4e660b8bf SRR7814824.sra SRR7814824.sra file validated SRR7814824 is paired end SRR7814824 is conventional basespace SRR7814824 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814824_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2325 37.0 37.0 37.0 37.0 37.0 2 36.295 37.0 37.0 37.0 37.0 37.0 3 36.2945 37.0 37.0 37.0 37.0 37.0 4 36.416 37.0 37.0 37.0 37.0 37.0 5 36.45 37.0 37.0 37.0 37.0 37.0 6 36.469 37.0 37.0 37.0 37.0 37.0 7 36.4245 37.0 37.0 37.0 37.0 37.0 8 36.546 37.0 37.0 37.0 37.0 37.0 9 36.471 37.0 37.0 37.0 37.0 37.0 10-14 36.468 37.0 37.0 37.0 37.0 37.0 15-19 36.45989999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.3878 37.0 37.0 37.0 37.0 37.0 25-29 36.386700000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.349700000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.319300000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.2549 37.0 37.0 37.0 37.0 37.0 45-49 36.094500000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.1508 37.0 37.0 37.0 37.0 37.0 55-59 35.9788 37.0 37.0 37.0 37.0 37.0 60-64 36.0398 37.0 37.0 37.0 37.0 37.0 65-69 35.9226 37.0 37.0 37.0 37.0 37.0 70-74 35.9234 37.0 37.0 37.0 37.0 37.0 75-79 35.9382 37.0 37.0 37.0 37.0 37.0 80-84 36.0178 37.0 37.0 37.0 37.0 37.0 85-89 35.8956 37.0 37.0 37.0 37.0 37.0 90-94 35.821000000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.763600000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.745 37.0 37.0 37.0 37.0 37.0 105-109 35.748400000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.7584 37.0 37.0 37.0 37.0 37.0 115-119 35.5338 37.0 37.0 37.0 37.0 37.0 120-124 35.561 37.0 37.0 37.0 37.0 37.0 125-129 35.5209 37.0 37.0 37.0 37.0 37.0 130-134 35.4173 37.0 37.0 37.0 37.0 37.0 135-139 35.2675 37.0 37.0 37.0 29.8 37.0 140-144 35.1971 37.0 37.0 37.0 27.4 37.0 145-149 35.081 37.0 37.0 37.0 25.0 37.0 150-151 34.414 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 2.0 22 2.0 23 2.0 24 4.0 25 11.0 26 10.0 27 11.0 28 25.0 29 31.0 30 42.0 31 68.0 32 74.0 33 121.0 34 201.0 35 387.0 36 2739.0 37 268.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 53.90977443609023 10.676691729323307 5.3884711779448615 30.025062656641605 2 27.0 12.525 30.125 30.349999999999998 3 23.599999999999998 17.275 23.175 35.949999999999996 4 29.9 23.65 19.825 26.625 5 30.175 28.1 21.5 20.225 6 25.775 29.2 20.3 24.725 7 20.65 23.799999999999997 35.9 19.650000000000002 8 21.775 22.375 27.325 28.525 9 22.45 21.55 30.8 25.2 10-14 24.68 25.069999999999997 24.495 25.755 15-19 25.064999999999998 23.200000000000003 24.315 27.42 20-24 25.740000000000002 24.2 23.715 26.345000000000002 25-29 25.575 23.94 23.71 26.775 30-34 25.52 23.39 24.395 26.695 35-39 25.605 23.145 24.104999999999997 27.145000000000003 40-44 25.795 23.630000000000003 24.01 26.565 45-49 26.135 23.775 23.674999999999997 26.415 50-54 26.455000000000002 22.900000000000002 23.22 27.425 55-59 25.885 23.345 23.565 27.205000000000002 60-64 26.245 22.555 23.86 27.339999999999996 65-69 25.905 23.885 23.32 26.889999999999997 70-74 27.229999999999997 23.025000000000002 23.24 26.505000000000003 75-79 26.224999999999998 23.105 23.369999999999997 27.3 80-84 27.384999999999998 22.275 23.61 26.729999999999997 85-89 27.105 22.869999999999997 22.939999999999998 27.084999999999997 90-94 27.134999999999998 23.669999999999998 22.75 26.445 95-99 27.634999999999998 22.925 22.725 26.715 100-104 27.6 23.32 22.88 26.200000000000003 105-109 28.215 22.615 22.875 26.295 110-114 27.57 22.994999999999997 22.81 26.625 115-119 27.965 22.805 22.869999999999997 26.36 120-124 27.42 23.46 22.355 26.765 125-129 27.87 23.18 22.11 26.840000000000003 130-134 28.139999999999997 22.735 22.805 26.32 135-139 27.625 23.015 21.845 27.515 140-144 27.805000000000003 23.21 22.35 26.634999999999998 145-149 27.775 22.915 22.245 27.065 150-151 27.35 22.0875 22.575 27.987499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 3.0 29 6.5 30 9.5 31 9.0 32 8.0 33 11.0 34 16.0 35 25.5 36 36.5 37 55.0 38 70.0 39 72.0 40 85.5 41 108.0 42 134.5 43 145.5 44 144.0 45 150.0 46 156.0 47 147.0 48 130.5 49 134.5 50 140.0 51 127.0 52 106.0 53 98.0 54 93.0 55 77.5 56 83.5 57 94.5 58 97.0 59 99.5 60 99.0 61 104.5 62 104.0 63 105.5 64 103.5 65 99.5 66 93.5 67 77.0 68 75.0 69 77.5 70 70.5 71 58.5 72 52.5 73 50.5 74 35.5 75 26.5 76 24.5 77 19.5 78 12.5 79 9.0 80 8.0 81 3.0 82 2.5 83 3.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 1.0 91 1.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.425 #Duplication Level Percentage of deduplicated Percentage of total 1 93.10251555315119 86.05000000000001 2 6.27535839870165 11.600000000000001 3 0.5680281309169597 1.575 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.054097917230186636 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGCTGTTATCTCGTAT 20 0.5 TruSeq Adapter, Index 10 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGCTGTTATCGCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 10 (97% over 38bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.9125000000000001 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.3875000000000002 0.0 0.0 0.0 0.0 106-107 1.6125 0.0 0.0 0.0 0.0 108-109 1.8875000000000002 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 3.0125 0.0 0.0 0.0 0.0 118-119 3.4375 0.0 0.0 0.0 0.0 120-121 3.875 0.0 0.0 0.0 0.0 122-123 4.2375 0.0 0.0 0.0 0.0 124-125 4.8125 0.0 0.0 0.0 0.0 126-127 5.3625 0.0 0.0 0.0 0.0 128-129 5.75 0.0 0.0 0.0 0.0 130-131 6.125 0.0 0.0 0.0 0.0 132-133 6.75 0.0 0.0 0.0 0.0 134-135 7.3 0.0 0.0 0.0 0.0 136-137 7.8875 0.0 0.0 0.0 0.0 138-139 8.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTGGT 10 0.006830828 145.0 7 GGCCGAG 35 0.0033124194 62.14286 1 >>END_MODULE SRR7814824 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814824_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1915 37.0 37.0 37.0 37.0 37.0 2 35.6875 37.0 37.0 37.0 37.0 37.0 3 35.724 37.0 37.0 37.0 37.0 37.0 4 35.876 37.0 37.0 37.0 37.0 37.0 5 35.95 37.0 37.0 37.0 37.0 37.0 6 35.801 37.0 37.0 37.0 37.0 37.0 7 35.756 37.0 37.0 37.0 37.0 37.0 8 35.6915 37.0 37.0 37.0 37.0 37.0 9 35.7625 37.0 37.0 37.0 37.0 37.0 10-14 35.7439 37.0 37.0 37.0 37.0 37.0 15-19 35.7274 37.0 37.0 37.0 37.0 37.0 20-24 35.561899999999994 37.0 37.0 37.0 37.0 37.0 25-29 35.4401 37.0 37.0 37.0 37.0 37.0 30-34 35.3489 37.0 37.0 37.0 37.0 37.0 35-39 35.39 37.0 37.0 37.0 37.0 37.0 40-44 35.325599999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.2321 37.0 37.0 37.0 37.0 37.0 50-54 35.167500000000004 37.0 37.0 37.0 34.6 37.0 55-59 35.1432 37.0 37.0 37.0 34.6 37.0 60-64 35.1242 37.0 37.0 37.0 29.8 37.0 65-69 35.11710000000001 37.0 37.0 37.0 32.2 37.0 70-74 34.91880000000001 37.0 37.0 37.0 25.0 37.0 75-79 35.019999999999996 37.0 37.0 37.0 27.4 37.0 80-84 34.8208 37.0 37.0 37.0 25.0 37.0 85-89 34.8584 37.0 37.0 37.0 25.0 37.0 90-94 34.796299999999995 37.0 37.0 37.0 25.0 37.0 95-99 34.7081 37.0 37.0 37.0 25.0 37.0 100-104 34.710699999999996 37.0 37.0 37.0 25.0 37.0 105-109 34.6957 37.0 37.0 37.0 25.0 37.0 110-114 34.4051 37.0 37.0 37.0 25.0 37.0 115-119 34.4728 37.0 37.0 37.0 25.0 37.0 120-124 34.2924 37.0 37.0 37.0 25.0 37.0 125-129 34.251099999999994 37.0 37.0 37.0 25.0 37.0 130-134 34.0351 37.0 37.0 37.0 25.0 37.0 135-139 33.78150000000001 37.0 37.0 37.0 25.0 37.0 140-144 33.6051 37.0 37.0 37.0 25.0 37.0 145-149 33.497 37.0 37.0 37.0 25.0 37.0 150-151 32.83325 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 8.0 14 13.0 15 7.0 16 11.0 17 10.0 18 5.0 19 8.0 20 15.0 21 10.0 22 14.0 23 12.0 24 17.0 25 24.0 26 24.0 27 28.0 28 24.0 29 29.0 30 58.0 31 65.0 32 110.0 33 186.0 34 358.0 35 902.0 36 1961.0 37 100.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.325 18.5 6.925000000000001 27.250000000000004 2 31.85 19.625 24.075 24.45 3 25.7 22.5 24.825 26.974999999999998 4 28.549999999999997 28.299999999999997 18.15 25.0 5 30.075000000000003 31.8 17.2 20.925 6 26.1 32.074999999999996 18.15 23.674999999999997 7 25.75 18.825 29.25 26.174999999999997 8 24.25 22.875 21.099999999999998 31.775 9 26.700000000000003 20.825 23.05 29.425 10-14 28.235 23.71 21.105 26.950000000000003 15-19 28.199999999999996 23.25 21.77 26.779999999999998 20-24 27.975 23.53 21.77 26.724999999999998 25-29 28.165000000000003 23.125 22.125 26.584999999999997 30-34 27.415 23.919999999999998 21.87 26.795 35-39 27.925 23.445 21.65 26.979999999999997 40-44 28.275 23.46 21.634999999999998 26.63 45-49 27.345000000000002 22.985 21.935 27.735 50-54 28.315 23.105 21.349999999999998 27.229999999999997 55-59 28.225 23.225 21.445 27.105 60-64 28.515 23.115 20.990000000000002 27.38 65-69 27.925 23.16 21.775 27.139999999999997 70-74 28.355000000000004 22.675 22.035 26.935 75-79 27.52 23.07 21.815 27.595 80-84 27.365000000000002 22.650000000000002 22.03 27.955000000000002 85-89 28.549999999999997 22.645 21.435000000000002 27.37 90-94 28.665000000000003 22.705000000000002 21.965 26.665 95-99 28.884999999999998 22.884999999999998 21.355 26.875 100-104 28.595 23.765 21.18 26.46 105-109 28.449999999999996 23.215 21.13 27.205000000000002 110-114 28.925 23.115 21.42 26.540000000000003 115-119 28.98 23.015 21.42 26.584999999999997 120-124 29.095 22.99 21.505 26.41 125-129 28.970000000000002 24.529999999999998 20.560000000000002 25.94 130-134 29.87 23.23 21.27 25.629999999999995 135-139 29.345 23.69 21.060000000000002 25.905 140-144 30.54 23.810000000000002 21.255 24.395 145-149 30.18 23.525 21.11 25.185000000000002 150-151 31.25 23.5375 20.875 24.337500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 2.0 12 3.0 13 1.0 14 0.5 15 0.5 16 1.0 17 1.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 1.5 26 2.0 27 3.5 28 5.0 29 3.5 30 4.0 31 8.5 32 7.5 33 8.0 34 16.0 35 26.0 36 29.5 37 33.0 38 46.0 39 54.0 40 67.5 41 87.0 42 104.5 43 114.0 44 122.5 45 124.5 46 126.0 47 138.5 48 142.5 49 124.0 50 120.5 51 124.0 52 107.5 53 97.5 54 92.0 55 89.0 56 85.0 57 85.5 58 97.0 59 109.5 60 110.5 61 109.5 62 120.0 63 125.0 64 114.5 65 109.5 66 102.5 67 94.0 68 91.5 69 91.5 70 80.0 71 70.5 72 65.5 73 53.5 74 46.0 75 37.0 76 32.0 77 26.5 78 15.5 79 8.0 80 4.5 81 4.0 82 5.0 83 3.0 84 1.5 85 1.5 86 1.5 87 3.0 88 3.0 89 2.0 90 2.0 91 3.0 92 2.5 93 2.0 94 3.0 95 1.5 96 0.5 97 5.0 98 7.5 99 6.5 100 8.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.325 #Duplication Level Percentage of deduplicated Percentage of total 1 93.20335770376388 86.05000000000001 2 5.9030598429461145 10.9 3 0.7581911724884917 2.1 4 0.05415651232060655 0.2 5 0.027078256160303276 0.125 6 0.0 0.0 7 0.027078256160303276 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.027078256160303276 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 18 0.44999999999999996 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 7 0.17500000000000002 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.675 0.0 0.0 0.0 0.0 108-109 1.9625 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.475 0.0 0.0 0.0 0.0 114-115 2.7375 0.0 0.0 0.0 0.0 116-117 3.0625 0.0 0.0 0.0 0.0 118-119 3.4875 0.0 0.0 0.0 0.0 120-121 3.9250000000000003 0.0 0.0 0.0 0.0 122-123 4.25 0.0 0.0 0.0 0.0 124-125 4.800000000000001 0.0 0.0 0.0 0.0 126-127 5.3125 0.0 0.0 0.0 0.0 128-129 5.699999999999999 0.0 0.0 0.0 0.0 130-131 6.1125 0.0 0.0 0.0 0.0 132-133 6.7 0.0 0.0 0.0 0.0 134-135 7.2125 0.0 0.0 0.0 0.0 136-137 7.725 0.0 0.0 0.0 0.0 138-139 8.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGAAGG 10 0.006830828 145.0 145 >>END_MODULE Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031276 spots for SRR7814824.sra Written 2031276 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra Read 2031265 spots for SRR7814824.sra Written 2031265 spots for SRR7814824.sra SRR ids: ['SRR7814824.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_397_at4y SRR7814824.sra spots: 40625311 blocks: [[1, 2031265], [2031266, 4062530], [4062531, 6093795], [6093796, 8125060], [8125061, 10156325], [10156326, 12187590], [12187591, 14218855], [14218856, 16250120], [16250121, 18281385], [18281386, 20312650], [20312651, 22343915], [22343916, 24375180], [24375181, 26406445], [26406446, 28437710], [28437711, 30468975], [30468976, 32500240], [32500241, 34531505], [34531506, 36562770], [36562771, 38594035], [38594036, 40625311]] SRR7814824 file size 13744884 SRR7814824 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814824 SRR7814824_1.fastq SRR7814824_2.fastq Input file: SRR7814824_1.fastq Paired file: SRR7814824_2.fastq trimmed: SRR7814824-trimmed-pair1.fastq, SRR7814824-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:20:41 2024 >> started Fri Dec 6 11:21:29 2024 >> done (48.201s) 40625311 read pairs processed; of these: 406 ( 0.00%) short read pairs filtered out after trimming by size control 329867 ( 0.81%) empty read pairs filtered out after trimming by size control 40295038 (99.19%) read pairs available; of these: 4710989 (11.69%) trimmed read pairs available after processing 35584049 (88.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 29 0.00% 19 35 0.00% 20 41 0.00% 21 33 0.00% 22 32 0.00% 23 33 0.00% 24 41 0.00% 25 46 0.00% 26 41 0.00% 27 78 0.00% 28 80 0.00% 29 66 0.00% 30 73 0.00% 31 77 0.00% 32 92 0.00% 33 89 0.00% 34 94 0.00% 35 112 0.00% 36 110 0.00% 37 111 0.00% 38 102 0.00% 39 108 0.00% 40 120 0.00% 41 124 0.00% 42 134 0.00% 43 149 0.00% 44 150 0.00% 45 161 0.00% 46 164 0.00% 47 189 0.00% 48 229 0.00% 49 251 0.00% 50 264 0.00% 51 295 0.00% 52 350 0.00% 53 322 0.00% 54 374 0.00% 55 373 0.00% 56 418 0.00% 57 525 0.00% 58 635 0.00% 59 638 0.00% 60 772 0.00% 61 822 0.00% 62 974 0.00% 63 1062 0.00% 64 1082 0.00% 65 1223 0.00% 66 1313 0.00% 67 1520 0.00% 68 1648 0.00% 69 1951 0.00% 70 2255 0.01% 71 2643 0.01% 72 2927 0.01% 73 3271 0.01% 74 3505 0.01% 75 4086 0.01% 76 4540 0.01% 77 4856 0.01% 78 5486 0.01% 79 6322 0.02% 80 6866 0.02% 81 7827 0.02% 82 8869 0.02% 83 9640 0.02% 84 10605 0.03% 85 11783 0.03% 86 12671 0.03% 87 13824 0.03% 88 14776 0.04% 89 16071 0.04% 90 17727 0.04% 91 19562 0.05% 92 20997 0.05% 93 22935 0.06% 94 24461 0.06% 95 26256 0.07% 96 27899 0.07% 97 29769 0.07% 98 31274 0.08% 99 32996 0.08% 100 35129 0.09% 101 37064 0.09% 102 39487 0.10% 103 41578 0.10% 104 43154 0.11% 105 44560 0.11% 106 47606 0.12% 107 48397 0.12% 108 50219 0.12% 109 52900 0.13% 110 54525 0.14% 111 56881 0.14% 112 59314 0.15% 113 61394 0.15% 114 64212 0.16% 115 66074 0.16% 116 67501 0.17% 117 69837 0.17% 118 70970 0.18% 119 72658 0.18% 120 75167 0.19% 121 76510 0.19% 122 77593 0.19% 123 81177 0.20% 124 83145 0.21% 125 85549 0.21% 126 88228 0.22% 127 88534 0.22% 128 90009 0.22% 129 93063 0.23% 130 94314 0.23% 131 95629 0.24% 132 98821 0.25% 133 100696 0.25% 134 102373 0.25% 135 104927 0.26% 136 105359 0.26% 137 105455 0.26% 138 108017 0.27% 139 110842 0.28% 140 111278 0.28% 141 114441 0.28% 142 116221 0.29% 143 117944 0.29% 144 121525 0.30% 145 123524 0.31% 146 122711 0.30% 147 125807 0.31% 148 126400 0.31% 149 126834 0.31% 150 128982 0.32% 151 35584049 88.31% 40295038 reads passed initial QC criterion=sequence-density sequence-density=1.21 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=20 prefix-density=1.27 prefix-fanout=2.7 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.21 sequence-density-rank=28 fanout-score=18.33 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=4.1 sequence=ACTTGCCGGGGACGAAGTTGGTGGC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=17 prefix-density=1.01 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=83.02 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=2.3 sequence=CAACAACCACAAAGCAATTAAGCAAAAGCAATGGCCTCCCAGCTCTCCGCCATGGCCTCCGTGCCGCAGTTCCACGGCCTCCGGAGCTACTCGGCGCCGAGGTCATCCATGGCGATGCTGCCAACGCTTAGAGCGTCCAGGAAGAGGTCCCAGGGCATCCGGTGCGACTTCATCGGCTCCTCCACCAACCTCATCATGGTGACGACGACGA SRR7814824 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:22:29 Started mapping on | Dec 06 11:22:31 Finished on | Dec 06 11:26:58 Mapping speed, Million of reads per hour | 543.30 Number of input reads | 40295038 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 37140917 Uniquely mapped reads % | 92.17% Average mapped length | 294.54 Number of splices: Total | 34905549 Number of splices: Annotated (sjdb) | 33076309 Number of splices: GT/AG | 34416777 Number of splices: GC/AG | 411049 Number of splices: AT/AC | 9570 Number of splices: Non-canonical | 68153 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.02% Deletion average length | 3.04 Insertion rate per base | 0.02% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 678315 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 68896 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.90% % of reads unmapped: other | 1.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2475806 2475806 2475806 N_multimapping 678315 678315 678315 N_noFeature 1231839 35984403 1577574 N_ambiguous 1050427 4370 239973 UnstrandedReadsAssigned:34858651 PositiveStrandReadsAssigned:1152144 NegativeStrandReadsAssigned:35323370 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814824 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814824-trimmed-pair1.fastq SRR7814824-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,295,038 reads, 36,063,425 reads pseudoaligned [quant] estimated average fragment length: 259.012 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR7814824.ke.tsv 35125 SRR7814824.se.tsv 88098 total ==> SRR7814824.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.404 0 0 PNS24247 1044 785.988 43.9501 1.95925 PNS24249 1928 1669.99 139.552 2.92799 PNS24246 1044 785.988 43.9501 1.95925 PNS24248 1044 785.988 43.9501 1.95925 PNS24244 1471 1212.99 59.5978 1.72155 PNS24243 293 97.6118 0 0 KQK14069 1603 1344.99 508.85 13.2562 KQK14071 474 237.8 0 0 ==> SRR7814824.se.tsv <== BRADI_1g14170v3 499 BRADI_1g53295v3 981 BRADI_1g59795v3 222 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 529 BRADI_1g74790v3 284 BRADI_1g09890v3 0 BRADI_1g77505v3 515 BRADI_1g48960v3 0 SRR7814824 completed mapping pipeline successfully