Starting /dee2/code/volunteer_pipeline.sh SRR7814825 current disk space = 1551263027200 free memory = 1598862204 SRR7814825 SRAfilesize 2da22993595e71b3532ffd85da5000e0 SRR7814825.sra SRR7814825.sra file validated SRR7814825 is paired end SRR7814825 is conventional basespace SRR7814825 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814825_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.423 37.0 37.0 37.0 37.0 37.0 2 36.371 37.0 37.0 37.0 37.0 37.0 3 36.4965 37.0 37.0 37.0 37.0 37.0 4 36.53 37.0 37.0 37.0 37.0 37.0 5 36.481 37.0 37.0 37.0 37.0 37.0 6 36.582 37.0 37.0 37.0 37.0 37.0 7 36.506 37.0 37.0 37.0 37.0 37.0 8 36.512 37.0 37.0 37.0 37.0 37.0 9 36.5895 37.0 37.0 37.0 37.0 37.0 10-14 36.5441 37.0 37.0 37.0 37.0 37.0 15-19 36.50599999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.4729 37.0 37.0 37.0 37.0 37.0 25-29 36.4298 37.0 37.0 37.0 37.0 37.0 30-34 36.24730000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.167500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1654 37.0 37.0 37.0 37.0 37.0 45-49 36.2867 37.0 37.0 37.0 37.0 37.0 50-54 36.3073 37.0 37.0 37.0 37.0 37.0 55-59 36.285399999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.259 37.0 37.0 37.0 37.0 37.0 65-69 36.2033 37.0 37.0 37.0 37.0 37.0 70-74 36.0897 37.0 37.0 37.0 37.0 37.0 75-79 36.0283 37.0 37.0 37.0 37.0 37.0 80-84 36.0649 37.0 37.0 37.0 37.0 37.0 85-89 36.0811 37.0 37.0 37.0 37.0 37.0 90-94 35.943 37.0 37.0 37.0 37.0 37.0 95-99 35.6616 37.0 37.0 37.0 37.0 37.0 100-104 35.3688 37.0 37.0 37.0 32.2 37.0 105-109 35.5314 37.0 37.0 37.0 37.0 37.0 110-114 35.6203 37.0 37.0 37.0 37.0 37.0 115-119 35.47710000000001 37.0 37.0 37.0 37.0 37.0 120-124 34.8922 37.0 37.0 37.0 25.0 37.0 125-129 34.650800000000004 37.0 37.0 37.0 25.0 37.0 130-134 35.112300000000005 37.0 37.0 37.0 25.0 37.0 135-139 34.927499999999995 37.0 37.0 37.0 25.0 37.0 140-144 34.989799999999995 37.0 37.0 37.0 25.0 37.0 145-149 34.94969999999999 37.0 37.0 37.0 25.0 37.0 150-151 34.31325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 0.0 24 0.0 25 1.0 26 3.0 27 7.0 28 19.0 29 27.0 30 36.0 31 64.0 32 107.0 33 161.0 34 251.0 35 593.0 36 2560.0 37 169.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.743615423134706 10.615923885828742 6.259389083625439 37.381071607411116 2 26.775 13.15 31.075000000000003 28.999999999999996 3 22.400000000000002 17.724999999999998 23.674999999999997 36.199999999999996 4 27.500000000000004 23.775 19.425 29.299999999999997 5 28.599999999999998 27.175 21.65 22.575 6 24.55 30.675 21.25 23.525 7 20.150000000000002 22.75 37.45 19.650000000000002 8 21.45 21.325 29.45 27.775 9 21.425 19.875 31.900000000000002 26.8 10-14 24.57 25.35 23.93 26.150000000000002 15-19 24.535 24.104999999999997 24.945 26.415 20-24 25.669999999999998 23.595 23.895 26.840000000000003 25-29 24.525 24.185000000000002 24.69 26.6 30-34 24.48 25.040000000000003 23.79 26.69 35-39 24.765 23.525 25.230000000000004 26.479999999999997 40-44 24.725 23.544999999999998 24.73 27.0 45-49 25.085 23.89 24.035 26.99 50-54 24.465 23.76 24.055 27.72 55-59 25.259999999999998 24.065 23.315 27.36 60-64 25.295 23.9 24.185000000000002 26.619999999999997 65-69 25.255 23.625 23.895 27.224999999999998 70-74 25.715 23.865 23.365 27.055 75-79 24.945 23.985 23.71 27.36 80-84 25.19 24.175 24.075 26.56 85-89 25.495 23.810000000000002 23.974999999999998 26.72 90-94 25.290000000000003 23.325000000000003 24.295 27.089999999999996 95-99 26.13 23.39 23.355 27.125 100-104 25.605 23.48 23.935000000000002 26.979999999999997 105-109 26.325 23.205000000000002 24.12 26.35 110-114 26.240000000000002 24.175 23.455000000000002 26.13 115-119 26.25 23.035 23.494999999999997 27.22 120-124 26.740000000000002 23.835 23.03 26.395000000000003 125-129 25.905 24.26 22.97 26.865 130-134 25.635 23.31 23.68 27.375 135-139 25.895000000000003 23.875 23.31 26.919999999999998 140-144 25.564999999999998 23.810000000000002 23.465 27.16 145-149 25.580000000000002 23.665 24.04 26.715 150-151 25.75 23.8375 22.9375 27.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 2.0 28 1.0 29 1.0 30 2.0 31 7.0 32 13.0 33 11.5 34 17.5 35 29.5 36 36.5 37 50.0 38 67.0 39 79.5 40 96.5 41 116.0 42 130.0 43 136.0 44 156.5 45 185.5 46 189.0 47 162.5 48 140.5 49 146.5 50 143.5 51 131.5 52 128.0 53 123.0 54 106.5 55 97.0 56 106.0 57 116.5 58 100.5 59 90.5 60 97.5 61 86.0 62 76.0 63 77.5 64 83.0 65 80.0 66 78.0 67 69.0 68 63.5 69 68.0 70 60.5 71 48.0 72 40.0 73 33.0 74 24.0 75 22.0 76 20.5 77 20.5 78 14.5 79 5.0 80 5.0 81 3.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.575 #Duplication Level Percentage of deduplicated Percentage of total 1 88.93593000282247 78.77499999999999 2 9.314140558848434 16.5 3 1.6652554332486593 4.425 4 0.0846740050804403 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6000000000000001 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.6124999999999998 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.3 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.9 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.5125 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.1875 0.0 0.0 0.0 0.0 126-127 4.6125 0.0 0.0 0.0 0.0 128-129 4.975 0.0 0.0 0.0 0.0 130-131 5.4375 0.0 0.0 0.0 0.0 132-133 5.875 0.0 0.0 0.0 0.0 134-135 6.15 0.0 0.0 0.0 0.0 136-137 6.699999999999999 0.0 0.0 0.0 0.0 138-139 7.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814825 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814825_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.04 37.0 37.0 37.0 37.0 37.0 2 35.676 37.0 37.0 37.0 37.0 37.0 3 35.525 37.0 37.0 37.0 37.0 37.0 4 35.7545 37.0 37.0 37.0 37.0 37.0 5 35.7945 37.0 37.0 37.0 37.0 37.0 6 35.6835 37.0 37.0 37.0 37.0 37.0 7 35.414 37.0 37.0 37.0 37.0 37.0 8 35.5835 37.0 37.0 37.0 37.0 37.0 9 35.9215 37.0 37.0 37.0 37.0 37.0 10-14 35.7408 37.0 37.0 37.0 37.0 37.0 15-19 35.3021 37.0 37.0 37.0 34.6 37.0 20-24 35.51370000000001 37.0 37.0 37.0 37.0 37.0 25-29 35.4678 37.0 37.0 37.0 37.0 37.0 30-34 35.2615 37.0 37.0 37.0 34.6 37.0 35-39 35.178700000000006 37.0 37.0 37.0 32.2 37.0 40-44 34.893600000000006 37.0 37.0 37.0 25.0 37.0 45-49 34.878699999999995 37.0 37.0 37.0 25.0 37.0 50-54 34.3542 37.0 37.0 37.0 25.0 37.0 55-59 34.2223 37.0 37.0 37.0 25.0 37.0 60-64 34.39 37.0 37.0 37.0 25.0 37.0 65-69 34.4304 37.0 37.0 37.0 25.0 37.0 70-74 34.038399999999996 37.0 37.0 37.0 25.0 37.0 75-79 33.8141 37.0 37.0 37.0 22.2 37.0 80-84 33.7989 37.0 37.0 37.0 22.2 37.0 85-89 34.1567 37.0 37.0 37.0 25.0 37.0 90-94 33.7311 37.0 37.0 37.0 25.0 37.0 95-99 32.9019 37.0 37.0 37.0 11.0 37.0 100-104 33.1767 37.0 37.0 37.0 16.6 37.0 105-109 32.7081 37.0 37.0 37.0 13.8 37.0 110-114 33.2016 37.0 37.0 37.0 13.8 37.0 115-119 33.2441 37.0 37.0 37.0 16.6 37.0 120-124 32.3877 37.0 34.6 37.0 11.0 37.0 125-129 32.6768 37.0 37.0 37.0 11.0 37.0 130-134 32.0972 37.0 32.2 37.0 11.0 37.0 135-139 32.040499999999994 37.0 29.8 37.0 11.0 37.0 140-144 32.2347 37.0 32.2 37.0 11.0 37.0 145-149 31.9133 37.0 27.4 37.0 11.0 37.0 150-151 31.288249999999998 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 3.0 16 1.0 17 2.0 18 0.0 19 3.0 20 4.0 21 15.0 22 32.0 23 40.0 24 55.0 25 72.0 26 77.0 27 86.0 28 107.0 29 109.0 30 124.0 31 126.0 32 159.0 33 217.0 34 384.0 35 778.0 36 1563.0 37 39.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.875 18.475 8.225 34.425 2 29.65 23.325000000000003 25.474999999999998 21.55 3 23.5 25.974999999999998 25.650000000000002 24.875 4 27.575 29.549999999999997 19.625 23.25 5 28.849999999999998 31.275 17.65 22.225 6 24.4 34.449999999999996 18.224999999999998 22.925 7 24.0 19.25 31.974999999999998 24.775 8 23.549999999999997 23.25 23.025000000000002 30.175 9 24.875 22.125 25.224999999999998 27.775 10-14 27.395000000000003 24.46 21.47 26.674999999999997 15-19 27.29 24.65 21.965 26.095000000000002 20-24 26.700000000000003 24.154999999999998 22.6 26.545 25-29 27.205000000000002 24.08 22.105 26.61 30-34 26.415 24.33 22.74 26.515 35-39 26.979999999999997 24.385 22.17 26.465 40-44 27.24 24.595 21.435000000000002 26.729999999999997 45-49 27.275 24.165 22.025 26.534999999999997 50-54 26.805 24.779999999999998 22.37 26.045 55-59 27.265 24.0 22.595000000000002 26.14 60-64 26.584999999999997 24.54 22.785 26.090000000000003 65-69 27.37 23.645 23.0 25.985000000000003 70-74 27.095000000000002 24.47 22.725 25.71 75-79 26.584999999999997 24.41 22.975 26.029999999999998 80-84 27.02 24.57 21.92 26.490000000000002 85-89 27.150000000000002 24.41 22.2 26.240000000000002 90-94 27.034999999999997 25.074999999999996 22.36 25.53 95-99 27.01 25.124999999999996 22.605 25.259999999999998 100-104 26.525 25.085 22.755 25.635 105-109 26.83 25.275 22.525000000000002 25.369999999999997 110-114 26.634999999999998 25.16 22.314999999999998 25.89 115-119 27.644999999999996 24.66 22.145 25.55 120-124 27.325 25.6 22.115000000000002 24.959999999999997 125-129 26.99 25.669999999999998 22.775000000000002 24.565 130-134 27.450000000000003 25.779999999999998 22.439999999999998 24.33 135-139 27.450000000000003 26.465 22.285 23.799999999999997 140-144 28.415000000000003 26.029999999999998 22.225 23.330000000000002 145-149 28.605000000000004 26.615 21.51 23.27 150-151 27.962500000000002 25.7875 22.325 23.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 1.5 22 1.5 23 2.5 24 2.0 25 2.5 26 2.5 27 2.0 28 4.5 29 7.5 30 8.0 31 7.5 32 11.5 33 16.0 34 23.0 35 31.0 36 41.0 37 52.0 38 56.0 39 68.5 40 94.5 41 112.0 42 111.0 43 132.5 44 144.5 45 127.5 46 126.5 47 143.0 48 139.5 49 145.5 50 140.5 51 113.5 52 107.5 53 102.5 54 106.0 55 105.5 56 96.0 57 97.0 58 111.0 59 113.5 60 108.0 61 107.5 62 108.5 63 100.5 64 94.0 65 91.5 66 83.0 67 77.0 68 76.0 69 64.5 70 58.0 71 61.5 72 49.5 73 41.0 74 35.0 75 33.0 76 30.5 77 16.5 78 10.0 79 7.5 80 5.0 81 4.5 82 3.5 83 2.0 84 2.0 85 1.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.5 91 0.5 92 1.0 93 1.5 94 0.5 95 0.0 96 0.0 97 0.5 98 1.0 99 2.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.52514587385386 81.45 2 8.141150319533203 14.649999999999999 3 1.1114198388441234 3.0 4 0.13892747985551543 0.5 5 0.05557099194220616 0.25 6 0.02778549597110308 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit CAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.4249999999999998 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.6 0.0 0.0 0.0 0.0 118-119 2.9000000000000004 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.7125000000000004 0.0 0.0 0.0 0.0 126-127 4.1375 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.887499999999999 0.0 0.0 0.0 0.0 132-133 5.3125 0.0 0.0 0.0 0.0 134-135 5.612500000000001 0.0 0.0 0.0 0.0 136-137 6.0375 0.0 0.0 0.0 0.0 138-139 6.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGAAGC 10 0.006830828 145.0 6 >>END_MODULE Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra Read 1414946 spots for SRR7814825.sra Written 1414946 spots for SRR7814825.sra Read 1414940 spots for SRR7814825.sra Written 1414940 spots for SRR7814825.sra SRR ids: ['SRR7814825.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rlzeklts SRR7814825.sra spots: 28298806 blocks: [[1, 1414940], [1414941, 2829880], [2829881, 4244820], [4244821, 5659760], [5659761, 7074700], [7074701, 8489640], [8489641, 9904580], [9904581, 11319520], [11319521, 12734460], [12734461, 14149400], [14149401, 15564340], [15564341, 16979280], [16979281, 18394220], [18394221, 19809160], [19809161, 21224100], [21224101, 22639040], [22639041, 24053980], [24053981, 25468920], [25468921, 26883860], [26883861, 28298806]] SRR7814825 file size 9567836 SRR7814825 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814825 SRR7814825_1.fastq SRR7814825_2.fastq Input file: SRR7814825_1.fastq Paired file: SRR7814825_2.fastq trimmed: SRR7814825-trimmed-pair1.fastq, SRR7814825-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:27:01 2024 >> started Fri Dec 6 11:27:30 2024 >> done (29.757s) 28298806 read pairs processed; of these: 135 ( 0.00%) short read pairs filtered out after trimming by size control 8556 ( 0.03%) empty read pairs filtered out after trimming by size control 28290115 (99.97%) read pairs available; of these: 2734902 ( 9.67%) trimmed read pairs available after processing 25555213 (90.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 8 0.00% 20 12 0.00% 21 12 0.00% 22 27 0.00% 23 24 0.00% 24 16 0.00% 25 35 0.00% 26 30 0.00% 27 37 0.00% 28 52 0.00% 29 37 0.00% 30 36 0.00% 31 28 0.00% 32 56 0.00% 33 50 0.00% 34 52 0.00% 35 65 0.00% 36 49 0.00% 37 65 0.00% 38 66 0.00% 39 86 0.00% 40 56 0.00% 41 64 0.00% 42 74 0.00% 43 79 0.00% 44 78 0.00% 45 93 0.00% 46 109 0.00% 47 112 0.00% 48 103 0.00% 49 132 0.00% 50 180 0.00% 51 164 0.00% 52 170 0.00% 53 183 0.00% 54 172 0.00% 55 202 0.00% 56 216 0.00% 57 243 0.00% 58 303 0.00% 59 337 0.00% 60 408 0.00% 61 432 0.00% 62 508 0.00% 63 544 0.00% 64 637 0.00% 65 641 0.00% 66 640 0.00% 67 738 0.00% 68 915 0.00% 69 1064 0.00% 70 1150 0.00% 71 1296 0.00% 72 1569 0.01% 73 1667 0.01% 74 2029 0.01% 75 2077 0.01% 76 2426 0.01% 77 2600 0.01% 78 2914 0.01% 79 3265 0.01% 80 3638 0.01% 81 4080 0.01% 82 4814 0.02% 83 5408 0.02% 84 5877 0.02% 85 6286 0.02% 86 7038 0.02% 87 7577 0.03% 88 8298 0.03% 89 8889 0.03% 90 9805 0.03% 91 10860 0.04% 92 11702 0.04% 93 12752 0.05% 94 13547 0.05% 95 14688 0.05% 96 15516 0.05% 97 16840 0.06% 98 17406 0.06% 99 18065 0.06% 100 19510 0.07% 101 20690 0.07% 102 21666 0.08% 103 22989 0.08% 104 24352 0.09% 105 24945 0.09% 106 26457 0.09% 107 28008 0.10% 108 28938 0.10% 109 29884 0.11% 110 30474 0.11% 111 31788 0.11% 112 33437 0.12% 113 34567 0.12% 114 36074 0.13% 115 37570 0.13% 116 38628 0.14% 117 40185 0.14% 118 41000 0.14% 119 41659 0.15% 120 42896 0.15% 121 43809 0.15% 122 45030 0.16% 123 46649 0.16% 124 47909 0.17% 125 49266 0.17% 126 51230 0.18% 127 52318 0.18% 128 53005 0.19% 129 54130 0.19% 130 54818 0.19% 131 55820 0.20% 132 57439 0.20% 133 58576 0.21% 134 60364 0.21% 135 61381 0.22% 136 62516 0.22% 137 63408 0.22% 138 63947 0.23% 139 65691 0.23% 140 66010 0.23% 141 67458 0.24% 142 69924 0.25% 143 70108 0.25% 144 71824 0.25% 145 72966 0.26% 146 73571 0.26% 147 75121 0.27% 148 76554 0.27% 149 75972 0.27% 150 77842 0.28% 151 25555213 90.33% 28290115 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=10 prefix-density=0.90 prefix-fanout=3.3 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.15 sequence-density-rank=30 fanout-score=18.07 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=4.7 sequence=ACTTGCCGGGGACGAAGTTGGTGGC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.90 fanout-score-rank=12 prefix-density=0.72 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.22 sequence-density-rank=17 fanout-score=33.82 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=11.3 sequence=CAAGAAGAAGGT SRR7814825 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:28:19 Started mapping on | Dec 06 11:28:19 Finished on | Dec 06 11:31:37 Mapping speed, Million of reads per hour | 514.37 Number of input reads | 28290115 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 26201854 Uniquely mapped reads % | 92.62% Average mapped length | 295.51 Number of splices: Total | 25382626 Number of splices: Annotated (sjdb) | 23976468 Number of splices: GT/AG | 25031155 Number of splices: GC/AG | 288165 Number of splices: AT/AC | 8408 Number of splices: Non-canonical | 54898 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.02% Deletion average length | 3.08 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 690027 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 58887 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.25% % of reads unmapped: other | 1.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1398234 1398234 1398234 N_multimapping 690027 690027 690027 N_noFeature 1056547 25460767 1266523 N_ambiguous 657547 3216 127179 UnstrandedReadsAssigned:24487760 PositiveStrandReadsAssigned:737871 NegativeStrandReadsAssigned:24808152 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814825 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814825-trimmed-pair1.fastq SRR7814825-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,290,115 reads, 25,282,738 reads pseudoaligned [quant] estimated average fragment length: 271.299 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52973 SRR7814825.ke.tsv 35125 SRR7814825.se.tsv 88098 total ==> SRR7814825.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.099 8.84874e-08 6.65584e-09 PNS24247 1044 773.701 46.4437 3.00755 PNS24249 1928 1657.7 176.006 5.31962 PNS24246 1044 773.701 46.4437 3.00755 PNS24248 1044 773.701 46.4437 3.00755 PNS24244 1471 1200.7 105.663 4.40908 PNS24243 293 94.4337 2 1.06112 KQK14069 1603 1332.7 23915.2 899.084 KQK14071 474 228.392 495.784 108.761 ==> SRR7814825.se.tsv <== BRADI_1g14170v3 26433 BRADI_1g53295v3 2438 BRADI_1g59795v3 161 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 1394 BRADI_1g74790v3 883 BRADI_1g09890v3 13 BRADI_1g77505v3 368 BRADI_1g48960v3 0 SRR7814825 completed mapping pipeline successfully