Starting /dee2/code/volunteer_pipeline.sh SRR7814826 current disk space = 1551402385408 free memory = 1355407664 SRR7814826 SRAfilesize cf865ad56cbb1b1ca99c4067d1af7d5c SRR7814826.sra SRR7814826.sra file validated SRR7814826 is paired end SRR7814826 is conventional basespace SRR7814826 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814826_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.29425 37.0 37.0 37.0 37.0 37.0 2 36.3865 37.0 37.0 37.0 37.0 37.0 3 36.498 37.0 37.0 37.0 37.0 37.0 4 36.535 37.0 37.0 37.0 37.0 37.0 5 36.507 37.0 37.0 37.0 37.0 37.0 6 36.5385 37.0 37.0 37.0 37.0 37.0 7 36.454 37.0 37.0 37.0 37.0 37.0 8 36.5305 37.0 37.0 37.0 37.0 37.0 9 36.5905 37.0 37.0 37.0 37.0 37.0 10-14 36.512100000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.53929999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.476 37.0 37.0 37.0 37.0 37.0 25-29 36.406600000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.258799999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.195100000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1724 37.0 37.0 37.0 37.0 37.0 45-49 36.2802 37.0 37.0 37.0 37.0 37.0 50-54 36.29709999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.2712 37.0 37.0 37.0 37.0 37.0 60-64 36.257999999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.233000000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0809 37.0 37.0 37.0 37.0 37.0 75-79 36.049600000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.044 37.0 37.0 37.0 37.0 37.0 85-89 36.0524 37.0 37.0 37.0 37.0 37.0 90-94 35.9711 37.0 37.0 37.0 37.0 37.0 95-99 35.67399999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.43149999999999 37.0 37.0 37.0 32.2 37.0 105-109 35.5014 37.0 37.0 37.0 37.0 37.0 110-114 35.627 37.0 37.0 37.0 37.0 37.0 115-119 35.466699999999996 37.0 37.0 37.0 37.0 37.0 120-124 34.9096 37.0 37.0 37.0 25.0 37.0 125-129 34.6314 37.0 37.0 37.0 25.0 37.0 130-134 35.174 37.0 37.0 37.0 27.4 37.0 135-139 35.029399999999995 37.0 37.0 37.0 25.0 37.0 140-144 35.059 37.0 37.0 37.0 27.4 37.0 145-149 34.9905 37.0 37.0 37.0 27.4 37.0 150-151 34.2815 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 2.0 25 1.0 26 8.0 27 7.0 28 15.0 29 30.0 30 45.0 31 59.0 32 83.0 33 157.0 34 251.0 35 562.0 36 2587.0 37 190.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.90328238536708 10.348283638185919 5.286895514908544 38.46153846153847 2 25.3 13.900000000000002 32.574999999999996 28.225 3 20.5 19.25 22.900000000000002 37.35 4 28.249999999999996 24.15 18.975 28.625 5 26.625 30.775000000000002 21.675 20.925 6 24.05 31.474999999999998 22.075 22.400000000000002 7 19.625 22.3 38.775 19.3 8 20.45 21.725 30.125 27.700000000000003 9 20.7 21.45 31.0 26.85 10-14 24.245 25.919999999999998 23.375 26.46 15-19 24.03 24.4 25.014999999999997 26.555 20-24 24.095 24.575 24.535 26.795 25-29 24.695 24.16 24.115000000000002 27.029999999999998 30-34 24.8 24.445 24.08 26.674999999999997 35-39 24.560000000000002 24.560000000000002 24.545 26.334999999999997 40-44 25.035 23.815 24.64 26.51 45-49 24.2 25.14 23.73 26.93 50-54 24.6 24.375 24.075 26.950000000000003 55-59 25.180000000000003 24.990000000000002 23.580000000000002 26.25 60-64 25.16 23.75 24.04 27.05 65-69 25.09 24.385 23.885 26.640000000000004 70-74 25.305 24.01 23.77 26.915 75-79 24.805 23.955000000000002 23.825 27.415 80-84 24.959999999999997 23.455000000000002 24.135 27.450000000000003 85-89 25.330000000000002 23.555 23.380000000000003 27.735 90-94 25.380000000000003 24.01 24.060000000000002 26.55 95-99 25.215 23.345 24.445 26.995 100-104 25.44 23.885 23.78 26.895000000000003 105-109 25.540000000000003 23.87 24.099999999999998 26.490000000000002 110-114 24.95 23.935000000000002 23.919999999999998 27.195000000000004 115-119 25.285000000000004 23.355 24.695 26.665 120-124 25.679999999999996 23.405 23.93 26.985 125-129 25.52 24.14 23.79 26.55 130-134 25.564999999999998 24.035 23.765 26.634999999999998 135-139 25.85 24.125 23.395 26.63 140-144 25.515 24.43 22.91 27.145000000000003 145-149 25.525 23.66 23.525 27.29 150-151 26.55 23.525 23.5375 26.387500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 3.0 29 3.0 30 7.5 31 12.5 32 12.0 33 17.0 34 29.5 35 38.5 36 49.0 37 58.0 38 67.0 39 78.0 40 105.5 41 130.5 42 134.5 43 145.0 44 164.5 45 160.5 46 158.0 47 178.5 48 174.5 49 153.0 50 134.0 51 127.0 52 130.5 53 113.5 54 95.5 55 86.0 56 80.5 57 90.0 58 102.0 59 98.0 60 90.0 61 93.5 62 77.0 63 67.0 64 76.0 65 77.5 66 70.5 67 69.0 68 66.0 69 53.5 70 53.0 71 47.5 72 39.5 73 45.0 74 43.0 75 28.0 76 17.5 77 15.5 78 10.5 79 6.0 80 4.5 81 3.0 82 1.5 83 3.0 84 2.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.125 #Duplication Level Percentage of deduplicated Percentage of total 1 91.24828532235941 83.15 2 7.84636488340192 14.299999999999999 3 0.823045267489712 2.25 4 0.0823045267489712 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 4.05 0.0 0.0 0.0 0.0 126-127 4.5125 0.0 0.0 0.0 0.0 128-129 5.0875 0.0 0.0 0.0 0.0 130-131 5.6125 0.0 0.0 0.0 0.0 132-133 6.0625 0.0 0.0 0.0 0.0 134-135 6.3375 0.0 0.0 0.0 0.0 136-137 6.762499999999999 0.0 0.0 0.0 0.0 138-139 7.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTGTT 10 0.006830828 145.0 1 >>END_MODULE SRR7814826 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814826_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.188 37.0 37.0 37.0 37.0 37.0 2 35.878 37.0 37.0 37.0 37.0 37.0 3 35.782 37.0 37.0 37.0 37.0 37.0 4 35.9475 37.0 37.0 37.0 37.0 37.0 5 35.873 37.0 37.0 37.0 37.0 37.0 6 35.8375 37.0 37.0 37.0 37.0 37.0 7 35.657 37.0 37.0 37.0 37.0 37.0 8 35.691 37.0 37.0 37.0 37.0 37.0 9 36.048 37.0 37.0 37.0 37.0 37.0 10-14 35.96469999999999 37.0 37.0 37.0 37.0 37.0 15-19 35.4657 37.0 37.0 37.0 37.0 37.0 20-24 35.684 37.0 37.0 37.0 37.0 37.0 25-29 35.643 37.0 37.0 37.0 37.0 37.0 30-34 35.3571 37.0 37.0 37.0 34.6 37.0 35-39 35.3374 37.0 37.0 37.0 34.6 37.0 40-44 34.9956 37.0 37.0 37.0 27.4 37.0 45-49 35.1535 37.0 37.0 37.0 27.4 37.0 50-54 34.5244 37.0 37.0 37.0 25.0 37.0 55-59 34.3516 37.0 37.0 37.0 25.0 37.0 60-64 34.69879999999999 37.0 37.0 37.0 25.0 37.0 65-69 34.563900000000004 37.0 37.0 37.0 25.0 37.0 70-74 34.2455 37.0 37.0 37.0 25.0 37.0 75-79 34.0353 37.0 37.0 37.0 22.2 37.0 80-84 33.9433 37.0 37.0 37.0 25.0 37.0 85-89 34.2885 37.0 37.0 37.0 25.0 37.0 90-94 33.8518 37.0 37.0 37.0 25.0 37.0 95-99 32.8826 37.0 37.0 37.0 11.0 37.0 100-104 33.218 37.0 37.0 37.0 16.6 37.0 105-109 32.818799999999996 37.0 37.0 37.0 13.8 37.0 110-114 33.11399999999999 37.0 37.0 37.0 16.6 37.0 115-119 33.2106 37.0 37.0 37.0 19.4 37.0 120-124 32.5129 37.0 37.0 37.0 11.0 37.0 125-129 32.6726 37.0 37.0 37.0 11.0 37.0 130-134 32.29 37.0 34.6 37.0 11.0 37.0 135-139 32.2534 37.0 32.2 37.0 11.0 37.0 140-144 32.4021 37.0 37.0 37.0 11.0 37.0 145-149 32.076 37.0 29.8 37.0 11.0 37.0 150-151 31.555749999999996 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 2.0 17 1.0 18 2.0 19 3.0 20 3.0 21 10.0 22 7.0 23 34.0 24 47.0 25 54.0 26 73.0 27 98.0 28 104.0 29 119.0 30 131.0 31 158.0 32 167.0 33 231.0 34 393.0 35 695.0 36 1626.0 37 39.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.900000000000006 16.625 8.85 34.625 2 29.825000000000003 22.7 27.200000000000003 20.275000000000002 3 23.599999999999998 24.7 26.5 25.2 4 27.125 29.4 18.325 25.15 5 27.474999999999998 32.0 18.4 22.125 6 23.35 34.599999999999994 19.125 22.925 7 23.200000000000003 19.6 31.75 25.45 8 23.825 20.95 23.7 31.525 9 25.025 20.225 27.224999999999998 27.525 10-14 26.810000000000002 24.725 21.575 26.889999999999997 15-19 26.51 24.555 22.625 26.31 20-24 26.465 25.009999999999998 22.395 26.13 25-29 27.04 23.98 22.91 26.07 30-34 26.400000000000002 24.33 22.925 26.345000000000002 35-39 26.115 24.33 23.06 26.495 40-44 26.924999999999997 24.38 22.845 25.85 45-49 27.11 24.095 22.535 26.26 50-54 26.32 24.81 23.064999999999998 25.805 55-59 27.3 24.63 22.285 25.785000000000004 60-64 27.04 24.545 22.535 25.88 65-69 26.650000000000002 24.205 23.169999999999998 25.974999999999998 70-74 26.8 23.880000000000003 23.18 26.14 75-79 26.745 24.57 23.035 25.650000000000002 80-84 26.174999999999997 25.169999999999998 22.52 26.135 85-89 27.405 24.169999999999998 22.509999999999998 25.915 90-94 26.71 24.725 22.535 26.029999999999998 95-99 26.31 25.785000000000004 22.625 25.28 100-104 27.115000000000002 24.745 22.495 25.645 105-109 26.179999999999996 25.585 23.355 24.88 110-114 26.450000000000003 25.71 22.235 25.605 115-119 26.945000000000004 25.264999999999997 22.85 24.94 120-124 26.915 25.555 22.805 24.725 125-129 27.47 25.145 22.64 24.745 130-134 27.145000000000003 25.36 23.105 24.39 135-139 27.565 26.265 22.32 23.849999999999998 140-144 27.060000000000002 26.32 22.759999999999998 23.86 145-149 28.16 26.240000000000002 22.59 23.01 150-151 27.675 25.8625 23.3375 23.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 3.0 26 2.0 27 1.5 28 6.0 29 8.0 30 8.5 31 12.5 32 16.5 33 15.5 34 19.0 35 31.5 36 42.0 37 53.0 38 65.0 39 82.0 40 105.0 41 115.5 42 124.0 43 137.0 44 147.5 45 156.0 46 150.0 47 137.5 48 128.0 49 121.0 50 127.0 51 133.0 52 109.5 53 85.5 54 94.5 55 101.5 56 86.0 57 89.5 58 100.0 59 102.5 60 103.5 61 97.0 62 98.5 63 101.5 64 94.5 65 84.0 66 87.0 67 82.5 68 64.0 69 77.0 70 80.0 71 66.0 72 59.5 73 44.0 74 35.5 75 30.5 76 20.5 77 11.5 78 13.0 79 9.5 80 2.5 81 3.5 82 3.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 1.0 99 1.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.725 #Duplication Level Percentage of deduplicated Percentage of total 1 91.9869174161897 84.375 2 7.086399563913873 13.0 3 0.8449168710820387 2.325 4 0.08176614881439084 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.025 72-73 0.05 0.0 0.0 0.0 0.025 74-75 0.05 0.0 0.0 0.0 0.025 76-77 0.0625 0.0 0.0 0.0 0.025 78-79 0.075 0.0 0.0 0.0 0.025 80-81 0.075 0.0 0.0 0.0 0.025 82-83 0.1 0.0 0.0 0.0 0.025 84-85 0.1125 0.0 0.0 0.0 0.025 86-87 0.125 0.0 0.0 0.0 0.025 88-89 0.175 0.0 0.0 0.0 0.025 90-91 0.25 0.0 0.0 0.0 0.025 92-93 0.3125 0.0 0.0 0.0 0.025 94-95 0.4625 0.0 0.0 0.0 0.025 96-97 0.5874999999999999 0.0 0.0 0.0 0.025 98-99 0.675 0.0 0.0 0.0 0.025 100-101 0.825 0.0 0.0 0.0 0.025 102-103 0.9375 0.0 0.0 0.0 0.025 104-105 1.0125 0.0 0.0 0.0 0.025 106-107 1.15 0.0 0.0 0.0 0.025 108-109 1.3125 0.0 0.0 0.0 0.025 110-111 1.4625 0.0 0.0 0.0 0.025 112-113 1.6625 0.0 0.0 0.0 0.025 114-115 2.0999999999999996 0.0 0.0 0.0 0.025 116-117 2.4375 0.0 0.0 0.0 0.025 118-119 2.7125 0.0 0.0 0.0 0.025 120-121 2.9375 0.0 0.0 0.0 0.025 122-123 3.2375 0.0 0.0 0.0 0.025 124-125 3.6375 0.0 0.0 0.0 0.025 126-127 4.05 0.0 0.0 0.0 0.025 128-129 4.5625 0.0 0.0 0.0 0.025 130-131 4.9375 0.0 0.0 0.0 0.025 132-133 5.3125 0.0 0.0 0.0 0.025 134-135 5.550000000000001 0.0 0.0 0.0 0.025 136-137 5.862500000000001 0.0 0.0 0.0 0.025 138-139 6.2125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 55 0.0025160722 15.818182 130-134 >>END_MODULE Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra Read 1574525 spots for SRR7814826.sra Written 1574525 spots for SRR7814826.sra SRR ids: ['SRR7814826.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tu5yub4m SRR7814826.sra spots: 31490500 blocks: [[1, 1574525], [1574526, 3149050], [3149051, 4723575], [4723576, 6298100], [6298101, 7872625], [7872626, 9447150], [9447151, 11021675], [11021676, 12596200], [12596201, 14170725], [14170726, 15745250], [15745251, 17319775], [17319776, 18894300], [18894301, 20468825], [20468826, 22043350], [22043351, 23617875], [23617876, 25192400], [25192401, 26766925], [26766926, 28341450], [28341451, 29915975], [29915976, 31490500]] SRR7814826 file size 10649396 SRR7814826 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814826 SRR7814826_1.fastq SRR7814826_2.fastq Input file: SRR7814826_1.fastq Paired file: SRR7814826_2.fastq trimmed: SRR7814826-trimmed-pair1.fastq, SRR7814826-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:30:33 2024 >> started Fri Dec 6 11:31:13 2024 >> done (39.212s) 31490500 read pairs processed; of these: 142 ( 0.00%) short read pairs filtered out after trimming by size control 4559 ( 0.01%) empty read pairs filtered out after trimming by size control 31485799 (99.99%) read pairs available; of these: 3328318 (10.57%) trimmed read pairs available after processing 28157481 (89.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 16 0.00% 20 19 0.00% 21 23 0.00% 22 27 0.00% 23 27 0.00% 24 36 0.00% 25 27 0.00% 26 28 0.00% 27 43 0.00% 28 36 0.00% 29 39 0.00% 30 40 0.00% 31 48 0.00% 32 57 0.00% 33 50 0.00% 34 53 0.00% 35 57 0.00% 36 49 0.00% 37 82 0.00% 38 68 0.00% 39 70 0.00% 40 77 0.00% 41 89 0.00% 42 99 0.00% 43 92 0.00% 44 95 0.00% 45 108 0.00% 46 128 0.00% 47 139 0.00% 48 128 0.00% 49 153 0.00% 50 148 0.00% 51 174 0.00% 52 181 0.00% 53 198 0.00% 54 214 0.00% 55 225 0.00% 56 246 0.00% 57 286 0.00% 58 375 0.00% 59 362 0.00% 60 474 0.00% 61 522 0.00% 62 552 0.00% 63 529 0.00% 64 662 0.00% 65 718 0.00% 66 775 0.00% 67 904 0.00% 68 994 0.00% 69 1097 0.00% 70 1353 0.00% 71 1560 0.00% 72 1745 0.01% 73 2039 0.01% 74 2260 0.01% 75 2307 0.01% 76 2752 0.01% 77 3093 0.01% 78 3323 0.01% 79 3943 0.01% 80 4171 0.01% 81 4804 0.02% 82 5504 0.02% 83 6090 0.02% 84 6822 0.02% 85 7385 0.02% 86 7990 0.03% 87 8727 0.03% 88 9695 0.03% 89 10215 0.03% 90 11249 0.04% 91 12491 0.04% 92 13469 0.04% 93 14746 0.05% 94 16292 0.05% 95 17348 0.06% 96 18587 0.06% 97 19529 0.06% 98 20839 0.07% 99 21667 0.07% 100 23571 0.07% 101 24836 0.08% 102 26524 0.08% 103 28156 0.09% 104 29346 0.09% 105 30651 0.10% 106 32780 0.10% 107 33862 0.11% 108 34796 0.11% 109 36595 0.12% 110 37746 0.12% 111 38830 0.12% 112 41046 0.13% 113 42853 0.14% 114 44613 0.14% 115 47273 0.15% 116 48176 0.15% 117 49172 0.16% 118 49519 0.16% 119 50667 0.16% 120 52592 0.17% 121 53643 0.17% 122 55015 0.17% 123 57781 0.18% 124 59164 0.19% 125 61372 0.19% 126 62837 0.20% 127 64490 0.20% 128 64071 0.20% 129 65702 0.21% 130 67091 0.21% 131 68498 0.22% 132 71027 0.23% 133 71986 0.23% 134 73903 0.23% 135 75503 0.24% 136 76399 0.24% 137 77460 0.25% 138 76864 0.24% 139 80160 0.25% 140 80541 0.26% 141 81683 0.26% 142 84458 0.27% 143 85430 0.27% 144 86880 0.28% 145 89608 0.28% 146 89223 0.28% 147 91515 0.29% 148 92189 0.29% 149 92336 0.29% 150 94232 0.30% 151 28157481 89.43% 31485799 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=11 prefix-density=0.86 prefix-fanout=3.3 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.24 sequence-density-rank=27 fanout-score=13.49 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=4.3 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.97 fanout-score-rank=9 prefix-density=0.71 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.19 sequence-density-rank=28 fanout-score=12.36 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=4.3 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC SRR7814826 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:32:26 Started mapping on | Dec 06 11:32:26 Finished on | Dec 06 11:37:06 Mapping speed, Million of reads per hour | 404.82 Number of input reads | 31485799 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 29239939 Uniquely mapped reads % | 92.87% Average mapped length | 295.14 Number of splices: Total | 25982431 Number of splices: Annotated (sjdb) | 24529232 Number of splices: GT/AG | 25620601 Number of splices: GC/AG | 285270 Number of splices: AT/AC | 12627 Number of splices: Non-canonical | 63933 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.03% Insertion average length | 2.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 537140 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 42983 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.40% % of reads unmapped: other | 0.89% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1708720 1708720 1708720 N_multimapping 537140 537140 537140 N_noFeature 1022757 28355157 1325210 N_ambiguous 726059 3603 144931 UnstrandedReadsAssigned:27491123 PositiveStrandReadsAssigned:881179 NegativeStrandReadsAssigned:27769798 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814826 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814826-trimmed-pair1.fastq SRR7814826-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,485,799 reads, 28,151,851 reads pseudoaligned [quant] estimated average fragment length: 263.39 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52973 SRR7814826.ke.tsv 35125 SRR7814826.se.tsv 88098 total ==> SRR7814826.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 674.148 0 0 PNS24247 1044 781.61 69.1691 4.10268 PNS24249 1928 1665.61 143.219 3.98632 PNS24246 1044 781.61 69.1691 4.10268 PNS24248 1044 781.61 69.1691 4.10268 PNS24244 1471 1208.61 53.2737 2.04349 PNS24243 293 95.4394 0 0 KQK14069 1603 1340.61 11604.1 401.285 KQK14071 474 233.954 75.7863 15.0178 ==> SRR7814826.se.tsv <== BRADI_1g14170v3 11901 BRADI_1g53295v3 3640 BRADI_1g59795v3 68 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 1180 BRADI_1g74790v3 337 BRADI_1g09890v3 24 BRADI_1g77505v3 341 BRADI_1g48960v3 0 SRR7814826 completed mapping pipeline successfully