Starting /dee2/code/volunteer_pipeline.sh SRR7814827 current disk space = 1551486652416 free memory = 1599162416 SRR7814827 SRAfilesize 0c594663bcd0001121057b84f6a9a0c1 SRR7814827.sra SRR7814827.sra file validated SRR7814827 is paired end SRR7814827 is conventional basespace SRR7814827 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814827_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.37175 37.0 37.0 37.0 37.0 37.0 2 36.2185 37.0 37.0 37.0 37.0 37.0 3 36.4545 37.0 37.0 37.0 37.0 37.0 4 36.4735 37.0 37.0 37.0 37.0 37.0 5 36.423 37.0 37.0 37.0 37.0 37.0 6 36.449 37.0 37.0 37.0 37.0 37.0 7 36.5405 37.0 37.0 37.0 37.0 37.0 8 36.524 37.0 37.0 37.0 37.0 37.0 9 36.5565 37.0 37.0 37.0 37.0 37.0 10-14 36.5384 37.0 37.0 37.0 37.0 37.0 15-19 36.5353 37.0 37.0 37.0 37.0 37.0 20-24 36.4745 37.0 37.0 37.0 37.0 37.0 25-29 36.428999999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.384899999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.377500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.326699999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.326800000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.261700000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.2231 37.0 37.0 37.0 37.0 37.0 60-64 36.23350000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2125 37.0 37.0 37.0 37.0 37.0 70-74 36.1408 37.0 37.0 37.0 37.0 37.0 75-79 36.1503 37.0 37.0 37.0 37.0 37.0 80-84 36.095600000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.0349 37.0 37.0 37.0 37.0 37.0 90-94 35.9551 37.0 37.0 37.0 37.0 37.0 95-99 35.9121 37.0 37.0 37.0 37.0 37.0 100-104 35.8918 37.0 37.0 37.0 37.0 37.0 105-109 35.9531 37.0 37.0 37.0 37.0 37.0 110-114 35.895500000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.753600000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.7531 37.0 37.0 37.0 37.0 37.0 125-129 35.61030000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.5162 37.0 37.0 37.0 37.0 37.0 135-139 35.3874 37.0 37.0 37.0 37.0 37.0 140-144 35.3554 37.0 37.0 37.0 37.0 37.0 145-149 35.207100000000004 37.0 37.0 37.0 27.4 37.0 150-151 34.604 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 3.0 24 3.0 25 5.0 26 9.0 27 15.0 28 15.0 29 28.0 30 36.0 31 52.0 32 78.0 33 102.0 34 153.0 35 371.0 36 2850.0 37 279.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 56.001002255073914 11.525933350037585 3.4577800050112755 29.015284389877223 2 24.725 13.25 32.475 29.549999999999997 3 20.45 20.05 24.375 35.125 4 27.400000000000002 26.775 20.05 25.775 5 27.075 31.65 20.674999999999997 20.599999999999998 6 21.575 33.4 21.95 23.075000000000003 7 17.825 23.75 39.300000000000004 19.125 8 19.0 23.599999999999998 29.7 27.700000000000003 9 21.375 19.3 31.825 27.500000000000004 10-14 24.07 26.32 24.455 25.155 15-19 23.835 24.955 25.44 25.77 20-24 23.955000000000002 26.14 24.335 25.569999999999997 25-29 23.54 25.540000000000003 24.43 26.490000000000002 30-34 24.085 25.245 24.615000000000002 26.055 35-39 23.51 25.44 24.645 26.405 40-44 23.835 25.44 25.035 25.69 45-49 23.94 25.264999999999997 24.765 26.029999999999998 50-54 23.669999999999998 25.445 25.330000000000002 25.555 55-59 24.495 25.580000000000002 24.165 25.759999999999998 60-64 23.794999999999998 25.174999999999997 24.654999999999998 26.375 65-69 24.185000000000002 25.105 24.895 25.814999999999998 70-74 24.135 25.069999999999997 24.89 25.905 75-79 23.96 25.569999999999997 24.55 25.919999999999998 80-84 24.175 25.22 24.265 26.340000000000003 85-89 24.235 25.124999999999996 24.43 26.21 90-94 24.63 25.205 23.94 26.224999999999998 95-99 24.19 24.805 24.58 26.424999999999997 100-104 24.125 25.130000000000003 24.38 26.365 105-109 24.224999999999998 25.31 24.295 26.169999999999998 110-114 24.25 25.36 24.279999999999998 26.11 115-119 24.275 25.69 24.0 26.035000000000004 120-124 24.77 24.275 24.255 26.700000000000003 125-129 24.84 25.074999999999996 23.494999999999997 26.590000000000003 130-134 25.165 25.2 23.630000000000003 26.005 135-139 24.0 25.36 24.325 26.314999999999998 140-144 24.29 24.85 23.79 27.07 145-149 24.349999999999998 25.4 23.305 26.945000000000004 150-151 23.6625 25.825 23.4875 27.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 2.0 28 3.0 29 5.5 30 10.0 31 10.0 32 12.5 33 20.5 34 24.5 35 24.5 36 38.5 37 63.5 38 85.5 39 103.0 40 110.0 41 125.0 42 156.5 43 167.0 44 172.5 45 176.0 46 192.0 47 207.0 48 184.5 49 160.5 50 162.5 51 160.0 52 141.0 53 126.0 54 117.0 55 117.0 56 110.5 57 95.5 58 77.5 59 78.5 60 75.5 61 64.0 62 59.0 63 56.5 64 54.0 65 48.0 66 50.0 67 53.5 68 54.0 69 52.0 70 44.0 71 34.5 72 24.5 73 16.0 74 16.5 75 15.0 76 8.0 77 8.5 78 8.5 79 5.0 80 3.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.09057495405618 90.55 2 4.804410606458388 9.15 3 0.10501443948542925 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.9 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.5625 0.0 0.0 0.0 0.0 98-99 1.6375 0.0 0.0 0.0 0.0 100-101 1.9125 0.0 0.0 0.0 0.0 102-103 2.2125 0.0 0.0 0.0 0.0 104-105 2.5 0.0 0.0 0.0 0.0 106-107 2.7875 0.0 0.0 0.0 0.0 108-109 2.9875 0.0 0.0 0.0 0.0 110-111 3.35 0.0 0.0 0.0 0.0 112-113 3.8375 0.0 0.0 0.0 0.0 114-115 4.4375 0.0 0.0 0.0 0.0 116-117 4.9625 0.0 0.0 0.0 0.0 118-119 5.512499999999999 0.0 0.0 0.0 0.0 120-121 6.125 0.0 0.0 0.0 0.0 122-123 6.5125 0.0 0.0 0.0 0.0 124-125 7.125 0.0 0.0 0.0 0.0 126-127 7.6 0.0 0.0 0.0 0.0 128-129 8.0375 0.0 0.0 0.0 0.0 130-131 8.7375 0.0 0.0 0.0 0.0 132-133 9.4875 0.0 0.0 0.0 0.0 134-135 9.8875 0.0 0.0 0.0 0.0 136-137 10.725 0.0 0.0 0.0 0.0 138-139 11.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814827 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814827_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.299 37.0 37.0 37.0 37.0 37.0 2 35.9715 37.0 37.0 37.0 37.0 37.0 3 36.0645 37.0 37.0 37.0 37.0 37.0 4 36.1235 37.0 37.0 37.0 37.0 37.0 5 36.208 37.0 37.0 37.0 37.0 37.0 6 36.1065 37.0 37.0 37.0 37.0 37.0 7 36.1005 37.0 37.0 37.0 37.0 37.0 8 36.1665 37.0 37.0 37.0 37.0 37.0 9 36.0975 37.0 37.0 37.0 37.0 37.0 10-14 36.1055 37.0 37.0 37.0 37.0 37.0 15-19 36.0531 37.0 37.0 37.0 37.0 37.0 20-24 36.0459 37.0 37.0 37.0 37.0 37.0 25-29 36.028499999999994 37.0 37.0 37.0 37.0 37.0 30-34 35.9616 37.0 37.0 37.0 37.0 37.0 35-39 35.965500000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.903299999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.915699999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.868399999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.7538 37.0 37.0 37.0 37.0 37.0 60-64 35.7302 37.0 37.0 37.0 37.0 37.0 65-69 35.6656 37.0 37.0 37.0 37.0 37.0 70-74 35.5708 37.0 37.0 37.0 37.0 37.0 75-79 35.5878 37.0 37.0 37.0 37.0 37.0 80-84 35.568799999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.4872 37.0 37.0 37.0 37.0 37.0 90-94 35.4024 37.0 37.0 37.0 37.0 37.0 95-99 35.3425 37.0 37.0 37.0 37.0 37.0 100-104 35.326499999999996 37.0 37.0 37.0 34.6 37.0 105-109 35.2639 37.0 37.0 37.0 32.2 37.0 110-114 35.0279 37.0 37.0 37.0 25.0 37.0 115-119 34.99900000000001 37.0 37.0 37.0 25.0 37.0 120-124 34.9567 37.0 37.0 37.0 25.0 37.0 125-129 34.77570000000001 37.0 37.0 37.0 25.0 37.0 130-134 34.662800000000004 37.0 37.0 37.0 25.0 37.0 135-139 34.45790000000001 37.0 37.0 37.0 25.0 37.0 140-144 34.2367 37.0 37.0 37.0 25.0 37.0 145-149 34.186400000000006 37.0 37.0 37.0 25.0 37.0 150-151 33.551500000000004 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 5.0 15 3.0 16 3.0 17 0.0 18 5.0 19 3.0 20 4.0 21 3.0 22 9.0 23 13.0 24 9.0 25 14.0 26 14.0 27 18.0 28 25.0 29 25.0 30 38.0 31 56.0 32 80.0 33 157.0 34 283.0 35 776.0 36 2343.0 37 110.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.224999999999994 19.8 5.1499999999999995 24.825 2 29.825000000000003 21.25 27.425 21.5 3 24.224999999999998 23.425 29.349999999999998 23.0 4 28.475 30.45 19.25 21.825 5 29.175 32.725 17.675 20.424999999999997 6 24.775 34.925 18.65 21.65 7 23.825 19.125 33.800000000000004 23.25 8 23.925 22.25 24.05 29.775000000000002 9 24.55 21.15 25.674999999999997 28.625 10-14 26.815 25.174999999999997 22.595000000000002 25.415 15-19 26.275 24.605 23.830000000000002 25.290000000000003 20-24 26.765 24.85 23.145 25.240000000000002 25-29 26.63 25.395 22.955000000000002 25.019999999999996 30-34 26.810000000000002 24.709999999999997 23.49 24.990000000000002 35-39 26.25 24.834999999999997 23.685000000000002 25.230000000000004 40-44 26.36 25.230000000000004 23.195 25.215 45-49 26.33 24.415 24.154999999999998 25.1 50-54 26.52 24.834999999999997 24.104999999999997 24.54 55-59 26.61 25.14 23.745 24.505 60-64 26.415 24.98 23.755000000000003 24.85 65-69 26.39 24.785 24.145 24.68 70-74 27.275 25.09 23.369999999999997 24.265 75-79 26.51 25.05 24.22 24.22 80-84 26.39 24.875 25.05 23.685000000000002 85-89 26.51 25.0 24.145 24.345 90-94 25.915 25.330000000000002 23.54 25.215 95-99 27.155 25.679999999999996 23.47 23.695 100-104 26.69 25.025 23.82 24.465 105-109 26.69 25.080000000000002 23.815 24.415 110-114 27.255000000000003 25.19 23.215 24.34 115-119 27.55 25.2 23.549999999999997 23.7 120-124 27.575 25.27 23.26 23.895 125-129 27.63 25.3 23.395 23.674999999999997 130-134 28.355000000000004 25.545 23.015 23.085 135-139 28.384999999999998 25.515 23.01 23.09 140-144 28.985 25.165 22.915 22.935 145-149 29.595 24.91 22.945 22.55 150-151 29.2 25.775 22.3375 22.6875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 3.0 10 3.0 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 1.5 18 1.5 19 1.0 20 0.5 21 1.0 22 1.5 23 1.0 24 1.5 25 1.0 26 2.5 27 2.5 28 0.5 29 3.0 30 6.5 31 7.5 32 8.5 33 11.5 34 16.0 35 21.0 36 31.5 37 44.0 38 59.5 39 88.5 40 108.5 41 121.0 42 136.5 43 166.5 44 191.5 45 192.5 46 183.5 47 178.5 48 168.0 49 153.0 50 146.5 51 125.0 52 113.5 53 115.0 54 124.5 55 116.5 56 97.5 57 95.0 58 92.5 59 94.0 60 82.5 61 77.5 62 80.5 63 74.0 64 79.0 65 71.0 66 56.0 67 64.0 68 61.0 69 53.0 70 47.0 71 38.0 72 39.5 73 32.0 74 23.5 75 20.0 76 12.5 77 12.0 78 11.5 79 6.0 80 2.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 1.5 87 2.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 1.0 97 1.0 98 0.0 99 0.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.075 #Duplication Level Percentage of deduplicated Percentage of total 1 95.1617144359716 90.47500000000001 2 4.6279253221141206 8.799999999999999 3 0.18406521167499343 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026295030239284777 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.9 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.5625 0.0 0.0 0.0 0.0 98-99 1.6375 0.0 0.0 0.0 0.0 100-101 1.9375 0.0 0.0 0.0 0.0 102-103 2.2375 0.0 0.0 0.0 0.0 104-105 2.5374999999999996 0.0 0.0 0.0 0.0 106-107 2.8375 0.0 0.0 0.0 0.0 108-109 3.0375 0.0 0.0 0.0 0.0 110-111 3.3875 0.0 0.0 0.0 0.0 112-113 3.8625 0.0 0.0 0.0 0.0 114-115 4.4875 0.0 0.0 0.0 0.0 116-117 5.0125 0.0 0.0 0.0 0.0 118-119 5.5625 0.0 0.0 0.0 0.0 120-121 6.15 0.0 0.0 0.0 0.0 122-123 6.55 0.0 0.0 0.0 0.0 124-125 7.225 0.0 0.0 0.0 0.0 126-127 7.7 0.0 0.0 0.0 0.0 128-129 8.125 0.0 0.0 0.0 0.0 130-131 8.8375 0.0 0.0 0.0 0.0 132-133 9.6125 0.0 0.0 0.0 0.0 134-135 10.025 0.0 0.0 0.0 0.0 136-137 10.837499999999999 0.0 0.0 0.0 0.0 138-139 11.524999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTTGA 10 0.006830828 145.0 4 >>END_MODULE Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra Read 1906850 spots for SRR7814827.sra Written 1906850 spots for SRR7814827.sra SRR ids: ['SRR7814827.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_51flguro SRR7814827.sra spots: 38137000 blocks: [[1, 1906850], [1906851, 3813700], [3813701, 5720550], [5720551, 7627400], [7627401, 9534250], [9534251, 11441100], [11441101, 13347950], [13347951, 15254800], [15254801, 17161650], [17161651, 19068500], [19068501, 20975350], [20975351, 22882200], [22882201, 24789050], [24789051, 26695900], [26695901, 28602750], [28602751, 30509600], [30509601, 32416450], [32416451, 34323300], [34323301, 36230150], [36230151, 38137000]] SRR7814827 file size 12901677 SRR7814827 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814827 SRR7814827_1.fastq SRR7814827_2.fastq Input file: SRR7814827_1.fastq Paired file: SRR7814827_2.fastq trimmed: SRR7814827-trimmed-pair1.fastq, SRR7814827-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:34:03 2024 >> started Fri Dec 6 11:34:49 2024 >> done (46.403s) 38137000 read pairs processed; of these: 371 ( 0.00%) short read pairs filtered out after trimming by size control 24438 ( 0.06%) empty read pairs filtered out after trimming by size control 38112191 (99.93%) read pairs available; of these: 5883742 (15.44%) trimmed read pairs available after processing 32228449 (84.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 22 0.00% 20 27 0.00% 21 27 0.00% 22 33 0.00% 23 39 0.00% 24 48 0.00% 25 44 0.00% 26 50 0.00% 27 70 0.00% 28 69 0.00% 29 62 0.00% 30 79 0.00% 31 84 0.00% 32 80 0.00% 33 93 0.00% 34 65 0.00% 35 101 0.00% 36 107 0.00% 37 121 0.00% 38 145 0.00% 39 139 0.00% 40 143 0.00% 41 152 0.00% 42 158 0.00% 43 159 0.00% 44 181 0.00% 45 221 0.00% 46 226 0.00% 47 272 0.00% 48 272 0.00% 49 319 0.00% 50 417 0.00% 51 424 0.00% 52 496 0.00% 53 476 0.00% 54 511 0.00% 55 581 0.00% 56 677 0.00% 57 755 0.00% 58 927 0.00% 59 1053 0.00% 60 1216 0.00% 61 1307 0.00% 62 1567 0.00% 63 1697 0.00% 64 1872 0.00% 65 1958 0.01% 66 2231 0.01% 67 2523 0.01% 68 2928 0.01% 69 3369 0.01% 70 3896 0.01% 71 4343 0.01% 72 5186 0.01% 73 5629 0.01% 74 6207 0.02% 75 6851 0.02% 76 7523 0.02% 77 8278 0.02% 78 9266 0.02% 79 10430 0.03% 80 11546 0.03% 81 12902 0.03% 82 14726 0.04% 83 15984 0.04% 84 17748 0.05% 85 19313 0.05% 86 21081 0.06% 87 22465 0.06% 88 23821 0.06% 89 25312 0.07% 90 27746 0.07% 91 30096 0.08% 92 32661 0.09% 93 35742 0.09% 94 37992 0.10% 95 40076 0.11% 96 42242 0.11% 97 44133 0.12% 98 45726 0.12% 99 48220 0.13% 100 50177 0.13% 101 53010 0.14% 102 55630 0.15% 103 58396 0.15% 104 60648 0.16% 105 63739 0.17% 106 65136 0.17% 107 66341 0.17% 108 68889 0.18% 109 71054 0.19% 110 72080 0.19% 111 75241 0.20% 112 78222 0.21% 113 79804 0.21% 114 83880 0.22% 115 85994 0.23% 116 87224 0.23% 117 89202 0.23% 118 90545 0.24% 119 92380 0.24% 120 93642 0.25% 121 95672 0.25% 122 97845 0.26% 123 101539 0.27% 124 105026 0.28% 125 105907 0.28% 126 107803 0.28% 127 109165 0.29% 128 109532 0.29% 129 112677 0.30% 130 113518 0.30% 131 113462 0.30% 132 116803 0.31% 133 119872 0.31% 134 121007 0.32% 135 124305 0.33% 136 125377 0.33% 137 125991 0.33% 138 128095 0.34% 139 128874 0.34% 140 128226 0.34% 141 130303 0.34% 142 133540 0.35% 143 134133 0.35% 144 137269 0.36% 145 139403 0.37% 146 139696 0.37% 147 140491 0.37% 148 141905 0.37% 149 140894 0.37% 150 146426 0.38% 151 32228449 84.56% 38112191 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=6.07 fanout-score-rank=25 prefix-density=0.24 prefix-fanout=4.1 sequence=GGCAGCCTCCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=680.63 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=27.1 sequence=CAGCAGCAGTCTTTGAAACTGCAGCAGACACTCCTCCCATGAGGAAATCAATTGCAAAGCTCTTGACACCTTTCTCAGCTGGTGCGTTAGCAAAGATTGGAGAGGACGACACCATCGGGACATTGATGGCAGACATTGCAGGGCCAAAATGGCTCTGGGTCATGTAGTTGCTTGTGGTGTAGCGCCTTTCATAAGCTGGGGCAGAAGGGCACATGTTACGGGCACGTACACCTTCAGAAAAGCTGGAGCCAAGGTGGAACTGTCCACCAAACTTCTGAAGAACAGTTGGTTGGTTAGCCTGGTCCATCGGCTAAGAGTACTGTCCCTTCGGAAGCGGAGGCGAGGCGATGGGGGCTCTTCCCAAACTCGGCGG criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=35 prefix-density=0.31 prefix-fanout=2.4 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=575.94 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=19.1 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR7814827 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:35:49 Started mapping on | Dec 06 11:35:49 Finished on | Dec 06 11:42:59 Mapping speed, Million of reads per hour | 319.08 Number of input reads | 38112191 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 34805462 Uniquely mapped reads % | 91.32% Average mapped length | 292.06 Number of splices: Total | 35242829 Number of splices: Annotated (sjdb) | 33184315 Number of splices: GT/AG | 34756580 Number of splices: GC/AG | 388131 Number of splices: AT/AC | 25630 Number of splices: Non-canonical | 72488 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 3.07 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 595180 % of reads mapped to multiple loci | 1.56% Number of reads mapped to too many loci | 52068 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.22% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2711549 2711549 2711549 N_multimapping 595180 595180 595180 N_noFeature 930467 33921800 1298570 N_ambiguous 596977 4405 83552 UnstrandedReadsAssigned:33278018 PositiveStrandReadsAssigned:879257 NegativeStrandReadsAssigned:33423340 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814827 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814827-trimmed-pair1.fastq SRR7814827-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,112,191 reads, 34,084,136 reads pseudoaligned [quant] estimated average fragment length: 246.279 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,313 rounds 52973 SRR7814827.ke.tsv 35125 SRR7814827.se.tsv 88098 total ==> SRR7814827.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.347 19.6241 1.18484 PNS24247 1044 798.721 85.5777 4.47229 PNS24249 1928 1682.72 329.715 8.17883 PNS24246 1044 798.721 85.5777 4.47229 PNS24248 1044 798.721 85.5777 4.47229 PNS24244 1471 1225.72 151.928 5.1738 PNS24243 293 103.639 0 0 KQK14069 1603 1357.72 4976.16 152.985 KQK14071 474 248.685 38.7708 6.50758 ==> SRR7814827.se.tsv <== BRADI_1g14170v3 5202 BRADI_1g53295v3 873 BRADI_1g59795v3 137 BRADI_1g07683v3 0 BRADI_1g00485v3 72 BRADI_1g20270v3 5032 BRADI_1g74790v3 67 BRADI_1g09890v3 0 BRADI_1g77505v3 389 BRADI_1g48960v3 0 SRR7814827 completed mapping pipeline successfully