Starting /dee2/code/volunteer_pipeline.sh SRR7814830 current disk space = 1551535325184 free memory = 1602172308 SRR7814830 SRAfilesize e6feb8672fdf6c99773643e6894df630 SRR7814830.sra SRR7814830.sra file validated SRR7814830 is paired end SRR7814830 is conventional basespace SRR7814830 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814830_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.38675 37.0 37.0 37.0 37.0 37.0 2 36.456 37.0 37.0 37.0 37.0 37.0 3 36.545 37.0 37.0 37.0 37.0 37.0 4 36.594 37.0 37.0 37.0 37.0 37.0 5 36.6125 37.0 37.0 37.0 37.0 37.0 6 36.54 37.0 37.0 37.0 37.0 37.0 7 36.5395 37.0 37.0 37.0 37.0 37.0 8 36.5215 37.0 37.0 37.0 37.0 37.0 9 36.6215 37.0 37.0 37.0 37.0 37.0 10-14 36.578500000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.548700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.514300000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.4652 37.0 37.0 37.0 37.0 37.0 30-34 36.3001 37.0 37.0 37.0 37.0 37.0 35-39 36.2855 37.0 37.0 37.0 37.0 37.0 40-44 36.1792 37.0 37.0 37.0 37.0 37.0 45-49 36.3052 37.0 37.0 37.0 37.0 37.0 50-54 36.341300000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3298 37.0 37.0 37.0 37.0 37.0 60-64 36.35529999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.213699999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.105399999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.054 37.0 37.0 37.0 37.0 37.0 80-84 36.054100000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.096199999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.9581 37.0 37.0 37.0 37.0 37.0 95-99 35.7308 37.0 37.0 37.0 37.0 37.0 100-104 35.4782 37.0 37.0 37.0 37.0 37.0 105-109 35.5917 37.0 37.0 37.0 37.0 37.0 110-114 35.6594 37.0 37.0 37.0 37.0 37.0 115-119 35.5298 37.0 37.0 37.0 37.0 37.0 120-124 34.8812 37.0 37.0 37.0 27.4 37.0 125-129 34.6596 37.0 37.0 37.0 25.0 37.0 130-134 35.2177 37.0 37.0 37.0 27.4 37.0 135-139 35.0863 37.0 37.0 37.0 27.4 37.0 140-144 35.0147 37.0 37.0 37.0 25.0 37.0 145-149 34.935500000000005 37.0 37.0 37.0 25.0 37.0 150-151 34.16 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 0.0 25 2.0 26 5.0 27 8.0 28 13.0 29 30.0 30 44.0 31 56.0 32 80.0 33 141.0 34 268.0 35 586.0 36 2568.0 37 198.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 49.96237772761475 10.132932029094558 5.191873589164786 34.71281665412591 2 26.575 12.950000000000001 31.55 28.925 3 22.2 18.099999999999998 23.7 36.0 4 27.275 24.25 21.5 26.974999999999998 5 26.5 30.25 22.025 21.224999999999998 6 22.15 31.55 22.35 23.95 7 17.875 23.875 39.4 18.85 8 20.599999999999998 21.575 29.099999999999998 28.725 9 21.75 19.425 31.55 27.275 10-14 23.28 26.369999999999997 24.555 25.795 15-19 23.990000000000002 24.11 25.195 26.705000000000002 20-24 24.13 24.165 25.759999999999998 25.945 25-29 23.82 24.05 25.655 26.474999999999998 30-34 24.005000000000003 23.915 25.405 26.674999999999997 35-39 24.015 24.169999999999998 24.93 26.884999999999998 40-44 24.6 23.72 24.595 27.084999999999997 45-49 24.135 24.195 24.615000000000002 27.055 50-54 23.86 24.01 24.395 27.735 55-59 23.995 24.14 24.715 27.150000000000002 60-64 24.33 23.955000000000002 24.834999999999997 26.88 65-69 24.7 24.07 24.21 27.02 70-74 24.735 24.23 24.335 26.700000000000003 75-79 24.64 23.895 24.21 27.255000000000003 80-84 24.865000000000002 24.279999999999998 24.235 26.619999999999997 85-89 25.069999999999997 24.095 24.005000000000003 26.83 90-94 25.074999999999996 23.365 24.315 27.245 95-99 24.725 24.265 23.94 27.07 100-104 25.314999999999998 23.985 23.880000000000003 26.82 105-109 24.815 23.494999999999997 24.54 27.150000000000002 110-114 25.47 23.94 23.945 26.645000000000003 115-119 24.595 23.810000000000002 24.3 27.295 120-124 24.615000000000002 24.08 23.93 27.375 125-129 24.654999999999998 23.880000000000003 24.03 27.435 130-134 25.790000000000003 23.505000000000003 23.505000000000003 27.200000000000003 135-139 25.124999999999996 24.29 23.765 26.82 140-144 25.009999999999998 24.33 23.575 27.084999999999997 145-149 24.87 23.905 23.735 27.49 150-151 25.0625 23.962500000000002 23.925 27.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 3.5 29 9.5 30 10.5 31 8.5 32 9.0 33 15.0 34 22.0 35 27.5 36 40.5 37 53.5 38 64.0 39 86.0 40 105.5 41 117.0 42 133.0 43 139.0 44 142.0 45 148.5 46 168.5 47 172.0 48 158.5 49 160.0 50 156.0 51 152.0 52 144.0 53 136.0 54 142.5 55 140.0 56 130.5 57 123.0 58 111.0 59 97.5 60 88.0 61 78.0 62 66.0 63 65.5 64 65.0 65 66.5 66 60.0 67 50.5 68 51.0 69 52.5 70 50.0 71 37.0 72 33.0 73 29.5 74 21.5 75 20.0 76 15.0 77 10.0 78 6.0 79 3.0 80 1.5 81 1.5 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.25 #Duplication Level Percentage of deduplicated Percentage of total 1 87.8510028653295 76.64999999999999 2 10.257879656160458 17.9 3 1.4040114613180517 3.675 4 0.42979942693409745 1.5 5 0.028653295128939826 0.125 6 0.028653295128939826 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 6 0.15 No Hit GTCCATCTTAATACGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.5874999999999999 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.3875 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 2.1375 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.6125 0.0 0.0 0.0 0.0 110-111 3.0125 0.0 0.0 0.0 0.0 112-113 3.3 0.0 0.0 0.0 0.0 114-115 3.6375 0.0 0.0 0.0 0.0 116-117 4.050000000000001 0.0 0.0 0.0 0.0 118-119 4.3875 0.0 0.0 0.0 0.0 120-121 4.9 0.0 0.0 0.0 0.0 122-123 5.4375 0.0 0.0 0.0 0.0 124-125 5.875 0.0 0.0 0.0 0.0 126-127 6.2875 0.0 0.0 0.0 0.0 128-129 6.75 0.0 0.0 0.0 0.0 130-131 7.2875 0.0 0.0 0.0 0.0 132-133 7.862500000000001 0.0 0.0 0.0 0.0 134-135 8.5625 0.0 0.0 0.0 0.0 136-137 9.1125 0.0 0.0 0.0 0.0 138-139 9.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCCAA 10 0.006830828 145.0 9 >>END_MODULE SRR7814830 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814830_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.997 37.0 37.0 37.0 37.0 37.0 2 35.7055 37.0 37.0 37.0 37.0 37.0 3 35.713 37.0 37.0 37.0 37.0 37.0 4 35.709 37.0 37.0 37.0 37.0 37.0 5 35.5855 37.0 37.0 37.0 37.0 37.0 6 35.6775 37.0 37.0 37.0 37.0 37.0 7 35.424 37.0 37.0 37.0 37.0 37.0 8 35.6475 37.0 37.0 37.0 37.0 37.0 9 35.853 37.0 37.0 37.0 37.0 37.0 10-14 35.7829 37.0 37.0 37.0 37.0 37.0 15-19 35.373000000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.595299999999995 37.0 37.0 37.0 37.0 37.0 25-29 35.5065 37.0 37.0 37.0 34.6 37.0 30-34 35.2178 37.0 37.0 37.0 32.2 37.0 35-39 35.2236 37.0 37.0 37.0 32.2 37.0 40-44 34.9619 37.0 37.0 37.0 29.8 37.0 45-49 35.059400000000004 37.0 37.0 37.0 29.8 37.0 50-54 34.3337 37.0 37.0 37.0 25.0 37.0 55-59 34.35170000000001 37.0 37.0 37.0 25.0 37.0 60-64 34.6035 37.0 37.0 37.0 25.0 37.0 65-69 34.562799999999996 37.0 37.0 37.0 25.0 37.0 70-74 34.0632 37.0 37.0 37.0 25.0 37.0 75-79 34.015 37.0 37.0 37.0 25.0 37.0 80-84 33.875299999999996 37.0 37.0 37.0 25.0 37.0 85-89 34.265100000000004 37.0 37.0 37.0 25.0 37.0 90-94 33.7732 37.0 37.0 37.0 22.2 37.0 95-99 32.9404 37.0 37.0 37.0 11.0 37.0 100-104 33.1871 37.0 37.0 37.0 16.6 37.0 105-109 32.866 37.0 37.0 37.0 13.8 37.0 110-114 33.164 37.0 37.0 37.0 13.8 37.0 115-119 33.2132 37.0 37.0 37.0 16.6 37.0 120-124 32.5739 37.0 34.6 37.0 11.0 37.0 125-129 32.7703 37.0 37.0 37.0 11.0 37.0 130-134 32.164 37.0 32.2 37.0 11.0 37.0 135-139 32.221399999999996 37.0 34.6 37.0 11.0 37.0 140-144 32.4408 37.0 34.6 37.0 11.0 37.0 145-149 32.075 37.0 32.2 37.0 11.0 37.0 150-151 31.70925 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 5.0 16 2.0 17 3.0 18 5.0 19 0.0 20 6.0 21 9.0 22 23.0 23 27.0 24 46.0 25 71.0 26 84.0 27 83.0 28 103.0 29 110.0 30 121.0 31 120.0 32 175.0 33 258.0 34 357.0 35 771.0 36 1569.0 37 50.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.625 18.525 7.7 30.15 2 30.0 21.075 27.150000000000002 21.775 3 24.775 22.675 28.575 23.974999999999998 4 28.225 31.275 18.525 21.975 5 29.15 34.4 16.475 19.975 6 24.05 34.849999999999994 18.6 22.5 7 24.3 18.224999999999998 33.975 23.5 8 24.125 22.475 22.525000000000002 30.875000000000004 9 25.85 20.5 26.174999999999997 27.474999999999998 10-14 27.68 25.05 21.14 26.13 15-19 26.96 25.014999999999997 22.295 25.729999999999997 20-24 27.115000000000002 24.815 23.015 25.055 25-29 27.229999999999997 24.875 22.52 25.374999999999996 30-34 26.834999999999997 25.230000000000004 22.919999999999998 25.014999999999997 35-39 27.215 25.005 22.58 25.2 40-44 28.13 24.645 22.52 24.705 45-49 27.185 25.455 23.01 24.349999999999998 50-54 26.21 25.135 23.169999999999998 25.485000000000003 55-59 27.384999999999998 25.09 23.005 24.52 60-64 26.669999999999998 24.310000000000002 23.035 25.985000000000003 65-69 27.08 25.22 23.175 24.525 70-74 27.205000000000002 25.290000000000003 22.585 24.92 75-79 26.979999999999997 25.025 22.57 25.424999999999997 80-84 27.6 24.560000000000002 22.89 24.95 85-89 26.72 25.335 22.759999999999998 25.185000000000002 90-94 27.16 25.124999999999996 22.665 25.05 95-99 26.61 25.564999999999998 23.135 24.69 100-104 26.82 26.215 22.765 24.2 105-109 26.700000000000003 26.1 22.91 24.29 110-114 26.965 25.814999999999998 22.770000000000003 24.45 115-119 27.365000000000002 25.85 22.93 23.855 120-124 27.465 26.534999999999997 22.62 23.380000000000003 125-129 27.205000000000002 26.26 22.095000000000002 24.44 130-134 27.16 26.295 23.45 23.095 135-139 27.139999999999997 26.655 22.91 23.294999999999998 140-144 27.655 26.284999999999997 22.845 23.215 145-149 27.279999999999998 26.674999999999997 22.79 23.255 150-151 29.1875 25.775 23.1375 21.9 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.5 16 2.5 17 1.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.0 23 1.0 24 2.0 25 2.0 26 0.5 27 2.0 28 5.0 29 5.5 30 7.5 31 11.0 32 12.5 33 16.0 34 28.0 35 35.5 36 43.0 37 52.0 38 69.5 39 86.5 40 87.0 41 104.0 42 113.5 43 123.5 44 132.5 45 135.5 46 155.5 47 143.5 48 130.0 49 143.0 50 142.0 51 130.5 52 123.5 53 137.5 54 151.5 55 137.5 56 121.0 57 107.5 58 108.5 59 109.5 60 97.5 61 95.5 62 93.5 63 88.5 64 87.5 65 83.0 66 70.5 67 66.5 68 56.0 69 43.5 70 50.5 71 50.0 72 40.5 73 34.0 74 30.5 75 23.5 76 14.0 77 10.0 78 8.0 79 5.0 80 4.0 81 4.5 82 2.5 83 1.0 84 0.5 85 1.0 86 2.0 87 2.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.5 97 0.5 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.68811463894353 79.80000000000001 2 8.766507445911772 15.6 3 1.236302332115763 3.3000000000000003 4 0.224782242202866 0.8 5 0.02809778027535825 0.125 6 0.0 0.0 7 0.02809778027535825 0.17500000000000002 8 0.02809778027535825 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTTACCAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCC 8 0.2 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit ACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.9125000000000001 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.2375 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.575 0.0 0.0 0.0 0.0 104-105 1.9625 0.0 0.0 0.0 0.0 106-107 2.1375 0.0 0.0 0.0 0.0 108-109 2.4125 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.0875 0.0 0.0 0.0 0.0 114-115 3.3625 0.0 0.0 0.0 0.0 116-117 3.625 0.0 0.0 0.0 0.0 118-119 3.9375 0.0 0.0 0.0 0.0 120-121 4.4625 0.0 0.0 0.0 0.0 122-123 4.9 0.0 0.0 0.0 0.0 124-125 5.25 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 6.0 0.0 0.0 0.0 0.0 130-131 6.4625 0.0 0.0 0.0 0.0 132-133 6.9625 0.0 0.0 0.0 0.0 134-135 7.5625 0.0 0.0 0.0 0.0 136-137 8.025 0.0 0.0 0.0 0.0 138-139 8.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTACCA 10 0.006830828 145.0 1 >>END_MODULE Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204841 spots for SRR7814830.sra Written 2204841 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra Read 2204833 spots for SRR7814830.sra Written 2204833 spots for SRR7814830.sra SRR ids: ['SRR7814830.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6m3iog_8 SRR7814830.sra spots: 44096668 blocks: [[1, 2204833], [2204834, 4409666], [4409667, 6614499], [6614500, 8819332], [8819333, 11024165], [11024166, 13228998], [13228999, 15433831], [15433832, 17638664], [17638665, 19843497], [19843498, 22048330], [22048331, 24253163], [24253164, 26457996], [26457997, 28662829], [28662830, 30867662], [30867663, 33072495], [33072496, 35277328], [35277329, 37482161], [37482162, 39686994], [39686995, 41891827], [41891828, 44096668]] SRR7814830 file size 14921213 SRR7814830 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814830 SRR7814830_1.fastq SRR7814830_2.fastq Input file: SRR7814830_1.fastq Paired file: SRR7814830_2.fastq trimmed: SRR7814830-trimmed-pair1.fastq, SRR7814830-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:43:49 2024 >> started Fri Dec 6 11:44:39 2024 >> done (49.873s) 44096668 read pairs processed; of these: 165 ( 0.00%) short read pairs filtered out after trimming by size control 5989 ( 0.01%) empty read pairs filtered out after trimming by size control 44090514 (99.99%) read pairs available; of these: 6018797 (13.65%) trimmed read pairs available after processing 38071717 (86.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 15 0.00% 20 13 0.00% 21 28 0.00% 22 23 0.00% 23 38 0.00% 24 21 0.00% 25 31 0.00% 26 40 0.00% 27 36 0.00% 28 28 0.00% 29 58 0.00% 30 53 0.00% 31 68 0.00% 32 61 0.00% 33 56 0.00% 34 53 0.00% 35 78 0.00% 36 77 0.00% 37 103 0.00% 38 103 0.00% 39 95 0.00% 40 123 0.00% 41 99 0.00% 42 98 0.00% 43 131 0.00% 44 125 0.00% 45 121 0.00% 46 160 0.00% 47 204 0.00% 48 197 0.00% 49 262 0.00% 50 235 0.00% 51 300 0.00% 52 373 0.00% 53 361 0.00% 54 382 0.00% 55 396 0.00% 56 499 0.00% 57 569 0.00% 58 655 0.00% 59 741 0.00% 60 864 0.00% 61 1055 0.00% 62 1140 0.00% 63 1346 0.00% 64 1373 0.00% 65 1472 0.00% 66 1676 0.00% 67 1756 0.00% 68 2052 0.00% 69 2381 0.01% 70 2880 0.01% 71 3231 0.01% 72 3827 0.01% 73 4304 0.01% 74 4735 0.01% 75 5225 0.01% 76 5653 0.01% 77 6354 0.01% 78 7073 0.02% 79 8389 0.02% 80 8903 0.02% 81 10264 0.02% 82 11626 0.03% 83 13111 0.03% 84 14158 0.03% 85 15843 0.04% 86 17329 0.04% 87 18556 0.04% 88 20075 0.05% 89 21279 0.05% 90 23367 0.05% 91 25747 0.06% 92 28309 0.06% 93 30902 0.07% 94 32971 0.07% 95 35526 0.08% 96 37794 0.09% 97 40076 0.09% 98 41491 0.09% 99 43687 0.10% 100 46359 0.11% 101 48857 0.11% 102 51911 0.12% 103 54717 0.12% 104 57409 0.13% 105 59123 0.13% 106 62067 0.14% 107 64303 0.15% 108 66685 0.15% 109 69558 0.16% 110 71369 0.16% 111 74265 0.17% 112 77941 0.18% 113 79145 0.18% 114 82698 0.19% 115 86628 0.20% 116 89267 0.20% 117 90751 0.21% 118 91361 0.21% 119 93054 0.21% 120 97552 0.22% 121 98725 0.22% 122 100904 0.23% 123 105460 0.24% 124 107375 0.24% 125 110877 0.25% 126 113699 0.26% 127 114608 0.26% 128 115901 0.26% 129 118704 0.27% 130 119144 0.27% 131 120519 0.27% 132 124022 0.28% 133 127299 0.29% 134 128551 0.29% 135 132303 0.30% 136 134457 0.30% 137 134430 0.30% 138 135177 0.31% 139 138664 0.31% 140 139118 0.32% 141 140678 0.32% 142 143854 0.33% 143 146073 0.33% 144 150539 0.34% 145 152670 0.35% 146 154890 0.35% 147 156996 0.36% 148 156698 0.36% 149 157372 0.36% 150 159154 0.36% 151 38071717 86.35% 44090514 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.78 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=23.69 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=1.5 sequence=GTTCGTTCGTTAGGATGCCTCAGCTGCATACATCACTGCACTTCCACTTGACACCTATTTAAACGGCTCGTCTCGCCGCTACCTTATCCTATTTCCATACTTCTGTCGCTCCATCCCCGTATGGGTGGAGAACCCGTCGCTGTCTCGGCTGTGATACCGGAGGCTCTAGGGAAGTCGGAGGAGAGAGCACTCATCTTGGGGTGGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCTCCGCACTTGGCTACCCAGCGTTTACCGTAGGCACGATAACTGGTACACCAGAGGTGCGTCCTTCCCGGTCCTCTCGTACTAGGGAAAGGTCCTCTCAATGCTCTAACGCCCACACCGGATATGGACCGAACTGTCTCACGA criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=14 prefix-density=1.05 prefix-fanout=2.3 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=12.88 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=2.5 sequence=CCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCCCTCGAGAACCTCAAGACCTACCCGTTCGTCAAGGAAGGC SRR7814830 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:46:26 Started mapping on | Dec 06 11:46:27 Finished on | Dec 06 11:55:54 Mapping speed, Million of reads per hour | 279.94 Number of input reads | 44090514 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 35999955 Uniquely mapped reads % | 81.65% Average mapped length | 293.54 Number of splices: Total | 33616534 Number of splices: Annotated (sjdb) | 31782962 Number of splices: GT/AG | 33113508 Number of splices: GC/AG | 414187 Number of splices: AT/AC | 12567 Number of splices: Non-canonical | 76272 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2495992 % of reads mapped to multiple loci | 5.66% Number of reads mapped to too many loci | 455350 % of reads mapped to too many loci | 1.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.29% % of reads unmapped: other | 6.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5594567 5594567 5594567 N_multimapping 2495992 2495992 2495992 N_noFeature 2784933 34790818 3075895 N_ambiguous 1094176 4438 177464 UnstrandedReadsAssigned:32120846 PositiveStrandReadsAssigned:1204699 NegativeStrandReadsAssigned:32746596 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814830 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814830-trimmed-pair1.fastq SRR7814830-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,090,514 reads, 33,958,720 reads pseudoaligned [quant] estimated average fragment length: 248.01 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 SRR7814830.ke.tsv 35125 SRR7814830.se.tsv 88098 total ==> SRR7814830.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.249 0 0 PNS24247 1044 796.99 51.2538 2.242 PNS24249 1928 1680.99 186.846 3.87508 PNS24246 1044 796.99 51.2538 2.242 PNS24248 1044 796.99 51.2538 2.242 PNS24244 1471 1223.99 177.392 5.05263 PNS24243 293 101.184 2 0.689093 KQK14069 1603 1355.99 5692.08 146.344 KQK14071 474 244.557 82.1275 11.7076 ==> SRR7814830.se.tsv <== BRADI_1g14170v3 5943 BRADI_1g53295v3 1510 BRADI_1g59795v3 227 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 484 BRADI_1g74790v3 473 BRADI_1g09890v3 0 BRADI_1g77505v3 750 BRADI_1g48960v3 1 SRR7814830 completed mapping pipeline successfully