Starting /dee2/code/volunteer_pipeline.sh SRR7814831 current disk space = 1551224954880 free memory = 1602204124 SRR7814831 SRAfilesize 776bfc7af2fc140009d61fef5faa3426 SRR7814831.sra SRR7814831.sra file validated SRR7814831 is paired end SRR7814831 is conventional basespace SRR7814831 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814831_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4305 37.0 37.0 37.0 37.0 37.0 2 36.3765 37.0 37.0 37.0 37.0 37.0 3 36.5125 37.0 37.0 37.0 37.0 37.0 4 36.506 37.0 37.0 37.0 37.0 37.0 5 36.537 37.0 37.0 37.0 37.0 37.0 6 36.5435 37.0 37.0 37.0 37.0 37.0 7 36.4495 37.0 37.0 37.0 37.0 37.0 8 36.572 37.0 37.0 37.0 37.0 37.0 9 36.5545 37.0 37.0 37.0 37.0 37.0 10-14 36.563399999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.49830000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5366 37.0 37.0 37.0 37.0 37.0 25-29 36.453199999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.2404 37.0 37.0 37.0 37.0 37.0 35-39 36.2097 37.0 37.0 37.0 37.0 37.0 40-44 36.1192 37.0 37.0 37.0 37.0 37.0 45-49 36.2963 37.0 37.0 37.0 37.0 37.0 50-54 36.3184 37.0 37.0 37.0 37.0 37.0 55-59 36.2607 37.0 37.0 37.0 37.0 37.0 60-64 36.2783 37.0 37.0 37.0 37.0 37.0 65-69 36.2063 37.0 37.0 37.0 37.0 37.0 70-74 36.1074 37.0 37.0 37.0 37.0 37.0 75-79 36.0609 37.0 37.0 37.0 37.0 37.0 80-84 36.0153 37.0 37.0 37.0 37.0 37.0 85-89 36.0205 37.0 37.0 37.0 37.0 37.0 90-94 35.930099999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.679 37.0 37.0 37.0 37.0 37.0 100-104 35.3778 37.0 37.0 37.0 32.2 37.0 105-109 35.520999999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.65540000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.485499999999995 37.0 37.0 37.0 37.0 37.0 120-124 34.8577 37.0 37.0 37.0 25.0 37.0 125-129 34.6443 37.0 37.0 37.0 25.0 37.0 130-134 35.1593 37.0 37.0 37.0 27.4 37.0 135-139 34.9654 37.0 37.0 37.0 25.0 37.0 140-144 35.0693 37.0 37.0 37.0 27.4 37.0 145-149 35.0213 37.0 37.0 37.0 25.0 37.0 150-151 34.39575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 1.0 25 3.0 26 7.0 27 13.0 28 19.0 29 21.0 30 32.0 31 71.0 32 83.0 33 135.0 34 260.0 35 614.0 36 2545.0 37 192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.2972972972973 11.136136136136136 5.7807807807807805 35.785785785785784 2 25.424999999999997 14.2 31.1 29.275000000000002 3 22.95 19.125 24.2 33.725 4 28.349999999999998 23.875 21.0 26.775 5 26.700000000000003 30.099999999999998 21.475 21.725 6 23.400000000000002 30.85 22.725 23.025000000000002 7 18.15 23.25 38.625 19.975 8 21.2 21.625 29.849999999999998 27.325 9 20.8 21.975 31.95 25.275 10-14 24.169999999999998 25.81 24.26 25.759999999999998 15-19 24.495 24.455 24.925 26.125 20-24 24.39 24.495 24.785 26.33 25-29 24.25 24.365000000000002 24.855 26.529999999999998 30-34 24.435000000000002 24.044999999999998 25.064999999999998 26.455000000000002 35-39 24.315 24.375 24.959999999999997 26.35 40-44 24.57 24.474999999999998 24.67 26.284999999999997 45-49 24.755 24.215 24.88 26.150000000000002 50-54 24.099999999999998 24.45 24.795 26.655 55-59 23.82 24.16 24.615000000000002 27.405 60-64 24.98 23.805 24.715 26.5 65-69 24.915000000000003 24.169999999999998 23.91 27.005000000000003 70-74 24.825 24.085 24.279999999999998 26.810000000000002 75-79 24.445 23.82 24.959999999999997 26.775 80-84 25.009999999999998 23.94 24.0 27.05 85-89 24.715 24.66 24.2 26.424999999999997 90-94 25.330000000000002 23.91 23.849999999999998 26.91 95-99 25.074999999999996 24.39 23.93 26.605 100-104 24.82 24.665 23.59 26.924999999999997 105-109 25.39 24.075 24.05 26.484999999999996 110-114 25.305 24.18 23.915 26.6 115-119 25.34 24.32 23.51 26.83 120-124 25.905 23.855 23.97 26.27 125-129 25.31 24.265 23.865 26.56 130-134 25.575 24.365000000000002 23.115 26.945000000000004 135-139 25.77 24.5 23.27 26.46 140-144 25.814999999999998 23.915 23.195 27.075 145-149 25.979999999999997 24.060000000000002 23.165 26.795 150-151 25.95 23.4625 23.4875 27.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 2.5 23 2.5 24 0.5 25 0.5 26 2.5 27 2.5 28 3.0 29 7.0 30 9.5 31 11.5 32 15.0 33 17.5 34 23.5 35 28.5 36 39.0 37 54.5 38 74.0 39 80.0 40 91.5 41 121.5 42 140.0 43 160.5 44 164.0 45 172.0 46 169.5 47 150.0 48 142.5 49 133.0 50 144.5 51 150.5 52 130.5 53 121.5 54 118.0 55 128.5 56 137.0 57 115.0 58 99.5 59 96.0 60 100.0 61 100.5 62 82.0 63 62.0 64 61.5 65 62.5 66 64.0 67 62.5 68 50.5 69 46.0 70 49.5 71 47.5 72 38.0 73 30.5 74 21.5 75 16.0 76 15.5 77 11.5 78 5.0 79 4.0 80 4.0 81 2.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.275 #Duplication Level Percentage of deduplicated Percentage of total 1 89.4707364883786 79.875 2 9.297115653878466 16.6 3 1.1201344161299356 3.0 4 0.05600672080649678 0.2 5 0.02800336040324839 0.125 6 0.0 0.0 7 0.0 0.0 8 0.02800336040324839 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 8 0.2 No Hit CTGCATTCAGGCAGAGCTTGTCGCATGACATGGCATACGAATTACTCGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.5875000000000004 0.0 0.0 0.0 0.0 116-117 2.9125 0.0 0.0 0.0 0.0 118-119 3.2125000000000004 0.0 0.0 0.0 0.0 120-121 3.4749999999999996 0.0 0.0 0.0 0.0 122-123 3.7625 0.0 0.0 0.0 0.0 124-125 4.1375 0.0 0.0 0.0 0.0 126-127 4.6 0.0 0.0 0.0 0.0 128-129 5.075 0.0 0.0 0.0 0.0 130-131 5.625 0.0 0.0 0.0 0.0 132-133 5.9875 0.0 0.0 0.0 0.0 134-135 6.5375 0.0 0.0 0.0 0.0 136-137 7.025 0.0 0.0 0.0 0.0 138-139 7.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814831 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814831_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1645 37.0 37.0 37.0 37.0 37.0 2 35.817 37.0 37.0 37.0 37.0 37.0 3 35.846 37.0 37.0 37.0 37.0 37.0 4 35.833 37.0 37.0 37.0 37.0 37.0 5 35.767 37.0 37.0 37.0 37.0 37.0 6 35.632 37.0 37.0 37.0 37.0 37.0 7 35.602 37.0 37.0 37.0 37.0 37.0 8 35.5375 37.0 37.0 37.0 37.0 37.0 9 35.9405 37.0 37.0 37.0 37.0 37.0 10-14 35.8115 37.0 37.0 37.0 37.0 37.0 15-19 35.3374 37.0 37.0 37.0 34.6 37.0 20-24 35.61 37.0 37.0 37.0 37.0 37.0 25-29 35.386700000000005 37.0 37.0 37.0 34.6 37.0 30-34 35.230399999999996 37.0 37.0 37.0 32.2 37.0 35-39 35.273799999999994 37.0 37.0 37.0 32.2 37.0 40-44 34.888099999999994 37.0 37.0 37.0 27.4 37.0 45-49 35.0477 37.0 37.0 37.0 27.4 37.0 50-54 34.246500000000005 37.0 37.0 37.0 25.0 37.0 55-59 34.2068 37.0 37.0 37.0 25.0 37.0 60-64 34.5612 37.0 37.0 37.0 25.0 37.0 65-69 34.4675 37.0 37.0 37.0 25.0 37.0 70-74 34.073100000000004 37.0 37.0 37.0 25.0 37.0 75-79 33.8722 37.0 37.0 37.0 22.2 37.0 80-84 33.894000000000005 37.0 37.0 37.0 22.2 37.0 85-89 34.192400000000006 37.0 37.0 37.0 25.0 37.0 90-94 33.7874 37.0 37.0 37.0 25.0 37.0 95-99 32.8285 37.0 37.0 37.0 11.0 37.0 100-104 33.1069 37.0 37.0 37.0 16.6 37.0 105-109 32.771699999999996 37.0 37.0 37.0 13.8 37.0 110-114 33.0075 37.0 37.0 37.0 13.8 37.0 115-119 33.126999999999995 37.0 37.0 37.0 16.6 37.0 120-124 32.431 37.0 34.6 37.0 11.0 37.0 125-129 32.6632 37.0 34.6 37.0 11.0 37.0 130-134 32.080999999999996 37.0 32.2 37.0 11.0 37.0 135-139 32.0497 37.0 29.8 37.0 11.0 37.0 140-144 32.192699999999995 37.0 29.8 37.0 11.0 37.0 145-149 31.830000000000002 37.0 27.4 37.0 11.0 37.0 150-151 31.34525 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 1.0 16 2.0 17 2.0 18 7.0 19 2.0 20 4.0 21 9.0 22 18.0 23 31.0 24 56.0 25 59.0 26 76.0 27 105.0 28 101.0 29 104.0 30 124.0 31 148.0 32 197.0 33 228.0 34 353.0 35 802.0 36 1529.0 37 36.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.175000000000004 17.9 8.05 30.875000000000004 2 28.675 22.75 27.35 21.224999999999998 3 24.5 22.95 27.700000000000003 24.85 4 27.900000000000002 30.3 19.025 22.775000000000002 5 30.175 31.15 17.95 20.724999999999998 6 24.75 33.074999999999996 19.275000000000002 22.900000000000002 7 23.25 18.55 33.050000000000004 25.15 8 25.45 20.65 24.8 29.099999999999998 9 25.174999999999997 22.25 25.45 27.125 10-14 26.855 25.14 21.625 26.38 15-19 26.974999999999998 24.055 22.770000000000003 26.200000000000003 20-24 27.21 24.87 22.43 25.490000000000002 25-29 26.650000000000002 24.740000000000002 22.595000000000002 26.015 30-34 26.68 24.955 23.11 25.255 35-39 27.265 24.325 22.775000000000002 25.635 40-44 27.450000000000003 24.29 22.97 25.290000000000003 45-49 27.339999999999996 23.62 23.455000000000002 25.585 50-54 27.22 24.63 22.86 25.290000000000003 55-59 26.595000000000002 25.064999999999998 23.13 25.21 60-64 26.69 24.235 23.385 25.69 65-69 27.275 24.495 23.02 25.21 70-74 26.93 25.369999999999997 22.73 24.97 75-79 26.61 24.435000000000002 23.119999999999997 25.835 80-84 26.35 24.975 23.465 25.21 85-89 26.825 24.555 22.765 25.855 90-94 26.55 25.419999999999998 22.595000000000002 25.435000000000002 95-99 26.064999999999998 25.555 23.145 25.235000000000003 100-104 26.155 25.635 23.169999999999998 25.040000000000003 105-109 26.265 25.995 23.119999999999997 24.62 110-114 27.139999999999997 25.285000000000004 23.01 24.565 115-119 27.05 25.285000000000004 23.119999999999997 24.545 120-124 26.86 26.465 22.08 24.595 125-129 27.26 26.040000000000003 22.425 24.275 130-134 26.700000000000003 26.705000000000002 23.400000000000002 23.195 135-139 26.51 26.840000000000003 22.84 23.810000000000002 140-144 27.310000000000002 26.165 22.6 23.925 145-149 27.57 27.095000000000002 22.36 22.975 150-151 27.925 26.35 22.1 23.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 2.0 23 1.0 24 1.0 25 3.0 26 6.0 27 5.5 28 2.5 29 5.0 30 7.0 31 13.0 32 16.5 33 17.5 34 26.0 35 34.0 36 39.5 37 46.5 38 62.0 39 89.0 40 103.5 41 107.0 42 123.0 43 136.0 44 130.0 45 135.5 46 146.5 47 147.5 48 150.0 49 131.5 50 122.5 51 127.0 52 113.5 53 112.0 54 122.5 55 113.0 56 105.0 57 113.0 58 116.5 59 112.5 60 110.0 61 108.5 62 97.5 63 92.5 64 87.0 65 78.0 66 75.0 67 75.0 68 73.0 69 63.0 70 55.5 71 44.0 72 37.0 73 35.0 74 26.0 75 20.5 76 17.5 77 13.0 78 10.0 79 6.0 80 3.5 81 4.0 82 4.0 83 1.0 84 0.5 85 1.0 86 0.5 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 1.0 99 1.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.0 #Duplication Level Percentage of deduplicated Percentage of total 1 91.4010989010989 83.175 2 7.637362637362638 13.900000000000002 3 0.8241758241758242 2.25 4 0.054945054945054944 0.2 5 0.054945054945054944 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027472527472527472 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit GCCAGGATGACGCCTACTAAGGACTACCTAAATTTATAATAATGAGCTTT 5 0.125 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.35 0.0 0.0 0.0 0.0 116-117 2.65 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.3375 0.0 0.0 0.0 0.0 124-125 3.7 0.0 0.0 0.0 0.0 126-127 4.1125 0.0 0.0 0.0 0.0 128-129 4.5125 0.0 0.0 0.0 0.0 130-131 4.949999999999999 0.0 0.0 0.0 0.0 132-133 5.25 0.0 0.0 0.0 0.0 134-135 5.699999999999999 0.0 0.0 0.0 0.0 136-137 6.025 0.0 0.0 0.0 0.0 138-139 6.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGAGAT 10 0.006830828 145.0 1 >>END_MODULE Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694299 spots for SRR7814831.sra Written 1694299 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra Read 1694296 spots for SRR7814831.sra Written 1694296 spots for SRR7814831.sra SRR ids: ['SRR7814831.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3t86kg4_ SRR7814831.sra spots: 33885923 blocks: [[1, 1694296], [1694297, 3388592], [3388593, 5082888], [5082889, 6777184], [6777185, 8471480], [8471481, 10165776], [10165777, 11860072], [11860073, 13554368], [13554369, 15248664], [15248665, 16942960], [16942961, 18637256], [18637257, 20331552], [20331553, 22025848], [22025849, 23720144], [23720145, 25414440], [25414441, 27108736], [27108737, 28803032], [28803033, 30497328], [30497329, 32191624], [32191625, 33885923]] SRR7814831 file size 11461127 SRR7814831 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814831 SRR7814831_1.fastq SRR7814831_2.fastq Input file: SRR7814831_1.fastq Paired file: SRR7814831_2.fastq trimmed: SRR7814831-trimmed-pair1.fastq, SRR7814831-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:43:49 2024 >> started Fri Dec 6 11:44:29 2024 >> done (39.534s) 33885923 read pairs processed; of these: 140 ( 0.00%) short read pairs filtered out after trimming by size control 4471 ( 0.01%) empty read pairs filtered out after trimming by size control 33881312 (99.99%) read pairs available; of these: 3477548 (10.26%) trimmed read pairs available after processing 30403764 (89.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 10 0.00% 21 11 0.00% 22 18 0.00% 23 23 0.00% 24 26 0.00% 25 29 0.00% 26 25 0.00% 27 35 0.00% 28 46 0.00% 29 49 0.00% 30 40 0.00% 31 48 0.00% 32 46 0.00% 33 57 0.00% 34 59 0.00% 35 60 0.00% 36 56 0.00% 37 66 0.00% 38 83 0.00% 39 86 0.00% 40 54 0.00% 41 77 0.00% 42 84 0.00% 43 86 0.00% 44 79 0.00% 45 77 0.00% 46 124 0.00% 47 112 0.00% 48 129 0.00% 49 143 0.00% 50 147 0.00% 51 150 0.00% 52 184 0.00% 53 208 0.00% 54 198 0.00% 55 228 0.00% 56 224 0.00% 57 267 0.00% 58 331 0.00% 59 354 0.00% 60 430 0.00% 61 458 0.00% 62 556 0.00% 63 622 0.00% 64 639 0.00% 65 639 0.00% 66 701 0.00% 67 839 0.00% 68 913 0.00% 69 1123 0.00% 70 1285 0.00% 71 1434 0.00% 72 1553 0.00% 73 1828 0.01% 74 1934 0.01% 75 2319 0.01% 76 2529 0.01% 77 2819 0.01% 78 3073 0.01% 79 3460 0.01% 80 4055 0.01% 81 4561 0.01% 82 5201 0.02% 83 5866 0.02% 84 6380 0.02% 85 6978 0.02% 86 7646 0.02% 87 8375 0.02% 88 9246 0.03% 89 9932 0.03% 90 10825 0.03% 91 12135 0.04% 92 13123 0.04% 93 14436 0.04% 94 15991 0.05% 95 17118 0.05% 96 18127 0.05% 97 19162 0.06% 98 20660 0.06% 99 21728 0.06% 100 23202 0.07% 101 24435 0.07% 102 26186 0.08% 103 27985 0.08% 104 29493 0.09% 105 30948 0.09% 106 32062 0.09% 107 33741 0.10% 108 35090 0.10% 109 37191 0.11% 110 37923 0.11% 111 39653 0.12% 112 41900 0.12% 113 43154 0.13% 114 45814 0.14% 115 47780 0.14% 116 49331 0.15% 117 49760 0.15% 118 50658 0.15% 119 52711 0.16% 120 54348 0.16% 121 55730 0.16% 122 57148 0.17% 123 60896 0.18% 124 61589 0.18% 125 63412 0.19% 126 65793 0.19% 127 67002 0.20% 128 68120 0.20% 129 69726 0.21% 130 70272 0.21% 131 72106 0.21% 132 74601 0.22% 133 76644 0.23% 134 77905 0.23% 135 79894 0.24% 136 81724 0.24% 137 81916 0.24% 138 83451 0.25% 139 85467 0.25% 140 86699 0.26% 141 87535 0.26% 142 89934 0.27% 143 91591 0.27% 144 95112 0.28% 145 96389 0.28% 146 96820 0.29% 147 98764 0.29% 148 100037 0.30% 149 100327 0.30% 150 102734 0.30% 151 30403764 89.74% 33881312 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=13 prefix-density=0.76 prefix-fanout=3.3 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=36 fanout-score=73.28 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=4.5 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=14 prefix-density=0.83 prefix-fanout=2.5 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=52.24 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=4.6 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7814831 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:45:20 Started mapping on | Dec 06 11:45:20 Finished on | Dec 06 11:51:07 Mapping speed, Million of reads per hour | 351.51 Number of input reads | 33881312 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 28708116 Uniquely mapped reads % | 84.73% Average mapped length | 295.45 Number of splices: Total | 27825806 Number of splices: Annotated (sjdb) | 26350240 Number of splices: GT/AG | 27409939 Number of splices: GC/AG | 344627 Number of splices: AT/AC | 9890 Number of splices: Non-canonical | 61350 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.02% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1584451 % of reads mapped to multiple loci | 4.68% Number of reads mapped to too many loci | 215478 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.64% % of reads unmapped: other | 4.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3588745 3588745 3588745 N_multimapping 1584451 1584451 1584451 N_noFeature 1972495 27845282 2195436 N_ambiguous 789961 3624 151804 UnstrandedReadsAssigned:25945660 PositiveStrandReadsAssigned:859210 NegativeStrandReadsAssigned:26360876 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814831 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814831-trimmed-pair1.fastq SRR7814831-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,881,312 reads, 27,240,026 reads pseudoaligned [quant] estimated average fragment length: 261.345 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR7814831.ke.tsv 35125 SRR7814831.se.tsv 88098 total ==> SRR7814831.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 676.019 0 0 PNS24247 1044 783.655 65.6265 3.70799 PNS24249 1928 1667.65 126.362 3.35501 PNS24246 1044 783.655 65.6265 3.70799 PNS24248 1044 783.655 65.6265 3.70799 PNS24244 1471 1210.65 195.759 7.15955 PNS24243 293 94.0091 2 0.941987 KQK14069 1603 1342.65 8151 268.801 KQK14071 474 233.428 82.3192 15.6147 ==> SRR7814831.se.tsv <== BRADI_1g14170v3 8446 BRADI_1g53295v3 1253 BRADI_1g59795v3 245 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 447 BRADI_1g74790v3 293 BRADI_1g09890v3 0 BRADI_1g77505v3 625 BRADI_1g48960v3 0 SRR7814831 completed mapping pipeline successfully