Starting /dee2/code/volunteer_pipeline.sh SRR7814832 current disk space = 1551181512704 free memory = 1604589272 SRR7814832 SRAfilesize 8aaecf5e9f44b4f56334c040775bcbec SRR7814832.sra SRR7814832.sra file validated SRR7814832 is paired end SRR7814832 is conventional basespace SRR7814832 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814832_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.392 37.0 37.0 37.0 37.0 37.0 2 36.3135 37.0 37.0 37.0 37.0 37.0 3 36.495 37.0 37.0 37.0 37.0 37.0 4 36.498 37.0 37.0 37.0 37.0 37.0 5 36.5595 37.0 37.0 37.0 37.0 37.0 6 36.5925 37.0 37.0 37.0 37.0 37.0 7 36.4655 37.0 37.0 37.0 37.0 37.0 8 36.4795 37.0 37.0 37.0 37.0 37.0 9 36.5845 37.0 37.0 37.0 37.0 37.0 10-14 36.5641 37.0 37.0 37.0 37.0 37.0 15-19 36.531400000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.4917 37.0 37.0 37.0 37.0 37.0 25-29 36.4595 37.0 37.0 37.0 37.0 37.0 30-34 36.2541 37.0 37.0 37.0 37.0 37.0 35-39 36.1584 37.0 37.0 37.0 37.0 37.0 40-44 36.166199999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.2774 37.0 37.0 37.0 37.0 37.0 50-54 36.316 37.0 37.0 37.0 37.0 37.0 55-59 36.3041 37.0 37.0 37.0 37.0 37.0 60-64 36.24980000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.1562 37.0 37.0 37.0 37.0 37.0 70-74 36.11 37.0 37.0 37.0 37.0 37.0 75-79 36.025099999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.9947 37.0 37.0 37.0 37.0 37.0 85-89 36.0223 37.0 37.0 37.0 37.0 37.0 90-94 35.9661 37.0 37.0 37.0 37.0 37.0 95-99 35.616 37.0 37.0 37.0 37.0 37.0 100-104 35.326 37.0 37.0 37.0 32.2 37.0 105-109 35.4838 37.0 37.0 37.0 34.6 37.0 110-114 35.5932 37.0 37.0 37.0 37.0 37.0 115-119 35.4248 37.0 37.0 37.0 37.0 37.0 120-124 34.7957 37.0 37.0 37.0 25.0 37.0 125-129 34.475699999999996 37.0 37.0 37.0 25.0 37.0 130-134 35.1751 37.0 37.0 37.0 27.4 37.0 135-139 34.9471 37.0 37.0 37.0 25.0 37.0 140-144 35.0354 37.0 37.0 37.0 27.4 37.0 145-149 34.956599999999995 37.0 37.0 37.0 27.4 37.0 150-151 34.192 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 2.0 24 3.0 25 1.0 26 6.0 27 9.0 28 21.0 29 26.0 30 36.0 31 44.0 32 106.0 33 155.0 34 265.0 35 600.0 36 2537.0 37 187.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.8436873747495 10.420841683366733 6.462925851703407 36.27254509018036 2 27.55 12.85 30.275000000000002 29.325000000000003 3 22.975 18.25 24.275 34.5 4 28.1 24.375 19.125 28.4 5 26.875 27.6 23.05 22.475 6 23.425 31.424999999999997 22.85 22.3 7 17.925 21.825 38.3 21.95 8 20.875 22.125 29.099999999999998 27.900000000000002 9 19.375 20.525 32.975 27.125 10-14 24.285 25.845000000000002 23.955000000000002 25.915 15-19 23.945 24.25 25.03 26.775 20-24 23.945 24.495 24.959999999999997 26.6 25-29 24.455 24.395 24.22 26.93 30-34 24.05 24.47 25.355 26.125 35-39 24.235 24.115000000000002 24.154999999999998 27.495000000000005 40-44 24.625 23.52 24.615000000000002 27.24 45-49 24.32 23.76 24.349999999999998 27.57 50-54 24.735 24.15 23.75 27.365000000000002 55-59 24.68 24.2 24.490000000000002 26.63 60-64 25.169999999999998 22.765 24.615000000000002 27.450000000000003 65-69 24.72 23.87 23.93 27.48 70-74 25.2 23.73 23.9 27.169999999999998 75-79 24.490000000000002 23.665 24.39 27.455000000000002 80-84 24.915000000000003 23.064999999999998 24.365000000000002 27.655 85-89 24.95 23.39 24.07 27.589999999999996 90-94 25.69 23.525 24.115000000000002 26.669999999999998 95-99 25.295 23.43 24.04 27.235 100-104 25.264999999999997 23.765 23.93 27.04 105-109 26.400000000000002 23.24 23.575 26.784999999999997 110-114 25.674999999999997 23.599999999999998 23.465 27.26 115-119 25.6 23.785 23.59 27.025 120-124 25.624999999999996 23.385 24.02 26.97 125-129 26.0 23.515 23.52 26.965 130-134 25.25 23.68 23.585 27.485 135-139 25.185000000000002 24.154999999999998 23.235 27.425 140-144 26.14 23.945 22.99 26.924999999999997 145-149 25.840000000000003 23.755000000000003 22.785 27.62 150-151 25.674999999999997 24.1375 22.05 28.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 2.0 28 1.5 29 1.0 30 5.0 31 9.0 32 12.5 33 13.5 34 19.5 35 28.5 36 41.0 37 50.5 38 60.5 39 89.5 40 103.5 41 111.5 42 114.5 43 120.5 44 147.0 45 167.0 46 175.0 47 164.0 48 152.5 49 140.0 50 142.5 51 151.0 52 132.5 53 108.5 54 110.5 55 143.5 56 141.0 57 125.0 58 127.5 59 119.0 60 110.0 61 98.5 62 83.5 63 75.0 64 68.0 65 55.0 66 55.0 67 64.5 68 63.0 69 51.0 70 45.0 71 42.0 72 34.0 73 30.5 74 24.5 75 15.0 76 11.5 77 10.0 78 8.0 79 8.0 80 6.0 81 3.0 82 2.0 83 1.5 84 1.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.99720592344231 80.525 2 8.689578094439787 15.55 3 1.033808326348142 2.775 4 0.13970382788488406 0.5 5 0.11176306230790724 0.5 6 0.02794076557697681 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 6 0.15 No Hit GTCATATCTAGTATTCAGAGTTTGCCTCGATTTGGTACCGCTCGCGCAGC 5 0.125 No Hit GAGGACTTAGAGCGCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGT 5 0.125 No Hit GCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTG 5 0.125 No Hit GTGCGACGTGGGGCTGGATCTCAGTGGATCGTGGCAGCAAGGCCACTCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.2249999999999996 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.85 0.0 0.0 0.0 0.0 122-123 3.3 0.0 0.0 0.0 0.0 124-125 3.65 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.425000000000001 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.525 0.0 0.0 0.0 0.0 134-135 5.9625 0.0 0.0 0.0 0.0 136-137 6.3875 0.0 0.0 0.0 0.0 138-139 7.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814832 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814832_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1355 37.0 37.0 37.0 37.0 37.0 2 35.8775 37.0 37.0 37.0 37.0 37.0 3 35.82 37.0 37.0 37.0 37.0 37.0 4 35.828 37.0 37.0 37.0 37.0 37.0 5 35.907 37.0 37.0 37.0 37.0 37.0 6 35.653 37.0 37.0 37.0 37.0 37.0 7 35.713 37.0 37.0 37.0 37.0 37.0 8 35.6445 37.0 37.0 37.0 37.0 37.0 9 35.9265 37.0 37.0 37.0 37.0 37.0 10-14 35.8593 37.0 37.0 37.0 37.0 37.0 15-19 35.34 37.0 37.0 37.0 34.6 37.0 20-24 35.5727 37.0 37.0 37.0 37.0 37.0 25-29 35.535000000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.245 37.0 37.0 37.0 34.6 37.0 35-39 35.291 37.0 37.0 37.0 34.6 37.0 40-44 34.970600000000005 37.0 37.0 37.0 27.4 37.0 45-49 34.9953 37.0 37.0 37.0 27.4 37.0 50-54 34.337900000000005 37.0 37.0 37.0 25.0 37.0 55-59 34.24550000000001 37.0 37.0 37.0 25.0 37.0 60-64 34.565000000000005 37.0 37.0 37.0 25.0 37.0 65-69 34.5403 37.0 37.0 37.0 25.0 37.0 70-74 34.132 37.0 37.0 37.0 25.0 37.0 75-79 33.931400000000004 37.0 37.0 37.0 22.2 37.0 80-84 33.8535 37.0 37.0 37.0 22.2 37.0 85-89 34.3206 37.0 37.0 37.0 25.0 37.0 90-94 33.8023 37.0 37.0 37.0 25.0 37.0 95-99 32.84570000000001 37.0 37.0 37.0 11.0 37.0 100-104 33.2522 37.0 37.0 37.0 16.6 37.0 105-109 32.726299999999995 37.0 37.0 37.0 13.8 37.0 110-114 33.194300000000005 37.0 37.0 37.0 13.8 37.0 115-119 33.2915 37.0 37.0 37.0 16.6 37.0 120-124 32.4525 37.0 37.0 37.0 11.0 37.0 125-129 32.7554 37.0 37.0 37.0 11.0 37.0 130-134 32.2761 37.0 32.2 37.0 11.0 37.0 135-139 32.2175 37.0 29.8 37.0 11.0 37.0 140-144 32.5185 37.0 37.0 37.0 11.0 37.0 145-149 32.10979999999999 37.0 29.8 37.0 11.0 37.0 150-151 31.58775 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 6.0 16 0.0 17 3.0 18 1.0 19 3.0 20 2.0 21 10.0 22 22.0 23 39.0 24 48.0 25 49.0 26 89.0 27 90.0 28 119.0 29 110.0 30 123.0 31 132.0 32 166.0 33 232.0 34 344.0 35 684.0 36 1687.0 37 38.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.925000000000004 18.25 8.450000000000001 31.374999999999996 2 30.15 21.975 26.625 21.25 3 24.0 24.45 25.825 25.724999999999998 4 28.449999999999996 29.725 18.075 23.75 5 29.4 31.2 17.175 22.225 6 24.75 34.4 18.175 22.675 7 25.05 17.525 31.8 25.624999999999996 8 23.3 22.85 22.475 31.374999999999996 9 25.4 20.849999999999998 25.7 28.050000000000004 10-14 27.575 24.205 21.529999999999998 26.69 15-19 27.089999999999996 24.09 22.439999999999998 26.38 20-24 27.315 24.8 22.555 25.330000000000002 25-29 27.21 24.099999999999998 22.98 25.71 30-34 27.334999999999997 24.54 22.71 25.415 35-39 27.025 24.59 22.81 25.575 40-44 26.865 24.65 22.43 26.055 45-49 26.88 24.099999999999998 22.61 26.41 50-54 27.305 24.97 22.345000000000002 25.380000000000003 55-59 27.115000000000002 24.83 22.46 25.595000000000002 60-64 27.584999999999997 23.855 22.650000000000002 25.91 65-69 26.805 24.595 22.13 26.47 70-74 26.790000000000003 24.81 22.555 25.845000000000002 75-79 27.224999999999998 24.9 22.220000000000002 25.655 80-84 26.974999999999998 24.975 22.605 25.445 85-89 27.515 23.87 22.585 26.029999999999998 90-94 27.250000000000004 24.805 22.325 25.619999999999997 95-99 27.27 25.7 22.23 24.8 100-104 27.01 25.955000000000002 22.09 24.945 105-109 27.29 25.64 22.43 24.64 110-114 26.555 25.455 22.71 25.28 115-119 27.21 24.955 22.48 25.355 120-124 26.87 27.084999999999997 21.790000000000003 24.255 125-129 27.200000000000003 26.255 21.95 24.595 130-134 27.485 27.025 21.63 23.86 135-139 27.565 26.35 22.005 24.08 140-144 28.315 26.205000000000002 21.560000000000002 23.919999999999998 145-149 27.544999999999998 27.185 21.555 23.715 150-151 29.599999999999998 26.025 22.4625 21.912499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 0.5 22 2.0 23 2.5 24 2.0 25 2.0 26 3.5 27 3.5 28 4.0 29 5.0 30 5.5 31 9.5 32 13.0 33 15.5 34 20.5 35 32.5 36 46.0 37 52.5 38 57.0 39 77.0 40 92.0 41 99.5 42 101.5 43 108.5 44 124.5 45 132.0 46 137.0 47 132.0 48 130.5 49 141.0 50 138.5 51 121.5 52 112.5 53 115.5 54 126.0 55 137.0 56 135.5 57 127.5 58 119.5 59 114.0 60 111.5 61 102.0 62 101.5 63 95.5 64 85.0 65 83.5 66 76.0 67 68.5 68 67.5 69 71.5 70 65.0 71 57.0 72 51.0 73 45.0 74 36.0 75 22.0 76 16.5 77 10.5 78 7.5 79 6.0 80 4.0 81 2.0 82 0.5 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 2.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 91.07241569928138 82.375 2 7.711442786069651 13.950000000000001 3 0.9673852957435046 2.625 4 0.13819789939192925 0.5 5 0.055279159756771695 0.25 6 0.055279159756771695 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCG 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.5750000000000002 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 3.0125 0.0 0.0 0.0 0.0 124-125 3.3375000000000004 0.0 0.0 0.0 0.0 126-127 3.6125 0.0 0.0 0.0 0.0 128-129 4.0 0.0 0.0 0.0 0.0 130-131 4.375 0.0 0.0 0.0 0.0 132-133 4.925000000000001 0.0 0.0 0.0 0.0 134-135 5.2625 0.0 0.0 0.0 0.0 136-137 5.525 0.0 0.0 0.0 0.0 138-139 6.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672460 spots for SRR7814832.sra Written 1672460 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra Read 1672455 spots for SRR7814832.sra Written 1672455 spots for SRR7814832.sra SRR ids: ['SRR7814832.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q23iic8a SRR7814832.sra spots: 33449105 blocks: [[1, 1672455], [1672456, 3344910], [3344911, 5017365], [5017366, 6689820], [6689821, 8362275], [8362276, 10034730], [10034731, 11707185], [11707186, 13379640], [13379641, 15052095], [15052096, 16724550], [16724551, 18397005], [18397006, 20069460], [20069461, 21741915], [21741916, 23414370], [23414371, 25086825], [25086826, 26759280], [26759281, 28431735], [28431736, 30104190], [30104191, 31776645], [31776646, 33449105]] SRR7814832 file size 11313103 SRR7814832 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814832 SRR7814832_1.fastq SRR7814832_2.fastq Input file: SRR7814832_1.fastq Paired file: SRR7814832_2.fastq trimmed: SRR7814832-trimmed-pair1.fastq, SRR7814832-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:44:32 2024 >> started Fri Dec 6 11:45:13 2024 >> done (40.665s) 33449105 read pairs processed; of these: 148 ( 0.00%) short read pairs filtered out after trimming by size control 6132 ( 0.02%) empty read pairs filtered out after trimming by size control 33442825 (99.98%) read pairs available; of these: 3406066 (10.18%) trimmed read pairs available after processing 30036759 (89.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 20 0.00% 20 10 0.00% 21 15 0.00% 22 11 0.00% 23 27 0.00% 24 21 0.00% 25 33 0.00% 26 29 0.00% 27 27 0.00% 28 32 0.00% 29 38 0.00% 30 40 0.00% 31 42 0.00% 32 41 0.00% 33 38 0.00% 34 45 0.00% 35 56 0.00% 36 37 0.00% 37 59 0.00% 38 61 0.00% 39 72 0.00% 40 66 0.00% 41 75 0.00% 42 73 0.00% 43 61 0.00% 44 88 0.00% 45 91 0.00% 46 95 0.00% 47 104 0.00% 48 118 0.00% 49 122 0.00% 50 150 0.00% 51 160 0.00% 52 194 0.00% 53 200 0.00% 54 177 0.00% 55 220 0.00% 56 221 0.00% 57 265 0.00% 58 265 0.00% 59 297 0.00% 60 384 0.00% 61 436 0.00% 62 479 0.00% 63 499 0.00% 64 569 0.00% 65 620 0.00% 66 701 0.00% 67 722 0.00% 68 833 0.00% 69 927 0.00% 70 1050 0.00% 71 1231 0.00% 72 1432 0.00% 73 1677 0.01% 74 1739 0.01% 75 1797 0.01% 76 2054 0.01% 77 2316 0.01% 78 2726 0.01% 79 2999 0.01% 80 3367 0.01% 81 3695 0.01% 82 4357 0.01% 83 4841 0.01% 84 5231 0.02% 85 5971 0.02% 86 6731 0.02% 87 7254 0.02% 88 7808 0.02% 89 8395 0.03% 90 9583 0.03% 91 10381 0.03% 92 11616 0.03% 93 12646 0.04% 94 13705 0.04% 95 15187 0.05% 96 16277 0.05% 97 17443 0.05% 98 18573 0.06% 99 19865 0.06% 100 21184 0.06% 101 22915 0.07% 102 24233 0.07% 103 25872 0.08% 104 27673 0.08% 105 28883 0.09% 106 30628 0.09% 107 32367 0.10% 108 33566 0.10% 109 35238 0.11% 110 36710 0.11% 111 38826 0.12% 112 40348 0.12% 113 42190 0.13% 114 44535 0.13% 115 46425 0.14% 116 48596 0.15% 117 49376 0.15% 118 50011 0.15% 119 51878 0.16% 120 54253 0.16% 121 55482 0.17% 122 56886 0.17% 123 59615 0.18% 124 60949 0.18% 125 63259 0.19% 126 65809 0.20% 127 66870 0.20% 128 67863 0.20% 129 69814 0.21% 130 70240 0.21% 131 72081 0.22% 132 74454 0.22% 133 76067 0.23% 134 77931 0.23% 135 79603 0.24% 136 81874 0.24% 137 81575 0.24% 138 81790 0.24% 139 85167 0.25% 140 85203 0.25% 141 87528 0.26% 142 89857 0.27% 143 90740 0.27% 144 93826 0.28% 145 95597 0.29% 146 96669 0.29% 147 99137 0.30% 148 99262 0.30% 149 100234 0.30% 150 103047 0.31% 151 30036759 89.82% 33442825 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=9 prefix-density=0.93 prefix-fanout=3.2 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=10.18 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.8 sequence=AGAACCCGTCGCTGTCTCGGCTGTGATACCGGAGGCTCTAGGGAAGTCGGAGGAGAGAGCACTCATCTTGGGGTGGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCTCCGCACTTGGCTACCCAGCGTTTACCGTAGGCACGATAACTGGTACACCAGAGGTGCGTCCTTCCCGGTCCTCTCGTACTAGGGAAAGGTCCTCTCAATGCTCTAACGCCCACACCGGATATGGACCGAACTGTCTCACGA criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=15 prefix-density=1.01 prefix-fanout=2.3 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=60.04 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=4.4 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7814832 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:46:20 Started mapping on | Dec 06 11:46:20 Finished on | Dec 06 11:50:33 Mapping speed, Million of reads per hour | 475.87 Number of input reads | 33442825 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 28112712 Uniquely mapped reads % | 84.06% Average mapped length | 295.67 Number of splices: Total | 26214042 Number of splices: Annotated (sjdb) | 24776148 Number of splices: GT/AG | 25828236 Number of splices: GC/AG | 318888 Number of splices: AT/AC | 8772 Number of splices: Non-canonical | 58146 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.02% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1674738 % of reads mapped to multiple loci | 5.01% Number of reads mapped to too many loci | 304701 % of reads mapped to too many loci | 0.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.05% % of reads unmapped: other | 5.97% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3655375 3655375 3655375 N_multimapping 1674738 1674738 1674738 N_noFeature 2039436 27247002 2230254 N_ambiguous 834464 3503 160678 UnstrandedReadsAssigned:25238812 PositiveStrandReadsAssigned:862207 NegativeStrandReadsAssigned:25721780 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814832 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814832-trimmed-pair1.fastq SRR7814832-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,442,825 reads, 26,605,724 reads pseudoaligned [quant] estimated average fragment length: 262.343 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 SRR7814832.ke.tsv 35125 SRR7814832.se.tsv 88098 total ==> SRR7814832.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.07 0 0 PNS24247 1044 782.657 60.0463 3.36446 PNS24249 1928 1666.66 146.248 3.84808 PNS24246 1044 782.657 60.0463 3.36446 PNS24248 1044 782.657 60.0463 3.36446 PNS24244 1471 1209.66 126.613 4.59004 PNS24243 293 94.9198 6 2.77201 KQK14069 1603 1341.66 5844.56 191.034 KQK14071 474 233.372 41.4729 7.79321 ==> SRR7814832.se.tsv <== BRADI_1g14170v3 6030 BRADI_1g53295v3 1320 BRADI_1g59795v3 177 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 339 BRADI_1g74790v3 328 BRADI_1g09890v3 0 BRADI_1g77505v3 535 BRADI_1g48960v3 1 SRR7814832 completed mapping pipeline successfully