Starting /dee2/code/volunteer_pipeline.sh SRR7814833 current disk space = 1551324520448 free memory = 1604583396 SRR7814833 SRAfilesize 26f2c685f8fd13912f4d34dd5924344c SRR7814833.sra SRR7814833.sra file validated SRR7814833 is paired end SRR7814833 is conventional basespace SRR7814833 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814833_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.48625 37.0 37.0 37.0 37.0 37.0 2 36.3645 37.0 37.0 37.0 37.0 37.0 3 36.49 37.0 37.0 37.0 37.0 37.0 4 36.5065 37.0 37.0 37.0 37.0 37.0 5 36.569 37.0 37.0 37.0 37.0 37.0 6 36.5045 37.0 37.0 37.0 37.0 37.0 7 36.435 37.0 37.0 37.0 37.0 37.0 8 36.4975 37.0 37.0 37.0 37.0 37.0 9 36.513 37.0 37.0 37.0 37.0 37.0 10-14 36.548899999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5537 37.0 37.0 37.0 37.0 37.0 20-24 36.51369999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.464600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4399 37.0 37.0 37.0 37.0 37.0 35-39 36.4116 37.0 37.0 37.0 37.0 37.0 40-44 36.4013 37.0 37.0 37.0 37.0 37.0 45-49 36.3996 37.0 37.0 37.0 37.0 37.0 50-54 36.341300000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3323 37.0 37.0 37.0 37.0 37.0 60-64 36.349399999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3071 37.0 37.0 37.0 37.0 37.0 70-74 36.3197 37.0 37.0 37.0 37.0 37.0 75-79 36.2911 37.0 37.0 37.0 37.0 37.0 80-84 36.2704 37.0 37.0 37.0 37.0 37.0 85-89 36.2362 37.0 37.0 37.0 37.0 37.0 90-94 36.16930000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.19839999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.194900000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.0928 37.0 37.0 37.0 37.0 37.0 110-114 36.0929 37.0 37.0 37.0 37.0 37.0 115-119 36.052899999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.941700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.967200000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.000099999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9252 37.0 37.0 37.0 37.0 37.0 140-144 35.7912 37.0 37.0 37.0 37.0 37.0 145-149 35.7943 37.0 37.0 37.0 37.0 37.0 150-151 35.22725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 3.0 27 7.0 28 14.0 29 21.0 30 32.0 31 33.0 32 52.0 33 82.0 34 135.0 35 353.0 36 2801.0 37 465.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.23153942428035 12.090112640801001 5.90738423028786 36.77096370463079 2 25.45 12.55 35.65 26.35 3 22.075 20.200000000000003 25.224999999999998 32.5 4 28.075 24.775 20.575 26.575 5 25.974999999999998 29.775000000000002 21.925 22.325 6 21.675 33.475 22.125 22.725 7 18.925 23.35 38.375 19.35 8 20.3 22.725 28.675 28.299999999999997 9 20.65 20.3 34.475 24.575 10-14 23.990000000000002 25.97 24.6 25.44 15-19 23.974999999999998 24.88 24.495 26.650000000000002 20-24 23.78 25.415 24.41 26.395000000000003 25-29 24.385 25.5 24.145 25.97 30-34 24.085 24.85 24.735 26.33 35-39 23.95 24.785 24.57 26.695 40-44 24.585 25.215 24.3 25.900000000000002 45-49 24.37 24.75 24.72 26.16 50-54 24.595 24.735 24.04 26.63 55-59 24.565 24.51 24.955 25.97 60-64 24.295 24.245 24.785 26.674999999999997 65-69 24.65 24.945 23.98 26.424999999999997 70-74 24.779999999999998 24.605 24.44 26.174999999999997 75-79 25.230000000000004 24.165 24.175 26.43 80-84 24.88 24.245 24.625 26.25 85-89 25.105 24.12 23.95 26.825 90-94 24.87 24.555 23.925 26.650000000000002 95-99 23.990000000000002 23.86 25.014999999999997 27.134999999999998 100-104 25.195 24.605 23.73 26.47 105-109 25.695 24.255 23.885 26.165 110-114 25.480000000000004 23.875 24.169999999999998 26.474999999999998 115-119 25.31 24.57 23.585 26.534999999999997 120-124 25.555 24.175 23.810000000000002 26.46 125-129 24.875 24.865000000000002 23.544999999999998 26.715 130-134 25.53 24.240000000000002 23.11 27.12 135-139 25.145 24.275 23.355 27.224999999999998 140-144 25.240000000000002 24.395 23.775 26.590000000000003 145-149 25.46 23.565 23.919999999999998 27.055 150-151 25.837500000000002 23.75 23.0625 27.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 2.0 27 2.5 28 2.5 29 3.5 30 7.0 31 8.5 32 13.0 33 21.0 34 30.0 35 41.5 36 50.0 37 62.5 38 82.5 39 102.5 40 112.5 41 121.0 42 133.5 43 152.5 44 173.5 45 181.5 46 194.5 47 179.0 48 157.5 49 170.5 50 159.0 51 133.5 52 117.5 53 109.5 54 99.0 55 82.0 56 87.5 57 95.0 58 84.5 59 78.5 60 76.5 61 72.5 62 77.0 63 76.0 64 66.0 65 69.5 66 72.0 67 68.5 68 63.5 69 52.5 70 48.5 71 47.0 72 38.0 73 28.5 74 21.5 75 17.5 76 16.5 77 11.0 78 6.5 79 6.5 80 4.5 81 3.0 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.8 #Duplication Level Percentage of deduplicated Percentage of total 1 90.94162995594714 82.575 2 8.122246696035242 14.75 3 0.8259911894273128 2.25 4 0.08259911894273128 0.3 5 0.027533039647577095 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGGTTTAAGATCCAGCTTGTCCACAAACTCCTTTGTGGTTTCGAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.3 0.0 0.0 0.0 0.0 104-105 1.6375 0.0 0.0 0.0 0.0 106-107 1.8625 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.2625 0.0 0.0 0.0 0.0 120-121 3.5375 0.0 0.0 0.0 0.0 122-123 3.9125 0.0 0.0 0.0 0.0 124-125 4.1875 0.0 0.0 0.0 0.0 126-127 4.675 0.0 0.0 0.0 0.0 128-129 5.225 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.112500000000001 0.0 0.0 0.0 0.0 134-135 6.475 0.0 0.0 0.0 0.0 136-137 6.925 0.0 0.0 0.0 0.0 138-139 7.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATGC 10 0.006830828 145.0 6 >>END_MODULE SRR7814833 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814833_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9695 37.0 37.0 37.0 37.0 37.0 2 35.7485 37.0 37.0 37.0 37.0 37.0 3 35.838 37.0 37.0 37.0 37.0 37.0 4 36.043 37.0 37.0 37.0 37.0 37.0 5 35.9555 37.0 37.0 37.0 37.0 37.0 6 35.916 37.0 37.0 37.0 37.0 37.0 7 35.8265 37.0 37.0 37.0 37.0 37.0 8 36.0265 37.0 37.0 37.0 37.0 37.0 9 36.088 37.0 37.0 37.0 37.0 37.0 10-14 36.0881 37.0 37.0 37.0 37.0 37.0 15-19 36.0125 37.0 37.0 37.0 37.0 37.0 20-24 36.0605 37.0 37.0 37.0 37.0 37.0 25-29 35.910700000000006 37.0 37.0 37.0 37.0 37.0 30-34 35.962599999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.9064 37.0 37.0 37.0 37.0 37.0 40-44 35.9353 37.0 37.0 37.0 37.0 37.0 45-49 35.9224 37.0 37.0 37.0 37.0 37.0 50-54 35.8013 37.0 37.0 37.0 37.0 37.0 55-59 35.720600000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.7037 37.0 37.0 37.0 37.0 37.0 65-69 35.6905 37.0 37.0 37.0 37.0 37.0 70-74 35.719500000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.6083 37.0 37.0 37.0 37.0 37.0 80-84 35.5178 37.0 37.0 37.0 37.0 37.0 85-89 35.4748 37.0 37.0 37.0 37.0 37.0 90-94 35.46300000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.4799 37.0 37.0 37.0 37.0 37.0 100-104 35.446999999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.4439 37.0 37.0 37.0 37.0 37.0 110-114 35.317499999999995 37.0 37.0 37.0 32.2 37.0 115-119 35.2239 37.0 37.0 37.0 29.8 37.0 120-124 35.214299999999994 37.0 37.0 37.0 27.4 37.0 125-129 35.22950000000001 37.0 37.0 37.0 29.8 37.0 130-134 35.1438 37.0 37.0 37.0 29.8 37.0 135-139 34.9493 37.0 37.0 37.0 25.0 37.0 140-144 34.734 37.0 37.0 37.0 25.0 37.0 145-149 34.803999999999995 37.0 37.0 37.0 25.0 37.0 150-151 34.10725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 5.0 17 1.0 18 3.0 19 1.0 20 2.0 21 6.0 22 3.0 23 14.0 24 7.0 25 8.0 26 11.0 27 18.0 28 18.0 29 23.0 30 45.0 31 59.0 32 103.0 33 155.0 34 266.0 35 723.0 36 2382.0 37 144.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.775 18.85 7.85 33.525 2 30.175 20.875 27.6 21.349999999999998 3 24.224999999999998 23.0 28.249999999999996 24.525 4 27.85 29.7 19.475 22.975 5 27.725 32.475 17.625 22.175 6 24.3 33.975 18.7 23.025000000000002 7 22.8 18.775 34.050000000000004 24.375 8 23.65 22.825 23.724999999999998 29.799999999999997 9 24.25 20.9 25.424999999999997 29.425 10-14 26.040000000000003 24.665 22.145 27.150000000000002 15-19 26.450000000000003 23.919999999999998 23.005 26.625 20-24 26.6 24.154999999999998 23.01 26.235000000000003 25-29 26.85 24.005000000000003 22.645 26.5 30-34 26.090000000000003 24.67 23.055 26.185000000000002 35-39 26.375 24.195 22.6 26.83 40-44 26.590000000000003 24.025 22.86 26.525 45-49 26.825 24.195 23.115 25.865 50-54 26.38 24.32 23.150000000000002 26.150000000000002 55-59 26.305 24.335 23.055 26.305 60-64 26.229999999999997 23.505000000000003 23.48 26.784999999999997 65-69 26.96 23.53 23.075000000000003 26.435 70-74 27.200000000000003 23.825 23.400000000000002 25.575 75-79 26.57 24.08 22.81 26.540000000000003 80-84 26.83 23.36 23.674999999999997 26.135 85-89 26.99 23.7 22.955000000000002 26.355 90-94 26.540000000000003 23.275000000000002 24.15 26.035000000000004 95-99 26.41 23.835 23.615 26.14 100-104 26.865 24.044999999999998 23.189999999999998 25.900000000000002 105-109 26.75 24.785 22.93 25.535000000000004 110-114 27.365000000000002 24.14 23.244999999999997 25.25 115-119 27.839999999999996 24.37 23.255 24.535 120-124 27.224999999999998 24.485 23.07 25.22 125-129 28.055000000000003 24.055 22.73 25.16 130-134 27.93 24.5 22.46 25.11 135-139 27.48 25.085 22.855 24.58 140-144 28.58 24.4 23.055 23.965 145-149 27.76 24.87 22.805 24.565 150-151 28.7 25.0 22.5 23.799999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 0.5 27 2.5 28 3.0 29 4.0 30 4.5 31 6.0 32 9.5 33 11.0 34 19.0 35 27.5 36 33.5 37 44.0 38 61.0 39 73.0 40 94.0 41 112.5 42 110.0 43 127.0 44 154.0 45 161.5 46 157.0 47 155.5 48 166.0 49 171.0 50 152.5 51 130.0 52 120.0 53 100.5 54 94.0 55 106.0 56 90.0 57 85.5 58 93.5 59 92.0 60 97.0 61 91.0 62 93.5 63 93.0 64 80.5 65 85.5 66 87.0 67 79.0 68 80.0 69 73.0 70 68.0 71 61.0 72 49.0 73 45.5 74 35.5 75 26.0 76 19.0 77 15.0 78 12.5 79 9.5 80 6.5 81 3.5 82 2.0 83 1.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.85 #Duplication Level Percentage of deduplicated Percentage of total 1 91.38690148596588 83.025 2 7.539900935608146 13.700000000000001 3 0.8805723720418271 2.4 4 0.0825536598789213 0.3 5 0.0275178866263071 0.125 6 0.0825536598789213 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit GTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCAGCGTCCATGAT 6 0.15 No Hit CTTCAGTTCTCACTCCACAGCTCAGAGTCAGAGCTACTAGCAATGGCAGC 6 0.15 No Hit CGGGACCAATGGAATGATCTTCATTCGTGGTTTCAGAAGTCTGAAATTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.6125 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.2625 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 3.9375 0.0 0.0 0.0 0.0 124-125 4.2 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 5.25 0.0 0.0 0.0 0.0 130-131 5.675 0.0 0.0 0.0 0.0 132-133 6.137499999999999 0.0 0.0 0.0 0.0 134-135 6.5 0.0 0.0 0.0 0.0 136-137 6.9625 0.0 0.0 0.0 0.0 138-139 7.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.00593511 29.0 25-29 >>END_MODULE Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317772 spots for SRR7814833.sra Written 2317772 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra Read 2317757 spots for SRR7814833.sra Written 2317757 spots for SRR7814833.sra SRR ids: ['SRR7814833.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4ay4bmc9 SRR7814833.sra spots: 46355155 blocks: [[1, 2317757], [2317758, 4635514], [4635515, 6953271], [6953272, 9271028], [9271029, 11588785], [11588786, 13906542], [13906543, 16224299], [16224300, 18542056], [18542057, 20859813], [20859814, 23177570], [23177571, 25495327], [25495328, 27813084], [27813085, 30130841], [30130842, 32448598], [32448599, 34766355], [34766356, 37084112], [37084113, 39401869], [39401870, 41719626], [41719627, 44037383], [44037384, 46355155]] SRR7814833 file size 15686540 SRR7814833 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814833 SRR7814833_1.fastq SRR7814833_2.fastq Input file: SRR7814833_1.fastq Paired file: SRR7814833_2.fastq trimmed: SRR7814833-trimmed-pair1.fastq, SRR7814833-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:48:49 2024 >> started Fri Dec 6 11:49:54 2024 >> done (64.907s) 46355155 read pairs processed; of these: 338 ( 0.00%) short read pairs filtered out after trimming by size control 3368 ( 0.01%) empty read pairs filtered out after trimming by size control 46351449 (99.99%) read pairs available; of these: 4832182 (10.43%) trimmed read pairs available after processing 41519267 (89.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 21 0.00% 20 21 0.00% 21 18 0.00% 22 40 0.00% 23 28 0.00% 24 47 0.00% 25 48 0.00% 26 47 0.00% 27 58 0.00% 28 60 0.00% 29 54 0.00% 30 57 0.00% 31 50 0.00% 32 81 0.00% 33 67 0.00% 34 75 0.00% 35 83 0.00% 36 74 0.00% 37 90 0.00% 38 108 0.00% 39 113 0.00% 40 100 0.00% 41 125 0.00% 42 121 0.00% 43 138 0.00% 44 123 0.00% 45 150 0.00% 46 137 0.00% 47 163 0.00% 48 217 0.00% 49 258 0.00% 50 220 0.00% 51 273 0.00% 52 358 0.00% 53 352 0.00% 54 345 0.00% 55 404 0.00% 56 442 0.00% 57 450 0.00% 58 608 0.00% 59 667 0.00% 60 890 0.00% 61 954 0.00% 62 1123 0.00% 63 1215 0.00% 64 1245 0.00% 65 1286 0.00% 66 1556 0.00% 67 1727 0.00% 68 1994 0.00% 69 2161 0.00% 70 2577 0.01% 71 2918 0.01% 72 3452 0.01% 73 3988 0.01% 74 4324 0.01% 75 4718 0.01% 76 5268 0.01% 77 5656 0.01% 78 6459 0.01% 79 7573 0.02% 80 8269 0.02% 81 9353 0.02% 82 10624 0.02% 83 11720 0.03% 84 12901 0.03% 85 13842 0.03% 86 14998 0.03% 87 16060 0.03% 88 17616 0.04% 89 18657 0.04% 90 20482 0.04% 91 22191 0.05% 92 24621 0.05% 93 26524 0.06% 94 28632 0.06% 95 30292 0.07% 96 31567 0.07% 97 33399 0.07% 98 34858 0.08% 99 36563 0.08% 100 38547 0.08% 101 41245 0.09% 102 43756 0.09% 103 45757 0.10% 104 48392 0.10% 105 49783 0.11% 106 51801 0.11% 107 52838 0.11% 108 54307 0.12% 109 56535 0.12% 110 57997 0.13% 111 60166 0.13% 112 63521 0.14% 113 65294 0.14% 114 68236 0.15% 115 70948 0.15% 116 72173 0.16% 117 72692 0.16% 118 73875 0.16% 119 75099 0.16% 120 77438 0.17% 121 78359 0.17% 122 80440 0.17% 123 83316 0.18% 124 86700 0.19% 125 88028 0.19% 126 90797 0.20% 127 90474 0.20% 128 91018 0.20% 129 93425 0.20% 130 93887 0.20% 131 95684 0.21% 132 98420 0.21% 133 100867 0.22% 134 102549 0.22% 135 104414 0.23% 136 105879 0.23% 137 105446 0.23% 138 107428 0.23% 139 108622 0.23% 140 108483 0.23% 141 110213 0.24% 142 113866 0.25% 143 114187 0.25% 144 118128 0.25% 145 120117 0.26% 146 120738 0.26% 147 121986 0.26% 148 121506 0.26% 149 121913 0.26% 150 123731 0.27% 151 41519267 89.57% 46351449 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=14 prefix-density=0.75 prefix-fanout=3.3 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=48.18 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=4.01 fanout-score-rank=14 prefix-density=0.66 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=16.12 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.8 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR7814833 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:51:45 Started mapping on | Dec 06 11:51:46 Finished on | Dec 06 11:57:39 Mapping speed, Million of reads per hour | 472.71 Number of input reads | 46351449 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 39010364 Uniquely mapped reads % | 84.16% Average mapped length | 289.23 Number of splices: Total | 38154070 Number of splices: Annotated (sjdb) | 36000286 Number of splices: GT/AG | 37604299 Number of splices: GC/AG | 440376 Number of splices: AT/AC | 13882 Number of splices: Non-canonical | 95513 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 3.07 Insertion rate per base | 0.02% Insertion average length | 2.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 668209 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 82848 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.36% % of reads unmapped: other | 0.85% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6672876 6672876 6672876 N_multimapping 668209 668209 668209 N_noFeature 1437398 37878931 1767481 N_ambiguous 1042608 6574 243126 UnstrandedReadsAssigned:36530358 PositiveStrandReadsAssigned:1124859 NegativeStrandReadsAssigned:36999757 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814833 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814833-trimmed-pair1.fastq SRR7814833-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 46,351,449 reads, 40,705,359 reads pseudoaligned [quant] estimated average fragment length: 268.455 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52973 SRR7814833.ke.tsv 35125 SRR7814833.se.tsv 88098 total ==> SRR7814833.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.965 0 0 PNS24247 1044 776.545 131.035 5.60282 PNS24249 1928 1660.55 305.285 6.10439 PNS24246 1044 776.545 131.035 5.60282 PNS24248 1044 776.545 131.035 5.60282 PNS24244 1471 1203.55 137.611 3.79645 PNS24243 293 101.041 1 0.328617 KQK14069 1603 1335.55 35500.9 882.609 KQK14071 474 233.831 618.426 87.8157 ==> SRR7814833.se.tsv <== BRADI_1g14170v3 35122 BRADI_1g53295v3 4246 BRADI_1g59795v3 310 BRADI_1g07683v3 0 BRADI_1g00485v3 59 BRADI_1g20270v3 2842 BRADI_1g74790v3 848 BRADI_1g09890v3 21 BRADI_1g77505v3 461 BRADI_1g48960v3 0 SRR7814833 completed mapping pipeline successfully