Starting /dee2/code/volunteer_pipeline.sh SRR7814834 current disk space = 1551386390528 free memory = 1604575292 SRR7814834 SRAfilesize d8f282f4ff012bdb7ba2a3ed32130bc5 SRR7814834.sra SRR7814834.sra file validated SRR7814834 is paired end SRR7814834 is conventional basespace SRR7814834 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814834_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3695 37.0 37.0 37.0 37.0 37.0 2 36.286 37.0 37.0 37.0 37.0 37.0 3 36.382 37.0 37.0 37.0 37.0 37.0 4 36.4855 37.0 37.0 37.0 37.0 37.0 5 36.483 37.0 37.0 37.0 37.0 37.0 6 36.4275 37.0 37.0 37.0 37.0 37.0 7 36.4385 37.0 37.0 37.0 37.0 37.0 8 36.5425 37.0 37.0 37.0 37.0 37.0 9 36.5795 37.0 37.0 37.0 37.0 37.0 10-14 36.5124 37.0 37.0 37.0 37.0 37.0 15-19 36.4832 37.0 37.0 37.0 37.0 37.0 20-24 36.4752 37.0 37.0 37.0 37.0 37.0 25-29 36.4308 37.0 37.0 37.0 37.0 37.0 30-34 36.39640000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.3711 37.0 37.0 37.0 37.0 37.0 40-44 36.3457 37.0 37.0 37.0 37.0 37.0 45-49 36.3818 37.0 37.0 37.0 37.0 37.0 50-54 36.3085 37.0 37.0 37.0 37.0 37.0 55-59 36.2762 37.0 37.0 37.0 37.0 37.0 60-64 36.2919 37.0 37.0 37.0 37.0 37.0 65-69 36.2633 37.0 37.0 37.0 37.0 37.0 70-74 36.276300000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.291799999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.1881 37.0 37.0 37.0 37.0 37.0 85-89 36.1888 37.0 37.0 37.0 37.0 37.0 90-94 36.158 37.0 37.0 37.0 37.0 37.0 95-99 36.126099999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.1303 37.0 37.0 37.0 37.0 37.0 105-109 36.1091 37.0 37.0 37.0 37.0 37.0 110-114 36.0946 37.0 37.0 37.0 37.0 37.0 115-119 35.9848 37.0 37.0 37.0 37.0 37.0 120-124 35.86 37.0 37.0 37.0 37.0 37.0 125-129 35.9253 37.0 37.0 37.0 37.0 37.0 130-134 35.866 37.0 37.0 37.0 37.0 37.0 135-139 35.8589 37.0 37.0 37.0 37.0 37.0 140-144 35.8304 37.0 37.0 37.0 37.0 37.0 145-149 35.8671 37.0 37.0 37.0 37.0 37.0 150-151 35.15675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 3.0 26 4.0 27 6.0 28 19.0 29 27.0 30 41.0 31 42.0 32 53.0 33 62.0 34 145.0 35 329.0 36 2847.0 37 421.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.13855421686747 11.094377510040161 5.697791164658635 36.06927710843373 2 26.05 14.249999999999998 31.474999999999998 28.225 3 22.175 18.925 22.375 36.525 4 28.925 25.3 19.5 26.275 5 27.775 29.299999999999997 22.125 20.8 6 22.900000000000002 30.15 24.175 22.775000000000002 7 19.275000000000002 22.2 37.75 20.775 8 20.724999999999998 21.675 29.325000000000003 28.275 9 22.175 20.375 31.15 26.3 10-14 24.115000000000002 25.924999999999997 23.845 26.115 15-19 24.09 24.33 24.825 26.755000000000003 20-24 24.365000000000002 25.115 24.58 25.94 25-29 24.560000000000002 25.014999999999997 23.82 26.605 30-34 24.279999999999998 24.39 24.875 26.455000000000002 35-39 24.38 24.46 24.6 26.56 40-44 24.675 24.695 23.96 26.669999999999998 45-49 24.41 24.224999999999998 23.93 27.435 50-54 24.025 24.03 24.46 27.485 55-59 24.46 24.605 24.32 26.615 60-64 24.925 24.145 24.075 26.855 65-69 24.7 24.085 24.85 26.365 70-74 25.330000000000002 24.36 24.044999999999998 26.265 75-79 24.815 23.645 23.995 27.544999999999998 80-84 25.06 24.69 23.845 26.405 85-89 24.93 24.16 23.935000000000002 26.974999999999998 90-94 25.014999999999997 24.19 23.995 26.8 95-99 25.264999999999997 23.705000000000002 24.365000000000002 26.665 100-104 25.71 23.93 24.03 26.33 105-109 26.165 23.645 23.705000000000002 26.484999999999996 110-114 25.324999999999996 24.795 23.815 26.064999999999998 115-119 25.46 23.849999999999998 23.955000000000002 26.735 120-124 24.91 24.884999999999998 23.595 26.61 125-129 25.545 24.135 23.45 26.87 130-134 25.795 24.34 23.615 26.25 135-139 25.369999999999997 24.08 23.385 27.165 140-144 25.455 23.98 23.56 27.005000000000003 145-149 25.795 23.974999999999998 23.65 26.58 150-151 25.8125 24.4 22.825 26.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 2.0 29 5.0 30 7.5 31 11.0 32 14.0 33 18.5 34 24.5 35 29.5 36 34.0 37 49.5 38 74.5 39 94.0 40 98.0 41 122.5 42 153.0 43 163.5 44 165.0 45 155.5 46 162.0 47 162.5 48 174.5 49 165.0 50 140.0 51 131.5 52 116.0 53 119.5 54 109.0 55 98.0 56 104.5 57 101.0 58 88.5 59 83.5 60 94.0 61 94.0 62 82.5 63 80.0 64 74.0 65 64.0 66 67.0 67 65.0 68 68.5 69 72.0 70 55.0 71 41.0 72 35.5 73 28.5 74 26.5 75 23.5 76 14.5 77 9.5 78 7.0 79 6.0 80 5.0 81 4.0 82 1.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.95 #Duplication Level Percentage of deduplicated Percentage of total 1 92.38716693855356 84.95 2 6.634040239260468 12.2 3 0.8428493746601413 2.325 4 0.1087547580206634 0.4 5 0.02718868950516585 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGATGTCCGTAGATCATAGGTCCGCTTAATGTGAGTCCTTTAGAGGTAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 3.025 0.0 0.0 0.0 0.0 120-121 3.4875 0.0 0.0 0.0 0.0 122-123 3.8 0.0 0.0 0.0 0.0 124-125 4.1625 0.0 0.0 0.0 0.0 126-127 4.525 0.0 0.0 0.0 0.0 128-129 5.15 0.0 0.0 0.0 0.0 130-131 5.5375 0.0 0.0 0.0 0.0 132-133 5.85 0.0 0.0 0.0 0.0 134-135 6.275 0.0 0.0 0.0 0.0 136-137 6.800000000000001 0.0 0.0 0.0 0.0 138-139 7.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACATC 10 0.006830828 145.0 6 >>END_MODULE SRR7814834 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814834_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.254 37.0 37.0 37.0 37.0 37.0 2 35.9545 37.0 37.0 37.0 37.0 37.0 3 36.0625 37.0 37.0 37.0 37.0 37.0 4 36.031 37.0 37.0 37.0 37.0 37.0 5 36.177 37.0 37.0 37.0 37.0 37.0 6 36.2025 37.0 37.0 37.0 37.0 37.0 7 36.0895 37.0 37.0 37.0 37.0 37.0 8 36.1905 37.0 37.0 37.0 37.0 37.0 9 36.091 37.0 37.0 37.0 37.0 37.0 10-14 36.135000000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.0178 37.0 37.0 37.0 37.0 37.0 20-24 36.0467 37.0 37.0 37.0 37.0 37.0 25-29 36.0128 37.0 37.0 37.0 37.0 37.0 30-34 35.9939 37.0 37.0 37.0 37.0 37.0 35-39 35.951299999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.005900000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.9011 37.0 37.0 37.0 37.0 37.0 50-54 35.876099999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.812599999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.789300000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.743700000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.815 37.0 37.0 37.0 37.0 37.0 75-79 35.7317 37.0 37.0 37.0 37.0 37.0 80-84 35.6524 37.0 37.0 37.0 37.0 37.0 85-89 35.6595 37.0 37.0 37.0 37.0 37.0 90-94 35.64919999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.563 37.0 37.0 37.0 37.0 37.0 100-104 35.5658 37.0 37.0 37.0 37.0 37.0 105-109 35.567299999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.53789999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.4195 37.0 37.0 37.0 37.0 37.0 120-124 35.4488 37.0 37.0 37.0 34.6 37.0 125-129 35.317899999999995 37.0 37.0 37.0 34.6 37.0 130-134 35.3557 37.0 37.0 37.0 34.6 37.0 135-139 35.12179999999999 37.0 37.0 37.0 27.4 37.0 140-144 34.8953 37.0 37.0 37.0 25.0 37.0 145-149 34.931599999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.21025 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 7.0 15 3.0 16 2.0 17 4.0 18 1.0 19 3.0 20 5.0 21 5.0 22 9.0 23 7.0 24 12.0 25 9.0 26 8.0 27 12.0 28 12.0 29 23.0 30 34.0 31 48.0 32 77.0 33 103.0 34 236.0 35 641.0 36 2554.0 37 182.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.325 17.525 7.375 32.775 2 29.425 23.625 24.474999999999998 22.475 3 22.825 24.625 26.325 26.224999999999998 4 27.450000000000003 30.099999999999998 18.475 23.974999999999998 5 28.375 31.85 19.0 20.775 6 23.0 34.449999999999996 19.5 23.05 7 24.05 19.025 32.125 24.8 8 22.650000000000002 21.975 22.55 32.824999999999996 9 23.3 23.025000000000002 26.075 27.6 10-14 27.33 25.115 21.415 26.14 15-19 26.41 24.445 22.98 26.165 20-24 26.63 24.555 22.795 26.02 25-29 26.38 24.465 22.895 26.26 30-34 26.575 23.974999999999998 23.115 26.334999999999997 35-39 26.540000000000003 24.115000000000002 22.869999999999997 26.474999999999998 40-44 27.565 23.794999999999998 22.770000000000003 25.869999999999997 45-49 26.295 24.625 22.785 26.295 50-54 26.775 23.845 22.830000000000002 26.55 55-59 26.919999999999998 23.555 23.09 26.435 60-64 27.0 23.599999999999998 23.294999999999998 26.105 65-69 26.775 24.04 23.425 25.759999999999998 70-74 26.91 24.455 22.43 26.205000000000002 75-79 26.625 24.0 23.105 26.27 80-84 26.919999999999998 23.76 23.01 26.31 85-89 27.765 23.71 22.79 25.735000000000003 90-94 27.439999999999998 23.875 23.294999999999998 25.39 95-99 27.105 24.9 22.82 25.174999999999997 100-104 27.505000000000003 23.995 22.84 25.66 105-109 27.52 24.915000000000003 22.915 24.65 110-114 27.644999999999996 24.705 22.07 25.580000000000002 115-119 26.845000000000002 24.85 22.395 25.91 120-124 27.744999999999997 24.990000000000002 22.18 25.085 125-129 27.834999999999997 24.81 22.675 24.68 130-134 27.715 24.740000000000002 22.64 24.905 135-139 28.315 24.595 22.785 24.305 140-144 28.95 24.34 22.615 24.095 145-149 28.73 24.84 22.88 23.549999999999997 150-151 29.4875 23.925 22.05 24.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 0.5 25 0.5 26 2.0 27 4.5 28 5.5 29 5.5 30 9.0 31 8.5 32 6.5 33 14.0 34 20.0 35 21.0 36 25.0 37 39.0 38 50.0 39 56.0 40 84.5 41 115.5 42 138.0 43 157.5 44 163.0 45 157.5 46 157.5 47 153.0 48 149.5 49 144.0 50 136.0 51 126.0 52 106.5 53 100.0 54 103.0 55 106.5 56 95.0 57 101.0 58 118.0 59 108.5 60 97.5 61 90.5 62 96.0 63 103.5 64 94.5 65 83.0 66 75.5 67 76.5 68 79.0 69 73.5 70 68.0 71 61.0 72 48.5 73 35.5 74 25.5 75 19.5 76 15.5 77 12.0 78 7.5 79 6.5 80 5.0 81 2.5 82 3.0 83 4.0 84 2.0 85 0.0 86 0.5 87 1.0 88 1.0 89 1.0 90 1.0 91 0.5 92 0.5 93 0.5 94 1.0 95 2.0 96 2.0 97 1.0 98 0.0 99 1.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.675 #Duplication Level Percentage of deduplicated Percentage of total 1 92.25524952277065 84.575 2 6.790291791655304 12.45 3 0.763566948459231 2.1 4 0.13635124079629124 0.5 5 0.02727024815925825 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02727024815925825 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit AGTACATCGAGGCTGGTAACAGCGAGCACGCCAGATCCCTTGGTCCCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.2625 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.9875 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.725 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.4 0.0 0.0 0.0 0.0 122-123 3.725 0.0 0.0 0.0 0.0 124-125 4.075 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 5.050000000000001 0.0 0.0 0.0 0.0 130-131 5.4375 0.0 0.0 0.0 0.0 132-133 5.75 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.675000000000001 0.0 0.0 0.0 0.0 138-139 7.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356908 spots for SRR7814834.sra Written 3356908 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra Read 3356904 spots for SRR7814834.sra Written 3356904 spots for SRR7814834.sra SRR ids: ['SRR7814834.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u61zmsc4 SRR7814834.sra spots: 67138084 blocks: [[1, 3356904], [3356905, 6713808], [6713809, 10070712], [10070713, 13427616], [13427617, 16784520], [16784521, 20141424], [20141425, 23498328], [23498329, 26855232], [26855233, 30212136], [30212137, 33569040], [33569041, 36925944], [36925945, 40282848], [40282849, 43639752], [43639753, 46996656], [46996657, 50353560], [50353561, 53710464], [53710465, 57067368], [57067369, 60424272], [60424273, 63781176], [63781177, 67138084]] SRR7814834 file size 22729193 SRR7814834 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814834 SRR7814834_1.fastq SRR7814834_2.fastq Input file: SRR7814834_1.fastq Paired file: SRR7814834_2.fastq trimmed: SRR7814834-trimmed-pair1.fastq, SRR7814834-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:52:35 2024 >> started Fri Dec 6 11:53:53 2024 >> done (78.861s) 67138084 read pairs processed; of these: 276 ( 0.00%) short read pairs filtered out after trimming by size control 21596 ( 0.03%) empty read pairs filtered out after trimming by size control 67116212 (99.97%) read pairs available; of these: 6244167 ( 9.30%) trimmed read pairs available after processing 60872045 (90.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 21 0.00% 20 19 0.00% 21 19 0.00% 22 19 0.00% 23 23 0.00% 24 30 0.00% 25 40 0.00% 26 34 0.00% 27 28 0.00% 28 48 0.00% 29 47 0.00% 30 45 0.00% 31 60 0.00% 32 58 0.00% 33 66 0.00% 34 59 0.00% 35 69 0.00% 36 68 0.00% 37 85 0.00% 38 78 0.00% 39 95 0.00% 40 113 0.00% 41 99 0.00% 42 116 0.00% 43 119 0.00% 44 91 0.00% 45 122 0.00% 46 130 0.00% 47 156 0.00% 48 171 0.00% 49 189 0.00% 50 218 0.00% 51 275 0.00% 52 266 0.00% 53 258 0.00% 54 288 0.00% 55 326 0.00% 56 360 0.00% 57 417 0.00% 58 447 0.00% 59 524 0.00% 60 658 0.00% 61 721 0.00% 62 826 0.00% 63 857 0.00% 64 961 0.00% 65 979 0.00% 66 1139 0.00% 67 1335 0.00% 68 1422 0.00% 69 1683 0.00% 70 1970 0.00% 71 2257 0.00% 72 2603 0.00% 73 2877 0.00% 74 3103 0.00% 75 3463 0.01% 76 4081 0.01% 77 4455 0.01% 78 4873 0.01% 79 5551 0.01% 80 6283 0.01% 81 7414 0.01% 82 8045 0.01% 83 9047 0.01% 84 10143 0.02% 85 11111 0.02% 86 12367 0.02% 87 13347 0.02% 88 14511 0.02% 89 15990 0.02% 90 17722 0.03% 91 19728 0.03% 92 21614 0.03% 93 23267 0.03% 94 25555 0.04% 95 27726 0.04% 96 29743 0.04% 97 31921 0.05% 98 33478 0.05% 99 35530 0.05% 100 38308 0.06% 101 41099 0.06% 102 43682 0.07% 103 47034 0.07% 104 49828 0.07% 105 52126 0.08% 106 55451 0.08% 107 57842 0.09% 108 60399 0.09% 109 63438 0.09% 110 65294 0.10% 111 68633 0.10% 112 72854 0.11% 113 75938 0.11% 114 79662 0.12% 115 83587 0.12% 116 85906 0.13% 117 88783 0.13% 118 91106 0.14% 119 93556 0.14% 120 97069 0.14% 121 99372 0.15% 122 102540 0.15% 123 106529 0.16% 124 110935 0.17% 125 114127 0.17% 126 118125 0.18% 127 120847 0.18% 128 122689 0.18% 129 125628 0.19% 130 128716 0.19% 131 130722 0.19% 132 135377 0.20% 133 139498 0.21% 134 142959 0.21% 135 146845 0.22% 136 148946 0.22% 137 150472 0.22% 138 153753 0.23% 139 158188 0.24% 140 159553 0.24% 141 162411 0.24% 142 167672 0.25% 143 170215 0.25% 144 176143 0.26% 145 179288 0.27% 146 181006 0.27% 147 185515 0.28% 148 187805 0.28% 149 188474 0.28% 150 192155 0.29% 151 60872045 90.70% 67116212 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=12 prefix-density=0.75 prefix-fanout=3.3 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=61.68 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=2.4 sequence=TGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTT criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=4.06 fanout-score-rank=9 prefix-density=0.73 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=26 fanout-score=11.57 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=3.8 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR7814834 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:54:37 Started mapping on | Dec 06 11:54:37 Finished on | Dec 06 12:02:01 Mapping speed, Million of reads per hour | 544.19 Number of input reads | 67116212 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 63293334 Uniquely mapped reads % | 94.30% Average mapped length | 296.56 Number of splices: Total | 60599766 Number of splices: Annotated (sjdb) | 57282889 Number of splices: GT/AG | 59772020 Number of splices: GC/AG | 665522 Number of splices: AT/AC | 29786 Number of splices: Non-canonical | 132438 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.06 Insertion rate per base | 0.02% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1115795 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 90805 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.04% % of reads unmapped: other | 0.85% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2707083 2707083 2707083 N_multimapping 1115795 1115795 1115795 N_noFeature 2005968 61602932 2527434 N_ambiguous 1445973 8143 278899 UnstrandedReadsAssigned:59841393 PositiveStrandReadsAssigned:1682259 NegativeStrandReadsAssigned:60487001 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814834 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814834-trimmed-pair1.fastq SRR7814834-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 67,116,212 reads, 61,174,595 reads pseudoaligned [quant] estimated average fragment length: 267.266 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR7814834.ke.tsv 35125 SRR7814834.se.tsv 88098 total ==> SRR7814834.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.129 0 0 PNS24247 1044 777.734 119.151 3.3584 PNS24249 1928 1661.73 349.245 4.60715 PNS24246 1044 777.734 119.151 3.3584 PNS24248 1044 777.734 119.151 3.3584 PNS24244 1471 1204.73 225.301 4.09954 PNS24243 293 92.7857 0 0 KQK14069 1603 1336.73 15914.2 260.978 KQK14071 474 231.566 235.414 22.2855 ==> SRR7814834.se.tsv <== BRADI_1g14170v3 17092 BRADI_1g53295v3 6774 BRADI_1g59795v3 217 BRADI_1g07683v3 0 BRADI_1g00485v3 146 BRADI_1g20270v3 7152 BRADI_1g74790v3 677 BRADI_1g09890v3 46 BRADI_1g77505v3 791 BRADI_1g48960v3 1 SRR7814834 completed mapping pipeline successfully