Starting /dee2/code/volunteer_pipeline.sh SRR7814835 current disk space = 1551411130368 free memory = 1604563136 SRR7814835 SRAfilesize 32401086e66cf0cbb877ce001fb21eab SRR7814835.sra SRR7814835.sra file validated SRR7814835 is paired end SRR7814835 is conventional basespace SRR7814835 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814835_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.45725 37.0 37.0 37.0 37.0 37.0 2 36.341 37.0 37.0 37.0 37.0 37.0 3 36.4675 37.0 37.0 37.0 37.0 37.0 4 36.509 37.0 37.0 37.0 37.0 37.0 5 36.5565 37.0 37.0 37.0 37.0 37.0 6 36.475 37.0 37.0 37.0 37.0 37.0 7 36.5465 37.0 37.0 37.0 37.0 37.0 8 36.5495 37.0 37.0 37.0 37.0 37.0 9 36.496 37.0 37.0 37.0 37.0 37.0 10-14 36.554 37.0 37.0 37.0 37.0 37.0 15-19 36.5388 37.0 37.0 37.0 37.0 37.0 20-24 36.5403 37.0 37.0 37.0 37.0 37.0 25-29 36.415800000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4387 37.0 37.0 37.0 37.0 37.0 35-39 36.3962 37.0 37.0 37.0 37.0 37.0 40-44 36.374399999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.373900000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.33219999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.3254 37.0 37.0 37.0 37.0 37.0 60-64 36.330400000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.303999999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.3572 37.0 37.0 37.0 37.0 37.0 75-79 36.269400000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.2047 37.0 37.0 37.0 37.0 37.0 85-89 36.2206 37.0 37.0 37.0 37.0 37.0 90-94 36.13870000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1477 37.0 37.0 37.0 37.0 37.0 100-104 36.09 37.0 37.0 37.0 37.0 37.0 105-109 36.125899999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.0672 37.0 37.0 37.0 37.0 37.0 115-119 36.0419 37.0 37.0 37.0 37.0 37.0 120-124 35.9354 37.0 37.0 37.0 37.0 37.0 125-129 35.947799999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.8766 37.0 37.0 37.0 37.0 37.0 135-139 35.842 37.0 37.0 37.0 37.0 37.0 140-144 35.840799999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.7947 37.0 37.0 37.0 37.0 37.0 150-151 35.26375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 1.0 23 1.0 24 2.0 25 4.0 26 2.0 27 6.0 28 13.0 29 18.0 30 19.0 31 42.0 32 63.0 33 85.0 34 143.0 35 356.0 36 2811.0 37 432.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 57.83011776497119 10.999749436231522 4.359809571535956 26.81032322726134 2 26.650000000000002 11.625 30.75 30.975 3 23.0 20.1 23.075000000000003 33.825 4 28.1 24.65 21.375 25.874999999999996 5 26.200000000000003 30.45 21.224999999999998 22.125 6 23.0 31.275 23.075000000000003 22.650000000000002 7 18.2 22.8 39.45 19.55 8 20.1 22.45 28.525 28.925 9 21.95 21.349999999999998 30.349999999999998 26.35 10-14 24.16 25.305 24.610000000000003 25.924999999999997 15-19 24.465 24.135 25.365 26.035000000000004 20-24 24.09 24.654999999999998 25.119999999999997 26.135 25-29 24.025 24.625 25.355 25.995 30-34 23.91 25.019999999999996 25.115 25.955000000000002 35-39 24.3 24.75 24.715 26.235000000000003 40-44 24.57 24.62 24.355 26.455000000000002 45-49 24.585 25.035 24.6 25.779999999999998 50-54 24.33 24.14 24.82 26.71 55-59 25.03 24.22 24.18 26.57 60-64 24.565 24.715 24.005000000000003 26.715 65-69 24.675 24.3 24.740000000000002 26.284999999999997 70-74 25.105 24.98 24.0 25.915 75-79 24.36 23.849999999999998 24.825 26.965 80-84 24.965 23.635 24.45 26.950000000000003 85-89 24.685000000000002 25.095 24.11 26.11 90-94 25.135 24.345 23.68 26.840000000000003 95-99 25.185000000000002 24.6 24.215 26.0 100-104 24.915000000000003 24.09 24.044999999999998 26.950000000000003 105-109 25.264999999999997 24.495 24.205 26.035000000000004 110-114 25.155 24.169999999999998 23.885 26.790000000000003 115-119 24.990000000000002 24.385 23.86 26.765 120-124 25.374999999999996 24.455 23.380000000000003 26.790000000000003 125-129 25.55 24.79 23.06 26.6 130-134 25.979999999999997 24.215 23.605 26.200000000000003 135-139 25.28 24.474999999999998 23.39 26.855 140-144 25.495 24.085 22.99 27.43 145-149 25.1 24.66 23.23 27.01 150-151 26.275 24.837500000000002 22.2625 26.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 2.0 27 2.5 28 2.5 29 4.5 30 7.0 31 8.5 32 14.0 33 22.0 34 29.0 35 31.5 36 33.0 37 58.0 38 74.0 39 83.5 40 101.0 41 123.0 42 158.0 43 174.0 44 174.0 45 172.0 46 172.5 47 188.5 48 180.5 49 157.0 50 142.0 51 133.0 52 129.5 53 114.0 54 109.5 55 100.0 56 96.0 57 88.0 58 76.0 59 78.5 60 76.5 61 76.0 62 80.0 63 82.5 64 72.0 65 65.5 66 61.0 67 64.0 68 68.0 69 60.5 70 57.0 71 47.5 72 34.0 73 22.0 74 18.5 75 20.0 76 16.5 77 9.5 78 7.5 79 8.0 80 5.0 81 2.5 82 1.0 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.55 #Duplication Level Percentage of deduplicated Percentage of total 1 91.75314036045876 84.0 2 7.318405243036592 13.4 3 0.8738394320043691 2.4 4 0.05461496450027307 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0125 92-93 0.6625000000000001 0.0 0.0 0.0 0.025 94-95 0.8 0.0 0.0 0.0 0.025 96-97 0.9375 0.0 0.0 0.0 0.025 98-99 1.1375 0.0 0.0 0.0 0.025 100-101 1.2875 0.0 0.0 0.0 0.025 102-103 1.425 0.0 0.0 0.0 0.025 104-105 1.6124999999999998 0.0 0.0 0.0 0.025 106-107 1.975 0.0 0.0 0.0 0.025 108-109 2.275 0.0 0.0 0.0 0.025 110-111 2.575 0.0 0.0 0.0 0.025 112-113 3.1624999999999996 0.0 0.0 0.0 0.025 114-115 3.5625 0.0 0.0 0.0 0.025 116-117 4.0625 0.0 0.0 0.0 0.025 118-119 4.6625 0.0 0.0 0.0 0.025 120-121 5.3625 0.0 0.0 0.0 0.025 122-123 5.9875 0.0 0.0 0.0 0.025 124-125 6.675 0.0 0.0 0.0 0.025 126-127 7.2 0.0 0.0 0.0 0.025 128-129 7.8125 0.0 0.0 0.0 0.025 130-131 8.3625 0.0 0.0 0.0 0.025 132-133 8.875 0.0 0.0 0.0 0.025 134-135 9.4375 0.0 0.0 0.0 0.025 136-137 10.1 0.0 0.0 0.0 0.025 138-139 10.8375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATCCT 10 0.006830828 145.0 6 TGAATCC 10 0.006830828 145.0 5 >>END_MODULE SRR7814835 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814835_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1825 37.0 37.0 37.0 37.0 37.0 2 35.862 37.0 37.0 37.0 37.0 37.0 3 35.9765 37.0 37.0 37.0 37.0 37.0 4 35.8765 37.0 37.0 37.0 37.0 37.0 5 35.9835 37.0 37.0 37.0 37.0 37.0 6 35.952 37.0 37.0 37.0 37.0 37.0 7 35.889 37.0 37.0 37.0 37.0 37.0 8 36.0415 37.0 37.0 37.0 37.0 37.0 9 35.9675 37.0 37.0 37.0 37.0 37.0 10-14 35.95 37.0 37.0 37.0 37.0 37.0 15-19 35.8868 37.0 37.0 37.0 37.0 37.0 20-24 35.8974 37.0 37.0 37.0 37.0 37.0 25-29 35.8004 37.0 37.0 37.0 37.0 37.0 30-34 35.7867 37.0 37.0 37.0 37.0 37.0 35-39 35.7325 37.0 37.0 37.0 37.0 37.0 40-44 35.7829 37.0 37.0 37.0 37.0 37.0 45-49 35.7095 37.0 37.0 37.0 37.0 37.0 50-54 35.6764 37.0 37.0 37.0 37.0 37.0 55-59 35.650999999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.5893 37.0 37.0 37.0 37.0 37.0 65-69 35.5282 37.0 37.0 37.0 37.0 37.0 70-74 35.561699999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.500099999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.474599999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.4105 37.0 37.0 37.0 37.0 37.0 90-94 35.394 37.0 37.0 37.0 37.0 37.0 95-99 35.388400000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.343500000000006 37.0 37.0 37.0 34.6 37.0 105-109 35.4113 37.0 37.0 37.0 37.0 37.0 110-114 35.2938 37.0 37.0 37.0 34.6 37.0 115-119 35.095000000000006 37.0 37.0 37.0 27.4 37.0 120-124 35.098499999999994 37.0 37.0 37.0 27.4 37.0 125-129 35.1059 37.0 37.0 37.0 27.4 37.0 130-134 34.9781 37.0 37.0 37.0 25.0 37.0 135-139 34.789500000000004 37.0 37.0 37.0 25.0 37.0 140-144 34.5458 37.0 37.0 37.0 25.0 37.0 145-149 34.570299999999996 37.0 37.0 37.0 25.0 37.0 150-151 33.7615 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 6.0 15 3.0 16 4.0 17 2.0 18 9.0 19 7.0 20 6.0 21 11.0 22 13.0 23 7.0 24 15.0 25 15.0 26 13.0 27 15.0 28 20.0 29 24.0 30 31.0 31 48.0 32 77.0 33 123.0 34 263.0 35 716.0 36 2388.0 37 177.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.224999999999994 19.900000000000002 6.2 23.674999999999997 2 29.975 21.224999999999998 26.424999999999997 22.375 3 23.849999999999998 23.375 28.025 24.75 4 28.000000000000004 30.049999999999997 18.7 23.25 5 29.075 33.1 17.849999999999998 19.975 6 24.15 34.25 17.849999999999998 23.75 7 23.9 19.0 33.050000000000004 24.05 8 24.825 21.875 22.8 30.5 9 25.35 21.275 25.374999999999996 28.000000000000004 10-14 26.790000000000003 24.845 22.02 26.345000000000002 15-19 27.315 24.62 22.49 25.575 20-24 26.484999999999996 24.195 23.105 26.215 25-29 26.56 24.46 22.564999999999998 26.415 30-34 25.89 24.905 22.97 26.235000000000003 35-39 26.815 25.145 22.735 25.305 40-44 26.855 24.165 23.07 25.91 45-49 26.945000000000004 24.41 23.175 25.47 50-54 27.139999999999997 24.845 22.900000000000002 25.115 55-59 26.56 24.695 23.25 25.495 60-64 26.38 24.560000000000002 23.565 25.495 65-69 26.25 24.785 23.400000000000002 25.564999999999998 70-74 26.369999999999997 24.715 23.695 25.22 75-79 26.495 24.044999999999998 23.41 26.05 80-84 26.619999999999997 24.075 23.765 25.540000000000003 85-89 26.93 24.63 23.09 25.35 90-94 26.845000000000002 24.425 23.22 25.509999999999998 95-99 26.479999999999997 25.025 23.31 25.185000000000002 100-104 26.965 24.37 23.035 25.629999999999995 105-109 26.82 24.755 23.544999999999998 24.88 110-114 26.855 25.145 23.175 24.825 115-119 27.555000000000003 25.195 22.735 24.515 120-124 28.165000000000003 24.915000000000003 22.81 24.11 125-129 28.025 24.95 22.900000000000002 24.125 130-134 28.895 25.629999999999995 21.865000000000002 23.61 135-139 28.78 25.235000000000003 22.215 23.77 140-144 28.89 25.705 22.475 22.93 145-149 28.96 25.900000000000002 22.7 22.439999999999998 150-151 29.599999999999998 24.3 23.8375 22.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 1.0 6 1.5 7 0.5 8 0.5 9 1.0 10 1.0 11 1.0 12 0.5 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 0.5 20 0.5 21 1.5 22 3.0 23 2.5 24 1.0 25 1.0 26 0.5 27 1.0 28 2.0 29 3.5 30 8.0 31 12.0 32 13.0 33 17.0 34 24.5 35 26.0 36 33.5 37 41.0 38 51.5 39 74.0 40 97.0 41 120.5 42 121.0 43 128.0 44 160.0 45 167.5 46 151.0 47 152.0 48 154.0 49 152.5 50 143.5 51 121.0 52 126.0 53 117.0 54 112.5 55 116.0 56 94.5 57 93.5 58 103.5 59 101.0 60 93.0 61 91.0 62 88.0 63 87.0 64 87.0 65 84.0 66 82.0 67 71.0 68 63.0 69 61.0 70 55.5 71 55.0 72 50.5 73 40.0 74 33.5 75 24.0 76 19.5 77 16.0 78 9.0 79 6.0 80 2.5 81 1.0 82 1.5 83 1.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 1.5 94 1.5 95 1.0 96 0.5 97 0.5 98 0.5 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.55 #Duplication Level Percentage of deduplicated Percentage of total 1 92.05352266521027 84.275 2 6.93610049153468 12.7 3 0.8465319497542327 2.325 4 0.10922992900054614 0.4 5 0.027307482250136534 0.125 6 0.0 0.0 7 0.027307482250136534 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.225 0.0 0.0 0.0 0.0 110-111 2.5625 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.575 0.0 0.0 0.0 0.0 116-117 4.05 0.0 0.0 0.0 0.0 118-119 4.6125 0.0 0.0 0.0 0.0 120-121 5.3125 0.0 0.0 0.0 0.0 122-123 5.9125 0.0 0.0 0.0 0.0 124-125 6.6125 0.0 0.0 0.0 0.0 126-127 7.15 0.0 0.0 0.0 0.0 128-129 7.737500000000001 0.0 0.0 0.0 0.0 130-131 8.3 0.0 0.0 0.0 0.0 132-133 8.8 0.0 0.0 0.0 0.0 134-135 9.3625 0.0 0.0 0.0 0.0 136-137 10.0375 0.0 0.0 0.0 0.0 138-139 10.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCAAA 10 0.006830828 145.0 1 >>END_MODULE Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242772 spots for SRR7814835.sra Written 2242772 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra Read 2242758 spots for SRR7814835.sra Written 2242758 spots for SRR7814835.sra SRR ids: ['SRR7814835.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k4u4kg8y SRR7814835.sra spots: 44855174 blocks: [[1, 2242758], [2242759, 4485516], [4485517, 6728274], [6728275, 8971032], [8971033, 11213790], [11213791, 13456548], [13456549, 15699306], [15699307, 17942064], [17942065, 20184822], [20184823, 22427580], [22427581, 24670338], [24670339, 26913096], [26913097, 29155854], [29155855, 31398612], [31398613, 33641370], [33641371, 35884128], [35884129, 38126886], [38126887, 40369644], [40369645, 42612402], [42612403, 44855174]] SRR7814835 file size 15178246 SRR7814835 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814835 SRR7814835_1.fastq SRR7814835_2.fastq Input file: SRR7814835_1.fastq Paired file: SRR7814835_2.fastq trimmed: SRR7814835-trimmed-pair1.fastq, SRR7814835-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:48:47 2024 >> started Fri Dec 6 11:49:36 2024 >> done (48.174s) 44855174 read pairs processed; of these: 267 ( 0.00%) short read pairs filtered out after trimming by size control 15993 ( 0.04%) empty read pairs filtered out after trimming by size control 44838914 (99.96%) read pairs available; of these: 6010108 (13.40%) trimmed read pairs available after processing 38828806 (86.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 17 0.00% 20 24 0.00% 21 23 0.00% 22 38 0.00% 23 33 0.00% 24 46 0.00% 25 53 0.00% 26 48 0.00% 27 63 0.00% 28 56 0.00% 29 57 0.00% 30 65 0.00% 31 68 0.00% 32 79 0.00% 33 61 0.00% 34 70 0.00% 35 81 0.00% 36 68 0.00% 37 89 0.00% 38 88 0.00% 39 91 0.00% 40 111 0.00% 41 118 0.00% 42 126 0.00% 43 141 0.00% 44 129 0.00% 45 153 0.00% 46 159 0.00% 47 182 0.00% 48 225 0.00% 49 245 0.00% 50 343 0.00% 51 352 0.00% 52 354 0.00% 53 393 0.00% 54 425 0.00% 55 446 0.00% 56 537 0.00% 57 565 0.00% 58 646 0.00% 59 789 0.00% 60 887 0.00% 61 1081 0.00% 62 1187 0.00% 63 1316 0.00% 64 1356 0.00% 65 1455 0.00% 66 1674 0.00% 67 1897 0.00% 68 2145 0.00% 69 2419 0.01% 70 2859 0.01% 71 3242 0.01% 72 3797 0.01% 73 4085 0.01% 74 4774 0.01% 75 5196 0.01% 76 5799 0.01% 77 6269 0.01% 78 7111 0.02% 79 8107 0.02% 80 9072 0.02% 81 10324 0.02% 82 11574 0.03% 83 12796 0.03% 84 14068 0.03% 85 15491 0.03% 86 16473 0.04% 87 18224 0.04% 88 19866 0.04% 89 20932 0.05% 90 23249 0.05% 91 25635 0.06% 92 28143 0.06% 93 29954 0.07% 94 32020 0.07% 95 34733 0.08% 96 36513 0.08% 97 39131 0.09% 98 40129 0.09% 99 42692 0.10% 100 45244 0.10% 101 47989 0.11% 102 50548 0.11% 103 54655 0.12% 104 56604 0.13% 105 59080 0.13% 106 61789 0.14% 107 62979 0.14% 108 65283 0.15% 109 68071 0.15% 110 70111 0.16% 111 73024 0.16% 112 76927 0.17% 113 80254 0.18% 114 83372 0.19% 115 85877 0.19% 116 87787 0.20% 117 90108 0.20% 118 90597 0.20% 119 92145 0.21% 120 95250 0.21% 121 98344 0.22% 122 100427 0.22% 123 104138 0.23% 124 108129 0.24% 125 110663 0.25% 126 112566 0.25% 127 113768 0.25% 128 115454 0.26% 129 117847 0.26% 130 118559 0.26% 131 120454 0.27% 132 124747 0.28% 133 127931 0.29% 134 131224 0.29% 135 133578 0.30% 136 134793 0.30% 137 135657 0.30% 138 137011 0.31% 139 139334 0.31% 140 140123 0.31% 141 141844 0.32% 142 145907 0.33% 143 146650 0.33% 144 152984 0.34% 145 155715 0.35% 146 155264 0.35% 147 158251 0.35% 148 157876 0.35% 149 157962 0.35% 150 159868 0.36% 151 38828806 86.60% 44838914 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=12 prefix-density=0.63 prefix-fanout=3.4 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=23.93 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=6.2 sequence=ACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGGGGACGAAGTTGGTGGC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=15 prefix-density=0.57 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=21 fanout-score=95.04 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=19.6 sequence=CAAGAAGAAGGT SRR7814835 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:51:01 Started mapping on | Dec 06 11:51:02 Finished on | Dec 06 11:58:03 Mapping speed, Million of reads per hour | 383.42 Number of input reads | 44838914 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 40462470 Uniquely mapped reads % | 90.24% Average mapped length | 293.78 Number of splices: Total | 38750924 Number of splices: Annotated (sjdb) | 36536739 Number of splices: GT/AG | 38200607 Number of splices: GC/AG | 443183 Number of splices: AT/AC | 18261 Number of splices: Non-canonical | 88873 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.06 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 800503 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 77410 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.65% % of reads unmapped: other | 1.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3575941 3575941 3575941 N_multimapping 800503 800503 800503 N_noFeature 1331767 39313029 1684828 N_ambiguous 956826 5432 161793 UnstrandedReadsAssigned:38173877 PositiveStrandReadsAssigned:1144009 NegativeStrandReadsAssigned:38615849 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814835 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814835-trimmed-pair1.fastq SRR7814835-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,838,914 reads, 39,479,683 reads pseudoaligned [quant] estimated average fragment length: 246.137 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52973 SRR7814835.ke.tsv 35125 SRR7814835.se.tsv 88098 total ==> SRR7814835.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.163 0 0 PNS24247 1044 798.863 120.051 5.06672 PNS24249 1928 1682.86 360.502 7.22257 PNS24246 1044 798.863 120.051 5.06672 PNS24248 1044 798.863 120.051 5.06672 PNS24244 1471 1225.86 227.345 6.25283 PNS24243 293 101.076 2 0.667138 KQK14069 1603 1357.86 25244.3 626.818 KQK14071 474 247.242 518.04 70.6438 ==> SRR7814835.se.tsv <== BRADI_1g14170v3 27451 BRADI_1g53295v3 3785 BRADI_1g59795v3 293 BRADI_1g07683v3 0 BRADI_1g00485v3 86 BRADI_1g20270v3 3967 BRADI_1g74790v3 630 BRADI_1g09890v3 14 BRADI_1g77505v3 614 BRADI_1g48960v3 1 SRR7814835 completed mapping pipeline successfully