Starting /dee2/code/volunteer_pipeline.sh SRR7814836 current disk space = 1551235829760 free memory = 1297678200 SRR7814836 SRAfilesize 4020eeeccd9bbad5162f05d8c643c880 SRR7814836.sra SRR7814836.sra file validated SRR7814836 is paired end SRR7814836 is conventional basespace SRR7814836 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814836_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36475 37.0 37.0 37.0 37.0 37.0 2 36.46625 37.0 37.0 37.0 37.0 37.0 3 36.613 37.0 37.0 37.0 37.0 37.0 4 36.686 37.0 37.0 37.0 37.0 37.0 5 36.6865 37.0 37.0 37.0 37.0 37.0 6 36.61 37.0 37.0 37.0 37.0 37.0 7 36.5135 37.0 37.0 37.0 37.0 37.0 8 36.5745 37.0 37.0 37.0 37.0 37.0 9 36.7105 37.0 37.0 37.0 37.0 37.0 10-14 36.6151 37.0 37.0 37.0 37.0 37.0 15-19 36.5779 37.0 37.0 37.0 37.0 37.0 20-24 36.563100000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.4837 37.0 37.0 37.0 37.0 37.0 30-34 36.3825 37.0 37.0 37.0 37.0 37.0 35-39 36.3438 37.0 37.0 37.0 37.0 37.0 40-44 36.2741 37.0 37.0 37.0 37.0 37.0 45-49 36.3831 37.0 37.0 37.0 37.0 37.0 50-54 36.3995 37.0 37.0 37.0 37.0 37.0 55-59 36.37169999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.336800000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.2546 37.0 37.0 37.0 37.0 37.0 70-74 36.1826 37.0 37.0 37.0 37.0 37.0 75-79 36.1357 37.0 37.0 37.0 37.0 37.0 80-84 36.1327 37.0 37.0 37.0 37.0 37.0 85-89 36.153299999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.031499999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.788 37.0 37.0 37.0 37.0 37.0 100-104 35.498000000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.7067 37.0 37.0 37.0 37.0 37.0 110-114 35.77420000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.6277 37.0 37.0 37.0 37.0 37.0 120-124 34.979499999999994 37.0 37.0 37.0 27.4 37.0 125-129 34.7282 37.0 37.0 37.0 25.0 37.0 130-134 35.2299 37.0 37.0 37.0 29.8 37.0 135-139 35.095299999999995 37.0 37.0 37.0 25.0 37.0 140-144 35.1355 37.0 37.0 37.0 27.4 37.0 145-149 35.0416 37.0 37.0 37.0 25.0 37.0 150-151 34.286500000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 0.0 24 0.0 25 1.0 26 5.0 27 13.0 28 15.0 29 20.0 30 29.0 31 55.0 32 81.0 33 112.0 34 243.0 35 559.0 36 2650.0 37 215.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.12816654125909 11.587659894657637 5.81891146225232 35.46526210183095 2 25.156289072268066 13.078269567391848 32.05801450362591 29.707426856714182 3 22.6 17.925 22.85 36.625 4 28.849999999999998 24.825 19.650000000000002 26.674999999999997 5 26.400000000000002 28.675 21.95 22.975 6 23.575 30.55 22.925 22.95 7 18.325 21.65 39.375 20.65 8 19.525000000000002 23.375 30.25 26.85 9 20.4 21.975 31.35 26.275 10-14 23.7 25.835 24.54 25.924999999999997 15-19 24.169999999999998 24.69 24.68 26.46 20-24 24.345 24.265 24.675 26.715 25-29 24.29 24.465 24.404999999999998 26.840000000000003 30-34 24.205 24.095 24.779999999999998 26.919999999999998 35-39 23.9 24.224999999999998 24.565 27.310000000000002 40-44 24.745 24.33 24.34 26.584999999999997 45-49 24.545 23.685000000000002 25.074999999999996 26.695 50-54 24.19 24.25 24.6 26.96 55-59 24.16 23.880000000000003 24.23 27.73 60-64 23.865 24.27 24.349999999999998 27.515 65-69 24.45 23.87 24.09 27.589999999999996 70-74 24.245 24.154999999999998 23.75 27.85 75-79 24.63 24.335 23.599999999999998 27.435 80-84 24.83 24.77 23.71 26.69 85-89 24.815 23.455000000000002 24.245 27.485 90-94 24.845 23.57 24.18 27.405 95-99 25.215 23.965 23.724999999999998 27.095000000000002 100-104 24.72 24.035 23.865 27.38 105-109 25.66 23.125 24.16 27.055 110-114 25.130000000000003 24.215 23.96 26.695 115-119 25.545 24.224999999999998 23.53 26.700000000000003 120-124 26.08 24.44 23.18 26.3 125-129 25.7 24.685000000000002 22.86 26.755000000000003 130-134 26.229999999999997 23.71 22.67 27.389999999999997 135-139 25.515 23.845 23.25 27.389999999999997 140-144 26.11 24.41 22.37 27.11 145-149 26.340000000000003 24.14 22.465 27.055 150-151 25.874999999999996 24.8 22.3375 26.987499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 1.0 27 1.0 28 3.0 29 4.0 30 7.0 31 8.5 32 13.0 33 21.0 34 20.5 35 27.0 36 45.0 37 63.0 38 68.0 39 74.0 40 84.5 41 100.0 42 131.5 43 151.5 44 141.5 45 144.0 46 156.0 47 155.0 48 148.5 49 148.0 50 155.0 51 152.5 52 143.0 53 136.5 54 151.5 55 148.0 56 128.5 57 126.5 58 114.5 59 101.0 60 95.0 61 87.5 62 84.5 63 81.5 64 68.0 65 64.5 66 64.5 67 61.0 68 52.0 69 48.5 70 47.5 71 35.0 72 28.5 73 20.5 74 19.0 75 17.5 76 12.0 77 12.5 78 11.0 79 4.5 80 2.5 81 2.5 82 1.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.7 #Duplication Level Percentage of deduplicated Percentage of total 1 88.91106043329533 77.97500000000001 2 8.893956670467503 15.6 3 1.653363740022805 4.35 4 0.37058152793614596 1.3 5 0.14253135689851767 0.625 6 0.028506271379703536 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATAC 6 0.15 No Hit GCCTCATCCTCTCCTTCCTCCGGCTTAACACCGGCGGTCTGTTCAGGGTT 5 0.125 No Hit GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 5 0.125 No Hit GCCAGCTCCTATAGTGTGACGGGCGGTGTGTACAAGGCCCGGGAACGGAT 5 0.125 No Hit GTTGAATACATCAGTGTAGCGCGCGTGCGGCCCAGAACATCTAAGGGCAT 5 0.125 No Hit GTGCGACGTGGGGCTGGATCTCAGTGGATCGTGGCAGCAAGGCCACTCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 1.1125 0.0 0.0 0.0 0.0 94-95 1.225 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.6875 0.0 0.0 0.0 0.0 100-101 1.925 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.3499999999999996 0.0 0.0 0.0 0.0 106-107 2.8 0.0 0.0 0.0 0.0 108-109 3.3499999999999996 0.0 0.0 0.0 0.0 110-111 3.9000000000000004 0.0 0.0 0.0 0.0 112-113 4.5875 0.0 0.0 0.0 0.0 114-115 5.3125 0.0 0.0 0.0 0.0 116-117 5.862500000000001 0.0 0.0 0.0 0.0 118-119 6.475 0.0 0.0 0.0 0.0 120-121 7.237500000000001 0.0 0.0 0.0 0.0 122-123 7.7375 0.0 0.0 0.0 0.0 124-125 8.462499999999999 0.0 0.0 0.0 0.0 126-127 9.1875 0.0 0.0 0.0 0.0 128-129 9.8625 0.0 0.0 0.0 0.0 130-131 10.6125 0.0 0.0 0.0 0.0 132-133 11.1875 0.0 0.0 0.0 0.0 134-135 11.8875 0.0 0.0 0.0 0.0 136-137 12.6 0.0 0.0 0.0 0.0 138-139 13.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATGG 10 0.006830828 145.0 2 CGCTTAG 10 0.006830828 145.0 6 GATCGCT 10 0.006830828 145.0 3 GGTCATG 10 0.006830828 145.0 1 CTTAGCC 10 0.006830828 145.0 8 ATGGATA 10 0.006830828 145.0 5 TAACTTT 10 0.006830828 145.0 9 TCGCTTA 10 0.006830828 145.0 5 AGTAACT 10 0.006830828 145.0 7 TGGATAG 10 0.006830828 145.0 6 GACGAAG 10 0.006830828 145.0 6 CTAGAGT 10 0.006830828 145.0 3 GTAACTT 10 0.006830828 145.0 8 AGATCGC 10 0.006830828 145.0 2 TTAGCCC 10 0.006830828 145.0 9 GCTTAGC 10 0.006830828 145.0 7 CCAGTCA 45 0.008957279 48.333332 145 >>END_MODULE SRR7814836 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814836_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2775 37.0 37.0 37.0 37.0 37.0 2 36.02 37.0 37.0 37.0 37.0 37.0 3 35.914 37.0 37.0 37.0 37.0 37.0 4 35.976 37.0 37.0 37.0 37.0 37.0 5 35.964 37.0 37.0 37.0 37.0 37.0 6 35.8685 37.0 37.0 37.0 37.0 37.0 7 35.707 37.0 37.0 37.0 37.0 37.0 8 35.8645 37.0 37.0 37.0 37.0 37.0 9 36.069 37.0 37.0 37.0 37.0 37.0 10-14 35.948699999999995 37.0 37.0 37.0 37.0 37.0 15-19 35.515 37.0 37.0 37.0 37.0 37.0 20-24 35.823 37.0 37.0 37.0 37.0 37.0 25-29 35.7195 37.0 37.0 37.0 37.0 37.0 30-34 35.403999999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.4846 37.0 37.0 37.0 37.0 37.0 40-44 35.1117 37.0 37.0 37.0 29.8 37.0 45-49 35.26690000000001 37.0 37.0 37.0 32.2 37.0 50-54 34.6189 37.0 37.0 37.0 25.0 37.0 55-59 34.541999999999994 37.0 37.0 37.0 25.0 37.0 60-64 34.7724 37.0 37.0 37.0 25.0 37.0 65-69 34.7144 37.0 37.0 37.0 25.0 37.0 70-74 34.403600000000004 37.0 37.0 37.0 25.0 37.0 75-79 34.2873 37.0 37.0 37.0 25.0 37.0 80-84 34.189499999999995 37.0 37.0 37.0 25.0 37.0 85-89 34.519400000000005 37.0 37.0 37.0 25.0 37.0 90-94 34.1609 37.0 37.0 37.0 25.0 37.0 95-99 33.117999999999995 37.0 37.0 37.0 16.6 37.0 100-104 33.576600000000006 37.0 37.0 37.0 16.6 37.0 105-109 33.1644 37.0 37.0 37.0 13.8 37.0 110-114 33.463100000000004 37.0 37.0 37.0 22.2 37.0 115-119 33.6318 37.0 37.0 37.0 22.2 37.0 120-124 32.879400000000004 37.0 37.0 37.0 11.0 37.0 125-129 32.9356 37.0 37.0 37.0 11.0 37.0 130-134 32.5328 37.0 37.0 37.0 11.0 37.0 135-139 32.296499999999995 37.0 32.2 37.0 11.0 37.0 140-144 32.5411 37.0 37.0 37.0 11.0 37.0 145-149 32.1974 37.0 32.2 37.0 11.0 37.0 150-151 31.694000000000003 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 2.0 16 4.0 17 3.0 18 3.0 19 4.0 20 3.0 21 8.0 22 12.0 23 34.0 24 37.0 25 56.0 26 64.0 27 89.0 28 83.0 29 103.0 30 136.0 31 140.0 32 144.0 33 199.0 34 326.0 35 683.0 36 1820.0 37 43.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.725 17.599999999999998 8.175 30.5 2 29.425 22.125 26.0 22.45 3 24.4 24.375 26.974999999999998 24.25 4 29.349999999999998 29.675 18.475 22.5 5 30.049999999999997 30.625000000000004 18.65 20.674999999999997 6 24.2 33.300000000000004 18.5 24.0 7 24.875 18.8 30.3 26.025 8 24.099999999999998 23.625 22.575 29.7 9 24.7 22.075 26.6 26.625 10-14 27.750000000000004 24.21 22.045 25.995 15-19 27.279999999999998 24.310000000000002 22.759999999999998 25.650000000000002 20-24 27.36 24.725 22.59 25.324999999999996 25-29 27.35 24.005000000000003 23.365 25.28 30-34 27.029999999999998 24.29 23.1 25.580000000000002 35-39 27.11 24.6 22.58 25.71 40-44 27.615000000000002 24.990000000000002 22.34 25.055 45-49 27.145000000000003 24.295 22.835 25.724999999999998 50-54 27.315 25.09 22.805 24.79 55-59 27.76 25.06 22.485 24.695 60-64 27.365000000000002 23.65 23.23 25.755 65-69 27.025 24.525 23.330000000000002 25.119999999999997 70-74 27.145000000000003 24.465 23.445 24.945 75-79 27.07 24.175 22.865 25.89 80-84 27.21 25.064999999999998 23.09 24.635 85-89 27.445000000000004 24.560000000000002 22.830000000000002 25.165 90-94 27.195000000000004 24.845 22.725 25.235000000000003 95-99 27.515 25.16 23.07 24.255 100-104 27.22 25.119999999999997 22.765 24.895 105-109 27.105 26.07 23.5 23.325000000000003 110-114 27.51 25.480000000000004 22.735 24.275 115-119 28.075 25.474999999999998 22.59 23.86 120-124 27.74 26.69 22.12 23.45 125-129 28.54 25.905 22.295 23.26 130-134 28.21 26.295 22.08 23.415 135-139 28.749999999999996 26.02 22.35 22.88 140-144 29.43 27.08 21.845 21.645 145-149 30.31 26.924999999999997 21.709999999999997 21.055 150-151 30.875000000000004 25.674999999999997 21.7375 21.712500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.5 25 0.5 26 2.0 27 3.0 28 3.5 29 6.5 30 8.5 31 8.5 32 9.5 33 13.0 34 16.5 35 25.0 36 34.0 37 43.0 38 61.0 39 81.5 40 88.0 41 99.5 42 107.0 43 127.5 44 147.0 45 135.0 46 135.5 47 138.5 48 139.5 49 144.5 50 137.0 51 136.0 52 142.0 53 139.0 54 139.0 55 128.5 56 122.5 57 127.5 58 120.0 59 124.0 60 116.5 61 96.5 62 96.5 63 90.5 64 82.0 65 72.5 66 71.0 67 67.5 68 66.5 69 60.0 70 45.0 71 42.5 72 41.0 73 32.5 74 27.0 75 26.0 76 16.0 77 10.0 78 9.5 79 7.5 80 3.5 81 2.0 82 2.0 83 2.0 84 1.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 0.5 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.3 #Duplication Level Percentage of deduplicated Percentage of total 1 90.36954087346024 80.7 2 7.894736842105263 14.099999999999998 3 1.3437849944008957 3.5999999999999996 4 0.22396416573348266 0.8 5 0.13997760358342665 0.625 6 0.0 0.0 7 0.027995520716685332 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTTACCAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCC 7 0.17500000000000002 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 5 0.125 No Hit GGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCA 5 0.125 No Hit ACCTTACCAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGC 5 0.125 No Hit GACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 90-91 0.8374999999999999 0.0 0.0 0.0 0.0 92-93 1.1125 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.325 0.0 0.0 0.0 0.0 98-99 1.6125 0.0 0.0 0.0 0.0 100-101 1.8 0.0 0.0 0.0 0.0 102-103 1.95 0.0 0.0 0.0 0.0 104-105 2.2125 0.0 0.0 0.0 0.0 106-107 2.6500000000000004 0.0 0.0 0.0 0.0 108-109 3.0875000000000004 0.0 0.0 0.0 0.0 110-111 3.5625 0.0 0.0 0.0 0.0 112-113 4.2875 0.0 0.0 0.0 0.0 114-115 4.975 0.0 0.0 0.0 0.0 116-117 5.5 0.0 0.0 0.0 0.0 118-119 6.025 0.0 0.0 0.0 0.0 120-121 6.7125 0.0 0.0 0.0 0.0 122-123 7.0875 0.0 0.0 0.0 0.0 124-125 7.699999999999999 0.0 0.0 0.0 0.0 126-127 8.3125 0.0 0.0 0.0 0.0 128-129 8.9 0.0 0.0 0.0 0.0 130-131 9.587499999999999 0.0 0.0 0.0 0.0 132-133 10.037500000000001 0.0 0.0 0.0 0.0 134-135 10.65 0.0 0.0 0.0 0.0 136-137 11.125 0.0 0.0 0.0 0.0 138-139 11.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAATGA 10 0.006830828 145.0 3 CCTAAAT 10 0.006830828 145.0 1 ACCGCTC 10 0.006830828 145.0 9 AGTGGGA 10 0.006830828 145.0 8 AGCAGTG 10 0.006830828 145.0 5 CCCAAGC 10 0.006830828 145.0 1 CTTATGG 10 0.006830828 145.0 145 CTAAATG 10 0.006830828 145.0 2 CCAAGCA 10 0.006830828 145.0 2 AAATGAC 10 0.006830828 145.0 4 AATGACC 10 0.006830828 145.0 5 GGGGGGG 40 0.0076550315 18.125 140-144 >>END_MODULE Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988018 spots for SRR7814836.sra Written 1988018 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra Read 1988010 spots for SRR7814836.sra Written 1988010 spots for SRR7814836.sra SRR ids: ['SRR7814836.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pd61ga96 SRR7814836.sra spots: 39760208 blocks: [[1, 1988010], [1988011, 3976020], [3976021, 5964030], [5964031, 7952040], [7952041, 9940050], [9940051, 11928060], [11928061, 13916070], [13916071, 15904080], [15904081, 17892090], [17892091, 19880100], [19880101, 21868110], [21868111, 23856120], [23856121, 25844130], [25844131, 27832140], [27832141, 29820150], [29820151, 31808160], [31808161, 33796170], [33796171, 35784180], [35784181, 37772190], [37772191, 39760208]] SRR7814836 file size 13451729 SRR7814836 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814836 SRR7814836_1.fastq SRR7814836_2.fastq Input file: SRR7814836_1.fastq Paired file: SRR7814836_2.fastq trimmed: SRR7814836-trimmed-pair1.fastq, SRR7814836-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:55:10 2024 >> started Fri Dec 6 11:56:08 2024 >> done (58.578s) 39760208 read pairs processed; of these: 222 ( 0.00%) short read pairs filtered out after trimming by size control 8874 ( 0.02%) empty read pairs filtered out after trimming by size control 39751112 (99.98%) read pairs available; of these: 7812580 (19.65%) trimmed read pairs available after processing 31938532 (80.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 19 0.00% 20 13 0.00% 21 20 0.00% 22 16 0.00% 23 17 0.00% 24 29 0.00% 25 30 0.00% 26 34 0.00% 27 38 0.00% 28 50 0.00% 29 48 0.00% 30 52 0.00% 31 44 0.00% 32 71 0.00% 33 51 0.00% 34 66 0.00% 35 64 0.00% 36 89 0.00% 37 87 0.00% 38 107 0.00% 39 100 0.00% 40 116 0.00% 41 153 0.00% 42 153 0.00% 43 138 0.00% 44 154 0.00% 45 168 0.00% 46 181 0.00% 47 226 0.00% 48 250 0.00% 49 288 0.00% 50 331 0.00% 51 417 0.00% 52 464 0.00% 53 457 0.00% 54 501 0.00% 55 562 0.00% 56 618 0.00% 57 728 0.00% 58 872 0.00% 59 1002 0.00% 60 1181 0.00% 61 1342 0.00% 62 1613 0.00% 63 1702 0.00% 64 1771 0.00% 65 1906 0.00% 66 2114 0.01% 67 2510 0.01% 68 2836 0.01% 69 3167 0.01% 70 3662 0.01% 71 4194 0.01% 72 4982 0.01% 73 5631 0.01% 74 6073 0.02% 75 6772 0.02% 76 7648 0.02% 77 8311 0.02% 78 9562 0.02% 79 10876 0.03% 80 12042 0.03% 81 13674 0.03% 82 15356 0.04% 83 17373 0.04% 84 19090 0.05% 85 21459 0.05% 86 23558 0.06% 87 24918 0.06% 88 27303 0.07% 89 28995 0.07% 90 32254 0.08% 91 35501 0.09% 92 39014 0.10% 93 42829 0.11% 94 45601 0.11% 95 49268 0.12% 96 52599 0.13% 97 55840 0.14% 98 58146 0.15% 99 61752 0.16% 100 65148 0.16% 101 68925 0.17% 102 72384 0.18% 103 76327 0.19% 104 79692 0.20% 105 82574 0.21% 106 87217 0.22% 107 90530 0.23% 108 93668 0.24% 109 98067 0.25% 110 99119 0.25% 111 103410 0.26% 112 108377 0.27% 113 109287 0.27% 114 114823 0.29% 115 119657 0.30% 116 123256 0.31% 117 122821 0.31% 118 124174 0.31% 119 126002 0.32% 120 132079 0.33% 121 133049 0.33% 122 135883 0.34% 123 140974 0.35% 124 142938 0.36% 125 146960 0.37% 126 150295 0.38% 127 152017 0.38% 128 153275 0.39% 129 155304 0.39% 130 155091 0.39% 131 157432 0.40% 132 161373 0.41% 133 162663 0.41% 134 164943 0.41% 135 167641 0.42% 136 170756 0.43% 137 168516 0.42% 138 168887 0.42% 139 171642 0.43% 140 172198 0.43% 141 173643 0.44% 142 176209 0.44% 143 177482 0.45% 144 180775 0.45% 145 181671 0.46% 146 182553 0.46% 147 184152 0.46% 148 183899 0.46% 149 183835 0.46% 150 185718 0.47% 151 31938532 80.35% 39751112 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=35 prefix-density=0.81 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.29 sequence-density-rank=26 fanout-score=21.51 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=19.7 sequence=GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGGACTTATCTCGTATGCCGTCTTCTGCTT criterion=sequence-density sequence-density=1.07 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=20 prefix-density=1.15 prefix-fanout=2.3 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=51.04 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=4.0 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7814836 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 11:57:51 Started mapping on | Dec 06 11:57:51 Finished on | Dec 06 12:02:14 Mapping speed, Million of reads per hour | 544.12 Number of input reads | 39751112 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 32260565 Uniquely mapped reads % | 81.16% Average mapped length | 290.20 Number of splices: Total | 26919814 Number of splices: Annotated (sjdb) | 25316417 Number of splices: GT/AG | 26518208 Number of splices: GC/AG | 318570 Number of splices: AT/AC | 9664 Number of splices: Non-canonical | 73372 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2635566 % of reads mapped to multiple loci | 6.63% Number of reads mapped to too many loci | 511743 % of reads mapped to too many loci | 1.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.87% % of reads unmapped: other | 7.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4854981 4854981 4854981 N_multimapping 2635566 2635566 2635566 N_noFeature 2647118 31221490 2906512 N_ambiguous 936230 3732 157692 UnstrandedReadsAssigned:28677217 PositiveStrandReadsAssigned:1035343 NegativeStrandReadsAssigned:29196361 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814836 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814836-trimmed-pair1.fastq SRR7814836-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,751,112 reads, 30,320,391 reads pseudoaligned [quant] estimated average fragment length: 226.604 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52973 SRR7814836.ke.tsv 35125 SRR7814836.se.tsv 88098 total ==> SRR7814836.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 710.692 0 0 PNS24247 1044 818.396 102.402 4.86295 PNS24249 1928 1702.4 179.227 4.09163 PNS24246 1044 818.396 102.402 4.86295 PNS24248 1044 818.396 102.402 4.86295 PNS24244 1471 1245.4 209.566 6.53983 PNS24243 293 110.515 9 3.165 KQK14069 1603 1377.4 12284.6 346.62 KQK14071 474 261.075 261.591 38.9414 ==> SRR7814836.se.tsv <== BRADI_1g14170v3 13157 BRADI_1g53295v3 1843 BRADI_1g59795v3 282 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 281 BRADI_1g74790v3 409 BRADI_1g09890v3 0 BRADI_1g77505v3 733 BRADI_1g48960v3 0 SRR7814836 completed mapping pipeline successfully