Starting /dee2/code/volunteer_pipeline.sh SRR7814837 current disk space = 1551379165184 free memory = 1602232404 SRR7814837 SRAfilesize a71cb88cff6d157fd877b765c1ba601e SRR7814837.sra SRR7814837.sra file validated SRR7814837 is paired end SRR7814837 is conventional basespace SRR7814837 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814837_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41975 37.0 37.0 37.0 37.0 37.0 2 36.384 37.0 37.0 37.0 37.0 37.0 3 36.4755 37.0 37.0 37.0 37.0 37.0 4 36.4775 37.0 37.0 37.0 37.0 37.0 5 36.571 37.0 37.0 37.0 37.0 37.0 6 36.607 37.0 37.0 37.0 37.0 37.0 7 36.541 37.0 37.0 37.0 37.0 37.0 8 36.5295 37.0 37.0 37.0 37.0 37.0 9 36.5895 37.0 37.0 37.0 37.0 37.0 10-14 36.5639 37.0 37.0 37.0 37.0 37.0 15-19 36.529199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4842 37.0 37.0 37.0 37.0 37.0 25-29 36.4362 37.0 37.0 37.0 37.0 37.0 30-34 36.2678 37.0 37.0 37.0 37.0 37.0 35-39 36.1905 37.0 37.0 37.0 37.0 37.0 40-44 36.1781 37.0 37.0 37.0 37.0 37.0 45-49 36.333400000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.3122 37.0 37.0 37.0 37.0 37.0 55-59 36.287099999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.2869 37.0 37.0 37.0 37.0 37.0 65-69 36.1656 37.0 37.0 37.0 37.0 37.0 70-74 36.047 37.0 37.0 37.0 37.0 37.0 75-79 36.0794 37.0 37.0 37.0 37.0 37.0 80-84 36.0326 37.0 37.0 37.0 37.0 37.0 85-89 36.043000000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.9399 37.0 37.0 37.0 37.0 37.0 95-99 35.670100000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.3257 37.0 37.0 37.0 32.2 37.0 105-109 35.4979 37.0 37.0 37.0 37.0 37.0 110-114 35.620900000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.500099999999996 37.0 37.0 37.0 37.0 37.0 120-124 34.7877 37.0 37.0 37.0 25.0 37.0 125-129 34.485 37.0 37.0 37.0 25.0 37.0 130-134 35.093 37.0 37.0 37.0 25.0 37.0 135-139 34.9087 37.0 37.0 37.0 25.0 37.0 140-144 34.954100000000004 37.0 37.0 37.0 27.4 37.0 145-149 34.7779 37.0 37.0 37.0 25.0 37.0 150-151 34.0835 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 2.0 26 7.0 27 15.0 28 11.0 29 23.0 30 40.0 31 60.0 32 95.0 33 167.0 34 266.0 35 587.0 36 2556.0 37 167.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.35794743429287 10.788485607008761 5.131414267834793 37.72215269086358 2 24.575 14.374999999999998 31.85 29.2 3 21.95 17.4 22.7 37.95 4 28.1 25.35 20.424999999999997 26.125 5 26.950000000000003 29.95 21.475 21.625 6 22.25 30.45 23.375 23.925 7 19.475 22.6 38.1 19.825 8 19.725 23.674999999999997 29.299999999999997 27.3 9 20.225 20.8 32.125 26.85 10-14 24.22 25.795 24.279999999999998 25.705 15-19 23.91 24.79 25.09 26.21 20-24 23.89 24.87 25.16 26.08 25-29 24.59 24.97 24.3 26.14 30-34 24.905 23.68 24.44 26.974999999999998 35-39 24.545 24.529999999999998 24.325 26.6 40-44 24.525 24.68 24.08 26.715 45-49 24.310000000000002 24.895 24.085 26.71 50-54 23.93 24.685000000000002 24.505 26.88 55-59 23.755000000000003 24.73 24.66 26.855 60-64 24.795 23.775 24.275 27.155 65-69 24.58 24.435000000000002 24.32 26.665 70-74 24.654999999999998 24.675 23.169999999999998 27.500000000000004 75-79 25.19 24.09 23.91 26.810000000000002 80-84 23.919999999999998 24.065 24.560000000000002 27.455000000000002 85-89 25.705 23.53 24.060000000000002 26.705000000000002 90-94 25.580000000000002 23.89 23.785 26.745 95-99 24.515 23.745 24.48 27.26 100-104 25.355 23.810000000000002 24.654999999999998 26.179999999999996 105-109 25.285000000000004 23.775 24.585 26.355 110-114 25.525 23.53 23.825 27.12 115-119 25.014999999999997 23.74 23.865 27.38 120-124 25.430000000000003 23.825 23.54 27.205000000000002 125-129 25.695 24.37 22.74 27.195000000000004 130-134 25.46 23.955000000000002 23.325000000000003 27.26 135-139 25.674999999999997 23.895 23.435 26.995 140-144 26.015 24.154999999999998 22.884999999999998 26.945000000000004 145-149 25.5 23.785 23.415 27.3 150-151 26.3 24.825 22.0 26.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 2.0 28 3.0 29 4.0 30 10.5 31 18.5 32 20.5 33 19.0 34 23.0 35 31.5 36 44.0 37 63.0 38 74.5 39 80.5 40 102.0 41 124.5 42 137.0 43 151.5 44 154.0 45 148.5 46 149.5 47 147.0 48 149.0 49 167.0 50 149.0 51 130.5 52 132.5 53 121.0 54 124.0 55 122.5 56 130.0 57 126.5 58 102.0 59 90.0 60 84.0 61 81.5 62 81.0 63 75.5 64 72.5 65 66.5 66 61.0 67 67.0 68 61.0 69 50.5 70 45.5 71 39.5 72 30.5 73 29.0 74 31.5 75 22.5 76 13.5 77 10.0 78 8.0 79 5.5 80 2.0 81 2.0 82 3.5 83 2.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.525 #Duplication Level Percentage of deduplicated Percentage of total 1 89.94694219491763 80.525 2 8.740575258307736 15.65 3 1.005305780508238 2.7 4 0.27925160569673274 1.0 5 0.027925160569673275 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGATCCAGCCGCACCTTCCAGTACGGCTACCTTGTTACGACTTCACTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.23750000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.6625 0.0 0.0 0.0 0.0 116-117 2.8499999999999996 0.0 0.0 0.0 0.0 118-119 3.225 0.0 0.0 0.0 0.0 120-121 3.4749999999999996 0.0 0.0 0.0 0.0 122-123 3.7875 0.0 0.0 0.0 0.0 124-125 4.1875 0.0 0.0 0.0 0.0 126-127 4.6125 0.0 0.0 0.0 0.0 128-129 5.175000000000001 0.0 0.0 0.0 0.0 130-131 5.5125 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.5 0.0 0.0 0.0 0.0 136-137 7.1 0.0 0.0 0.0 0.0 138-139 7.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTAAGC 10 0.006830828 145.0 6 AAGCTGC 10 0.006830828 145.0 9 >>END_MODULE SRR7814837 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814837_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0825 37.0 37.0 37.0 37.0 37.0 2 35.667 37.0 37.0 37.0 37.0 37.0 3 35.7395 37.0 37.0 37.0 37.0 37.0 4 35.755 37.0 37.0 37.0 37.0 37.0 5 35.7755 37.0 37.0 37.0 37.0 37.0 6 35.5305 37.0 37.0 37.0 37.0 37.0 7 35.572 37.0 37.0 37.0 37.0 37.0 8 35.549 37.0 37.0 37.0 37.0 37.0 9 35.81 37.0 37.0 37.0 37.0 37.0 10-14 35.7603 37.0 37.0 37.0 37.0 37.0 15-19 35.2954 37.0 37.0 37.0 37.0 37.0 20-24 35.5559 37.0 37.0 37.0 37.0 37.0 25-29 35.394 37.0 37.0 37.0 34.6 37.0 30-34 35.136 37.0 37.0 37.0 29.8 37.0 35-39 35.2154 37.0 37.0 37.0 32.2 37.0 40-44 34.921200000000006 37.0 37.0 37.0 27.4 37.0 45-49 35.0264 37.0 37.0 37.0 27.4 37.0 50-54 34.2879 37.0 37.0 37.0 25.0 37.0 55-59 34.1399 37.0 37.0 37.0 25.0 37.0 60-64 34.55649999999999 37.0 37.0 37.0 25.0 37.0 65-69 34.4399 37.0 37.0 37.0 25.0 37.0 70-74 34.03060000000001 37.0 37.0 37.0 25.0 37.0 75-79 33.856700000000004 37.0 37.0 37.0 25.0 37.0 80-84 33.78 37.0 37.0 37.0 22.2 37.0 85-89 34.2779 37.0 37.0 37.0 25.0 37.0 90-94 33.7168 37.0 37.0 37.0 25.0 37.0 95-99 32.8613 37.0 37.0 37.0 11.0 37.0 100-104 33.14190000000001 37.0 37.0 37.0 11.0 37.0 105-109 32.688100000000006 37.0 37.0 37.0 13.8 37.0 110-114 33.0233 37.0 37.0 37.0 16.6 37.0 115-119 33.2708 37.0 37.0 37.0 16.6 37.0 120-124 32.452299999999994 37.0 37.0 37.0 11.0 37.0 125-129 32.7039 37.0 37.0 37.0 11.0 37.0 130-134 32.0778 37.0 29.8 37.0 11.0 37.0 135-139 32.1103 37.0 32.2 37.0 11.0 37.0 140-144 32.30970000000001 37.0 34.6 37.0 11.0 37.0 145-149 31.8671 37.0 27.4 37.0 11.0 37.0 150-151 31.4265 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 2.0 16 2.0 17 1.0 18 1.0 19 4.0 20 7.0 21 10.0 22 22.0 23 39.0 24 47.0 25 78.0 26 74.0 27 97.0 28 102.0 29 110.0 30 144.0 31 152.0 32 167.0 33 206.0 34 326.0 35 778.0 36 1588.0 37 39.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.8 17.675 8.575000000000001 32.95 2 31.3 23.025000000000002 24.9 20.775 3 23.5 24.9 27.250000000000004 24.349999999999998 4 26.55 30.0 19.650000000000002 23.799999999999997 5 28.875 33.45 17.849999999999998 19.825 6 24.575 35.725 17.974999999999998 21.725 7 23.125 18.7 33.175 25.0 8 25.05 21.875 23.200000000000003 29.875 9 24.625 21.9 24.425 29.049999999999997 10-14 27.195000000000004 24.52 21.705 26.58 15-19 26.85 24.485 22.925 25.740000000000002 20-24 26.805 24.555 22.98 25.66 25-29 27.155 24.67 22.205 25.97 30-34 26.645000000000003 25.235000000000003 22.96 25.16 35-39 27.185 24.759999999999998 22.465 25.590000000000003 40-44 27.435 24.555 22.7 25.31 45-49 27.12 24.775 22.085 26.02 50-54 26.58 24.38 23.47 25.569999999999997 55-59 26.305 25.575 22.884999999999998 25.235000000000003 60-64 26.484999999999996 24.58 23.155 25.779999999999998 65-69 26.875 25.019999999999996 23.119999999999997 24.985 70-74 27.37 24.715 22.495 25.419999999999998 75-79 26.415 25.21 23.005 25.369999999999997 80-84 26.5 24.740000000000002 23.62 25.14 85-89 26.745 24.305 22.755 26.195 90-94 26.810000000000002 25.21 22.45 25.53 95-99 26.705000000000002 25.81 23.095 24.39 100-104 26.724999999999998 25.224999999999998 23.044999999999998 25.005 105-109 26.090000000000003 26.064999999999998 23.185 24.66 110-114 27.175 26.0 22.919999999999998 23.905 115-119 27.46 25.195 22.73 24.615000000000002 120-124 26.784999999999997 26.43 22.09 24.695 125-129 27.169999999999998 26.36 21.91 24.560000000000002 130-134 26.724999999999998 26.924999999999997 22.21 24.14 135-139 26.93 26.69 22.41 23.97 140-144 27.944999999999997 26.495 21.805 23.755000000000003 145-149 27.744999999999997 27.66 21.93 22.665 150-151 27.8125 26.6625 21.712500000000002 23.8125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 2.0 23 3.0 24 2.0 25 2.5 26 4.5 27 6.0 28 5.5 29 12.5 30 15.5 31 12.0 32 14.5 33 20.0 34 29.0 35 38.0 36 41.0 37 46.5 38 50.0 39 74.0 40 97.0 41 96.5 42 109.0 43 114.5 44 113.0 45 134.0 46 150.5 47 161.0 48 150.5 49 135.0 50 137.5 51 133.0 52 118.0 53 112.0 54 122.5 55 135.0 56 128.0 57 105.5 58 111.5 59 109.5 60 98.5 61 99.0 62 94.0 63 89.5 64 86.0 65 83.5 66 85.0 67 80.5 68 74.0 69 64.0 70 49.0 71 39.5 72 39.5 73 34.5 74 27.0 75 24.0 76 16.5 77 14.0 78 12.0 79 6.5 80 3.0 81 2.0 82 3.0 83 3.5 84 2.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.8 #Duplication Level Percentage of deduplicated Percentage of total 1 91.27202643171806 82.875 2 7.6266519823788546 13.850000000000001 3 0.881057268722467 2.4 4 0.13766519823788548 0.5 5 0.08259911894273128 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit CGTTAACGAACGAGACCTCAGCCTGCTAACTAGCTATGCGGAGCCATCCC 5 0.125 No Hit GTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.9874999999999998 0.0 0.0 0.0 0.0 114-115 2.275 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.25 0.0 0.0 0.0 0.0 124-125 3.5875000000000004 0.0 0.0 0.0 0.0 126-127 4.0 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.825 0.0 0.0 0.0 0.0 132-133 5.237500000000001 0.0 0.0 0.0 0.0 134-135 5.6375 0.0 0.0 0.0 0.0 136-137 6.1875 0.0 0.0 0.0 0.0 138-139 6.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATCG 10 0.006830828 145.0 3 CTTTGTT 10 0.006830828 145.0 8 TTTGTTT 10 0.006830828 145.0 9 >>END_MODULE Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274368 spots for SRR7814837.sra Written 1274368 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra Read 1274363 spots for SRR7814837.sra Written 1274363 spots for SRR7814837.sra SRR ids: ['SRR7814837.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wziyg4tu SRR7814837.sra spots: 25487265 blocks: [[1, 1274363], [1274364, 2548726], [2548727, 3823089], [3823090, 5097452], [5097453, 6371815], [6371816, 7646178], [7646179, 8920541], [8920542, 10194904], [10194905, 11469267], [11469268, 12743630], [12743631, 14017993], [14017994, 15292356], [15292357, 16566719], [16566720, 17841082], [17841083, 19115445], [19115446, 20389808], [20389809, 21664171], [21664172, 22938534], [22938535, 24212897], [24212898, 25487265]] SRR7814837 file size 8615097 SRR7814837 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814837 SRR7814837_1.fastq SRR7814837_2.fastq Input file: SRR7814837_1.fastq Paired file: SRR7814837_2.fastq trimmed: SRR7814837-trimmed-pair1.fastq, SRR7814837-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 11:58:28 2024 >> started Fri Dec 6 11:58:59 2024 >> done (30.639s) 25487265 read pairs processed; of these: 104 ( 0.00%) short read pairs filtered out after trimming by size control 2837 ( 0.01%) empty read pairs filtered out after trimming by size control 25484324 (99.99%) read pairs available; of these: 2612691 (10.25%) trimmed read pairs available after processing 22871633 (89.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 7 0.00% 20 14 0.00% 21 12 0.00% 22 10 0.00% 23 13 0.00% 24 11 0.00% 25 22 0.00% 26 21 0.00% 27 17 0.00% 28 27 0.00% 29 26 0.00% 30 21 0.00% 31 27 0.00% 32 32 0.00% 33 34 0.00% 34 36 0.00% 35 44 0.00% 36 44 0.00% 37 43 0.00% 38 42 0.00% 39 43 0.00% 40 49 0.00% 41 51 0.00% 42 62 0.00% 43 65 0.00% 44 68 0.00% 45 63 0.00% 46 80 0.00% 47 80 0.00% 48 89 0.00% 49 100 0.00% 50 115 0.00% 51 140 0.00% 52 124 0.00% 53 150 0.00% 54 160 0.00% 55 187 0.00% 56 195 0.00% 57 194 0.00% 58 252 0.00% 59 281 0.00% 60 359 0.00% 61 380 0.00% 62 377 0.00% 63 431 0.00% 64 475 0.00% 65 549 0.00% 66 551 0.00% 67 673 0.00% 68 748 0.00% 69 864 0.00% 70 1015 0.00% 71 1135 0.00% 72 1297 0.01% 73 1389 0.01% 74 1624 0.01% 75 1822 0.01% 76 1998 0.01% 77 2220 0.01% 78 2457 0.01% 79 2824 0.01% 80 3151 0.01% 81 3553 0.01% 82 3900 0.02% 83 4375 0.02% 84 4878 0.02% 85 5475 0.02% 86 5872 0.02% 87 6443 0.03% 88 6904 0.03% 89 7675 0.03% 90 8371 0.03% 91 9368 0.04% 92 10284 0.04% 93 11169 0.04% 94 12130 0.05% 95 13060 0.05% 96 13903 0.05% 97 14841 0.06% 98 15737 0.06% 99 16599 0.07% 100 17799 0.07% 101 18701 0.07% 102 19851 0.08% 103 21228 0.08% 104 22355 0.09% 105 23135 0.09% 106 24267 0.10% 107 25605 0.10% 108 26658 0.10% 109 27987 0.11% 110 28882 0.11% 111 30207 0.12% 112 31814 0.12% 113 33098 0.13% 114 34384 0.13% 115 36218 0.14% 116 37510 0.15% 117 37787 0.15% 118 38503 0.15% 119 39437 0.15% 120 41143 0.16% 121 42277 0.17% 122 43600 0.17% 123 45183 0.18% 124 46344 0.18% 125 47521 0.19% 126 49247 0.19% 127 50242 0.20% 128 50918 0.20% 129 52510 0.21% 130 52777 0.21% 131 54210 0.21% 132 56251 0.22% 133 57639 0.23% 134 58272 0.23% 135 60016 0.24% 136 60599 0.24% 137 61254 0.24% 138 61770 0.24% 139 63960 0.25% 140 64397 0.25% 141 64882 0.25% 142 67384 0.26% 143 67982 0.27% 144 69857 0.27% 145 71395 0.28% 146 71704 0.28% 147 73940 0.29% 148 74860 0.29% 149 74612 0.29% 150 76580 0.30% 151 22871633 89.75% 25484324 reads passed initial QC criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=11 prefix-density=1.01 prefix-fanout=3.1 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=20.74 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=3.3 sequence=GGAGGAGAGAGCACTCATCTTGGGGTGGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCTCCGCACTTGGCTACCCAGCGTTTACCGTAGGCACGATAACTGGTACACCAGAGGTGCGTCCTTCCCGGTCCTCTCGTACTAGGGAAAGGTCCTCTCAATGCTCTAACGCCCACACCGGATATGGACCGAACTGTCTCACGA criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=20 prefix-density=0.89 prefix-fanout=2.4 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=58.53 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=4.2 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7814837 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:00:01 Started mapping on | Dec 06 12:00:01 Finished on | Dec 06 12:04:11 Mapping speed, Million of reads per hour | 366.97 Number of input reads | 25484324 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 21626816 Uniquely mapped reads % | 84.86% Average mapped length | 295.48 Number of splices: Total | 19811677 Number of splices: Annotated (sjdb) | 18729103 Number of splices: GT/AG | 19524746 Number of splices: GC/AG | 235773 Number of splices: AT/AC | 6103 Number of splices: Non-canonical | 45055 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.02% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1172586 % of reads mapped to multiple loci | 4.60% Number of reads mapped to too many loci | 193161 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.06% % of reads unmapped: other | 4.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2684922 2684922 2684922 N_multimapping 1172586 1172586 1172586 N_noFeature 1509052 20960659 1676960 N_ambiguous 613810 2687 116437 UnstrandedReadsAssigned:19503954 PositiveStrandReadsAssigned:663470 NegativeStrandReadsAssigned:19833419 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814837 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814837-trimmed-pair1.fastq SRR7814837-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,484,324 reads, 20,428,997 reads pseudoaligned [quant] estimated average fragment length: 263.966 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR7814837.ke.tsv 35125 SRR7814837.se.tsv 88098 total ==> SRR7814837.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 673.456 0 0 PNS24247 1044 781.034 45.9752 3.38448 PNS24249 1928 1665.03 111.812 3.86104 PNS24246 1044 781.034 45.9752 3.38448 PNS24248 1044 781.034 45.9752 3.38448 PNS24244 1471 1208.03 113.263 5.39072 PNS24243 293 94.7258 6 3.64185 KQK14069 1603 1340.03 8703.66 373.444 KQK14071 474 232.796 114.698 28.3283 ==> SRR7814837.se.tsv <== BRADI_1g14170v3 9100 BRADI_1g53295v3 1123 BRADI_1g59795v3 183 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 194 BRADI_1g74790v3 209 BRADI_1g09890v3 0 BRADI_1g77505v3 447 BRADI_1g48960v3 1 SRR7814837 completed mapping pipeline successfully