Starting /dee2/code/volunteer_pipeline.sh SRR7814838 current disk space = 1551425114112 free memory = 1602189172 SRR7814838 SRAfilesize 3cadf4bf4b97f050f30a8f08a13f9fcf SRR7814838.sra SRR7814838.sra file validated SRR7814838 is paired end SRR7814838 is conventional basespace SRR7814838 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814838_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.29125 37.0 37.0 37.0 37.0 37.0 2 36.357 37.0 37.0 37.0 37.0 37.0 3 36.3015 37.0 37.0 37.0 37.0 37.0 4 36.45 37.0 37.0 37.0 37.0 37.0 5 36.5095 37.0 37.0 37.0 37.0 37.0 6 36.5075 37.0 37.0 37.0 37.0 37.0 7 36.3735 37.0 37.0 37.0 37.0 37.0 8 36.48 37.0 37.0 37.0 37.0 37.0 9 36.508 37.0 37.0 37.0 37.0 37.0 10-14 36.4825 37.0 37.0 37.0 37.0 37.0 15-19 36.4669 37.0 37.0 37.0 37.0 37.0 20-24 36.4106 37.0 37.0 37.0 37.0 37.0 25-29 36.4324 37.0 37.0 37.0 37.0 37.0 30-34 36.3437 37.0 37.0 37.0 37.0 37.0 35-39 36.3155 37.0 37.0 37.0 37.0 37.0 40-44 36.1371 37.0 37.0 37.0 37.0 37.0 45-49 35.258799999999994 37.0 37.0 37.0 29.8 37.0 50-54 35.7572 37.0 37.0 37.0 34.6 37.0 55-59 34.652 37.0 37.0 37.0 25.0 37.0 60-64 34.667699999999996 37.0 37.0 37.0 27.4 37.0 65-69 34.4607 37.0 37.0 37.0 19.0 37.0 70-74 35.0187 37.0 37.0 37.0 32.2 37.0 75-79 35.9889 37.0 37.0 37.0 37.0 37.0 80-84 36.0952 37.0 37.0 37.0 37.0 37.0 85-89 36.09179999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.999700000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.919599999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.925 37.0 37.0 37.0 37.0 37.0 105-109 35.9425 37.0 37.0 37.0 37.0 37.0 110-114 35.955200000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.7656 37.0 37.0 37.0 37.0 37.0 120-124 35.749 37.0 37.0 37.0 37.0 37.0 125-129 35.71560000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.5895 37.0 37.0 37.0 37.0 37.0 135-139 35.508399999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.4465 37.0 37.0 37.0 37.0 37.0 145-149 35.2651 37.0 37.0 37.0 29.8 37.0 150-151 34.673249999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 7.0 25 0.0 26 11.0 27 22.0 28 21.0 29 34.0 30 41.0 31 58.0 32 83.0 33 221.0 34 342.0 35 339.0 36 2593.0 37 228.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 50.891287973889035 11.09716294250565 4.946020587496862 33.065528496108456 2 21.925 21.099999999999998 31.1 25.874999999999996 3 20.05 18.65 30.15 31.15 4 26.200000000000003 23.175 19.35 31.275 5 34.050000000000004 26.424999999999997 20.849999999999998 18.675 6 28.65 29.799999999999997 21.125 20.424999999999997 7 16.75 29.2 36.425000000000004 17.625 8 18.675 27.675 28.625 25.025 9 27.375 19.35 30.275000000000002 23.0 10-14 23.7 26.950000000000003 23.294999999999998 26.055 15-19 23.395 24.425 24.92 27.26 20-24 23.79 26.91 24.595 24.705 25-29 23.485 24.775 24.725 27.015 30-34 23.65 24.29 24.709999999999997 27.35 35-39 23.345 24.555 24.88 27.22 40-44 21.62 25.165 27.839999999999996 25.374999999999996 45-49 23.919999999999998 24.135 26.22 25.724999999999998 50-54 25.395 22.425 24.805 27.375 55-59 22.45 22.74 28.255000000000003 26.555 60-64 24.19 22.91 27.105 25.795 65-69 24.615000000000002 28.52 23.005 23.86 70-74 30.37 23.225 22.45 23.955000000000002 75-79 30.845 22.505 22.89 23.76 80-84 30.14 23.255 22.720000000000002 23.885 85-89 30.825000000000003 22.21 23.29 23.674999999999997 90-94 31.130000000000003 22.93 22.625 23.315 95-99 30.895 23.085 22.445 23.575 100-104 30.7 23.16 22.17 23.97 105-109 30.9 22.875 22.42 23.805 110-114 30.855 23.26 22.15 23.735 115-119 30.925000000000004 22.225 22.720000000000002 24.13 120-124 31.135 22.865 22.14 23.86 125-129 30.464999999999996 22.8 22.62 24.115000000000002 130-134 31.1 22.59 22.205 24.104999999999997 135-139 31.105 22.97 21.995 23.93 140-144 30.740000000000002 23.035 22.335 23.89 145-149 31.674999999999997 22.720000000000002 21.77 23.835 150-151 31.125000000000004 22.0125 21.6 25.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 2.0 27 2.5 28 2.5 29 3.5 30 8.5 31 11.0 32 10.5 33 17.0 34 30.0 35 35.0 36 50.0 37 59.0 38 69.5 39 86.0 40 105.0 41 136.0 42 154.0 43 151.5 44 151.0 45 165.0 46 177.0 47 180.0 48 163.0 49 162.5 50 159.5 51 138.0 52 126.5 53 103.0 54 83.5 55 85.5 56 87.5 57 77.0 58 68.5 59 70.0 60 67.0 61 65.0 62 60.0 63 59.0 64 61.0 65 86.5 66 130.5 67 134.5 68 113.0 69 74.0 70 45.0 71 37.5 72 30.0 73 28.5 74 22.0 75 14.5 76 12.5 77 8.0 78 5.0 79 4.5 80 2.0 81 1.0 82 0.5 83 0.0 84 1.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.275 #Duplication Level Percentage of deduplicated Percentage of total 1 94.9584646233171 82.875 2 4.554568891435118 7.95 3 0.40103122314523065 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.028645087367516472 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.057290174735032943 7.9 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTACGTTATCTCGTAT 203 5.075 TruSeq Adapter, Index 6 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTACGTTATCGCGTAT 113 2.825 TruSeq Adapter, Index 6 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTACGTTATCGCGGAT 9 0.22499999999999998 TruSeq Adapter, Index 6 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.2874999999999996 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.5375 0.0 0.0 0.0 0.0 124-125 3.9250000000000003 0.0 0.0 0.0 0.0 126-127 4.2875 0.0 0.0 0.0 0.0 128-129 4.7 0.0 0.0 0.0 0.0 130-131 4.975 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.825 0.0 0.0 0.0 0.0 136-137 6.225 0.0 0.0 0.0 0.0 138-139 6.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTCTT 10 0.006830828 145.0 6 TTCTTTA 10 0.006830828 145.0 8 AGGTAGA 10 0.006830828 145.0 5 CGGAAGA 50 1.7769479E-4 58.0 4 AGAGCAC 50 1.7769479E-4 58.0 8 TCGGAAG 55 2.8464277E-4 52.727276 3 GAGCACA 55 2.8464277E-4 52.727276 9 ATCGGAA 55 2.8464277E-4 52.727276 2 GGAAGAG 55 2.8464277E-4 52.727276 5 AAGAGCA 60 4.3742658E-4 48.333332 7 GATCGGA 60 4.3742658E-4 48.333332 1 GAAGAGC 65 6.491996E-4 44.615383 6 AGGGGGG 20 0.00593511 29.0 65-69 GTATGCC 20 0.00593511 29.0 45-49 ATCTCGT 20 0.00593511 29.0 40-44 ACGTTAT 20 0.00593511 29.0 35-39 TTATCTC 20 0.00593511 29.0 40-44 TACGTTA 20 0.00593511 29.0 35-39 TATCTCG 20 0.00593511 29.0 40-44 CGTATGC 20 0.00593511 29.0 45-49 >>END_MODULE SRR7814838 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814838_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.349 37.0 37.0 37.0 37.0 37.0 2 35.946 37.0 37.0 37.0 37.0 37.0 3 35.8625 37.0 37.0 37.0 37.0 37.0 4 35.928 37.0 37.0 37.0 37.0 37.0 5 36.0525 37.0 37.0 37.0 37.0 37.0 6 36.126 37.0 37.0 37.0 37.0 37.0 7 35.5575 37.0 37.0 37.0 37.0 37.0 8 34.946 37.0 37.0 37.0 25.0 37.0 9 35.173 37.0 37.0 37.0 37.0 37.0 10-14 34.9058 37.0 37.0 37.0 25.0 37.0 15-19 34.8591 37.0 37.0 37.0 25.0 37.0 20-24 34.7506 37.0 37.0 37.0 25.0 37.0 25-29 34.1216 37.0 37.0 37.0 25.0 37.0 30-34 34.0398 37.0 37.0 37.0 22.2 37.0 35-39 33.95 37.0 37.0 37.0 19.4 37.0 40-44 33.9739 37.0 37.0 37.0 22.2 37.0 45-49 33.9823 37.0 37.0 37.0 25.0 37.0 50-54 34.016999999999996 37.0 37.0 37.0 25.0 37.0 55-59 34.1674 37.0 37.0 37.0 25.0 37.0 60-64 34.238200000000006 37.0 37.0 37.0 25.0 37.0 65-69 34.172799999999995 37.0 37.0 37.0 25.0 37.0 70-74 33.8666 37.0 37.0 37.0 25.0 37.0 75-79 33.875800000000005 37.0 37.0 37.0 19.4 37.0 80-84 33.797200000000004 37.0 37.0 37.0 22.2 37.0 85-89 33.87740000000001 37.0 37.0 37.0 25.0 37.0 90-94 34.3027 37.0 37.0 37.0 25.0 37.0 95-99 34.57640000000001 37.0 37.0 37.0 25.0 37.0 100-104 34.8976 37.0 37.0 37.0 25.0 37.0 105-109 34.9867 37.0 37.0 37.0 25.0 37.0 110-114 34.8808 37.0 37.0 37.0 25.0 37.0 115-119 34.9799 37.0 37.0 37.0 25.0 37.0 120-124 34.913999999999994 37.0 37.0 37.0 25.0 37.0 125-129 34.9171 37.0 37.0 37.0 25.0 37.0 130-134 34.7921 37.0 37.0 37.0 25.0 37.0 135-139 34.598400000000005 37.0 37.0 37.0 25.0 37.0 140-144 34.524800000000006 37.0 37.0 37.0 25.0 37.0 145-149 34.4889 37.0 37.0 37.0 25.0 37.0 150-151 33.719 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 7.0 15 8.0 16 10.0 17 17.0 18 12.0 19 17.0 20 24.0 21 34.0 22 38.0 23 44.0 24 50.0 25 63.0 26 53.0 27 40.0 28 19.0 29 34.0 30 43.0 31 50.0 32 82.0 33 120.0 34 234.0 35 651.0 36 2227.0 37 121.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.15 15.45 7.9750000000000005 27.425 2 34.675 20.150000000000002 25.825 19.35 3 29.025000000000002 21.425 26.575 22.975 4 33.275 28.475 17.125 21.125 5 34.8 28.4 19.025 17.775 6 29.299999999999997 31.6 19.0 20.1 7 28.625 15.675 33.175 22.525000000000002 8 29.075 20.724999999999998 21.525 28.675 9 30.3 19.175 26.150000000000002 24.375 10-14 31.985000000000003 24.02 21.01 22.985 15-19 32.09 23.419999999999998 22.025 22.465 20-24 31.86 23.305 22.205 22.63 25-29 30.61 24.355 22.21 22.825 30-34 29.865000000000002 24.26 23.015 22.86 35-39 28.785 25.45 23.125 22.64 40-44 28.860000000000003 24.0 24.884999999999998 22.255 45-49 29.38 23.775 23.955000000000002 22.89 50-54 30.064999999999998 23.46 24.065 22.41 55-59 31.275 23.419999999999998 23.13 22.175 60-64 32.074999999999996 23.22 22.205 22.5 65-69 31.31 23.715 22.475 22.5 70-74 30.81 24.42 22.59 22.18 75-79 29.205 25.205 23.015 22.575 80-84 29.794999999999998 23.985 23.43 22.79 85-89 30.620000000000005 24.735 22.1 22.545 90-94 31.4 24.095 22.285 22.220000000000002 95-99 31.695 24.04 21.715 22.55 100-104 32.745000000000005 23.46 21.625 22.17 105-109 32.46 23.36 21.935 22.245 110-114 32.785 22.945 21.815 22.455 115-119 33.03 23.135 21.94 21.895 120-124 33.14 22.745 22.02 22.095000000000002 125-129 33.550000000000004 23.04 21.78 21.63 130-134 33.625 22.919999999999998 21.715 21.740000000000002 135-139 33.885 23.36 21.87 20.885 140-144 33.785 23.0 21.75 21.465 145-149 33.955 23.175 21.195 21.675 150-151 34.175 22.8 21.4375 21.587500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.5 3 1.0 4 0.5 5 1.5 6 2.5 7 2.0 8 1.0 9 1.0 10 2.0 11 2.5 12 2.0 13 1.0 14 0.5 15 0.5 16 1.5 17 2.0 18 1.5 19 1.5 20 1.5 21 1.5 22 2.5 23 2.5 24 1.5 25 3.0 26 3.5 27 2.0 28 6.5 29 12.0 30 11.0 31 11.0 32 11.0 33 13.0 34 26.0 35 33.0 36 39.5 37 56.5 38 66.0 39 77.0 40 92.5 41 111.0 42 134.5 43 146.5 44 145.5 45 159.0 46 168.5 47 174.0 48 161.5 49 147.5 50 161.5 51 140.5 52 103.5 53 80.0 54 85.5 55 87.5 56 74.0 57 83.5 58 91.0 59 90.5 60 79.5 61 62.0 62 57.0 63 61.0 64 70.5 65 67.5 66 64.0 67 69.0 68 65.5 69 63.0 70 53.0 71 40.0 72 30.0 73 28.5 74 29.0 75 24.0 76 19.5 77 11.5 78 7.5 79 6.0 80 3.5 81 3.0 82 5.0 83 6.0 84 6.0 85 7.0 86 6.0 87 4.5 88 6.5 89 9.0 90 12.0 91 13.5 92 12.0 93 15.0 94 17.5 95 20.5 96 22.5 97 20.0 98 18.5 99 18.0 100 15.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.59482986019519 90.60000000000001 2 3.9303613822210495 7.449999999999999 3 0.3692957003429174 1.05 4 0.07913479293062516 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026378264310208392 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 24 0.6 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.3375000000000004 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 2.9749999999999996 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.262499999999999 0.0 0.0 0.0 0.0 128-129 4.65 0.0 0.0 0.0 0.0 130-131 4.925000000000001 0.0 0.0 0.0 0.0 132-133 5.3375 0.0 0.0 0.0 0.0 134-135 5.775 0.0 0.0 0.0 0.0 136-137 6.15 0.0 0.0 0.0 0.0 138-139 6.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCTGG 10 0.006830828 145.0 2 CAACATT 10 0.006830828 145.0 8 >>END_MODULE Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355613 spots for SRR7814838.sra Written 2355613 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra Read 2355610 spots for SRR7814838.sra Written 2355610 spots for SRR7814838.sra SRR ids: ['SRR7814838.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7z9gk87m SRR7814838.sra spots: 47112203 blocks: [[1, 2355610], [2355611, 4711220], [4711221, 7066830], [7066831, 9422440], [9422441, 11778050], [11778051, 14133660], [14133661, 16489270], [16489271, 18844880], [18844881, 21200490], [21200491, 23556100], [23556101, 25911710], [25911711, 28267320], [28267321, 30622930], [30622931, 32978540], [32978541, 35334150], [35334151, 37689760], [37689761, 40045370], [40045371, 42400980], [42400981, 44756590], [44756591, 47112203]] SRR7814838 file size 15943079 SRR7814838 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814838 SRR7814838_1.fastq SRR7814838_2.fastq Input file: SRR7814838_1.fastq Paired file: SRR7814838_2.fastq trimmed: SRR7814838-trimmed-pair1.fastq, SRR7814838-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:01:52 2024 >> started Fri Dec 6 12:03:02 2024 >> done (69.598s) 47112203 read pairs processed; of these: 879 ( 0.00%) short read pairs filtered out after trimming by size control 3455120 ( 7.33%) empty read pairs filtered out after trimming by size control 43656204 (92.66%) read pairs available; of these: 4502426 (10.31%) trimmed read pairs available after processing 39153778 (89.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 15 0.00% 20 19 0.00% 21 22 0.00% 22 20 0.00% 23 31 0.00% 24 30 0.00% 25 38 0.00% 26 46 0.00% 27 44 0.00% 28 45 0.00% 29 37 0.00% 30 48 0.00% 31 54 0.00% 32 67 0.00% 33 56 0.00% 34 52 0.00% 35 64 0.00% 36 64 0.00% 37 70 0.00% 38 81 0.00% 39 87 0.00% 40 93 0.00% 41 105 0.00% 42 113 0.00% 43 105 0.00% 44 116 0.00% 45 110 0.00% 46 132 0.00% 47 135 0.00% 48 143 0.00% 49 183 0.00% 50 237 0.00% 51 244 0.00% 52 266 0.00% 53 253 0.00% 54 266 0.00% 55 300 0.00% 56 352 0.00% 57 348 0.00% 58 434 0.00% 59 529 0.00% 60 499 0.00% 61 636 0.00% 62 667 0.00% 63 791 0.00% 64 923 0.00% 65 859 0.00% 66 980 0.00% 67 1116 0.00% 68 1304 0.00% 69 1459 0.00% 70 1670 0.00% 71 1849 0.00% 72 2227 0.01% 73 2400 0.01% 74 2820 0.01% 75 3128 0.01% 76 3388 0.01% 77 3699 0.01% 78 4109 0.01% 79 4504 0.01% 80 5160 0.01% 81 5912 0.01% 82 6621 0.02% 83 7440 0.02% 84 8455 0.02% 85 9248 0.02% 86 10022 0.02% 87 10909 0.02% 88 12077 0.03% 89 12885 0.03% 90 14174 0.03% 91 15831 0.04% 92 17268 0.04% 93 18818 0.04% 94 20530 0.05% 95 22339 0.05% 96 23600 0.05% 97 25481 0.06% 98 26422 0.06% 99 28343 0.06% 100 30372 0.07% 101 32049 0.07% 102 34110 0.08% 103 36834 0.08% 104 38041 0.09% 105 40461 0.09% 106 42388 0.10% 107 44415 0.10% 108 45717 0.10% 109 48013 0.11% 110 49741 0.11% 111 51787 0.12% 112 54857 0.13% 113 56607 0.13% 114 58821 0.13% 115 62190 0.14% 116 63948 0.15% 117 66010 0.15% 118 67046 0.15% 119 68548 0.16% 120 70926 0.16% 121 72838 0.17% 122 75215 0.17% 123 78153 0.18% 124 80384 0.18% 125 82109 0.19% 126 84850 0.19% 127 86455 0.20% 128 87036 0.20% 129 90201 0.21% 130 91458 0.21% 131 92783 0.21% 132 96177 0.22% 133 98621 0.23% 134 101400 0.23% 135 103488 0.24% 136 104481 0.24% 137 106058 0.24% 138 106887 0.24% 139 110542 0.25% 140 111627 0.26% 141 113489 0.26% 142 115476 0.26% 143 117416 0.27% 144 120933 0.28% 145 124178 0.28% 146 124162 0.28% 147 127700 0.29% 148 128620 0.29% 149 128955 0.30% 150 131828 0.30% 151 39153778 89.69% 43656204 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=30 prefix-density=0.29 prefix-fanout=2.2 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=217.58 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=14.2 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=33 prefix-density=0.46 prefix-fanout=2.2 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=156.08 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=19.8 sequence=GCCGCCGCCGCC SRR7814838 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:05:03 Started mapping on | Dec 06 12:05:03 Finished on | Dec 06 12:11:38 Mapping speed, Million of reads per hour | 397.88 Number of input reads | 43656204 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 40608212 Uniquely mapped reads % | 93.02% Average mapped length | 295.64 Number of splices: Total | 41298159 Number of splices: Annotated (sjdb) | 38848326 Number of splices: GT/AG | 40702780 Number of splices: GC/AG | 481129 Number of splices: AT/AC | 17363 Number of splices: Non-canonical | 96887 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 699928 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 52487 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.56% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2348064 2348064 2348064 N_multimapping 699928 699928 699928 N_noFeature 1901769 39394951 2299834 N_ambiguous 956974 6759 142635 UnstrandedReadsAssigned:37749469 PositiveStrandReadsAssigned:1206502 NegativeStrandReadsAssigned:38165743 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814838 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814838-trimmed-pair1.fastq SRR7814838-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,656,204 reads, 38,681,888 reads pseudoaligned [quant] estimated average fragment length: 268.889 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,245 rounds 52973 SRR7814838.ke.tsv 35125 SRR7814838.se.tsv 88098 total ==> SRR7814838.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.827 0 0 PNS24247 1044 776.111 133.698 6.36772 PNS24249 1928 1660.11 327.363 7.28912 PNS24246 1044 776.111 133.698 6.36772 PNS24248 1044 776.111 133.698 6.36772 PNS24244 1471 1203.11 328.543 10.0941 PNS24243 293 93.7718 1 0.394195 KQK14069 1603 1335.11 3498.73 96.8671 KQK14071 474 232.466 20.571 3.27099 ==> SRR7814838.se.tsv <== BRADI_1g14170v3 3785 BRADI_1g53295v3 1245 BRADI_1g59795v3 319 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 1186 BRADI_1g74790v3 877 BRADI_1g09890v3 2 BRADI_1g77505v3 590 BRADI_1g48960v3 1 SRR7814838 completed mapping pipeline successfully