Starting /dee2/code/volunteer_pipeline.sh SRR7814840 current disk space = 1551039225856 free memory = 1604581300 SRR7814840 SRAfilesize 51234c1ba0f5ace6e2096f4aade7736c SRR7814840.sra SRR7814840.sra file validated SRR7814840 is paired end SRR7814840 is conventional basespace SRR7814840 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814840_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41525 37.0 37.0 37.0 37.0 37.0 2 36.396 37.0 37.0 37.0 37.0 37.0 3 36.512 37.0 37.0 37.0 37.0 37.0 4 36.5965 37.0 37.0 37.0 37.0 37.0 5 36.5505 37.0 37.0 37.0 37.0 37.0 6 36.4835 37.0 37.0 37.0 37.0 37.0 7 36.5 37.0 37.0 37.0 37.0 37.0 8 36.5825 37.0 37.0 37.0 37.0 37.0 9 36.512 37.0 37.0 37.0 37.0 37.0 10-14 36.6014 37.0 37.0 37.0 37.0 37.0 15-19 36.521699999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.512 37.0 37.0 37.0 37.0 37.0 25-29 36.4333 37.0 37.0 37.0 37.0 37.0 30-34 36.3115 37.0 37.0 37.0 37.0 37.0 35-39 36.2331 37.0 37.0 37.0 37.0 37.0 40-44 36.0723 37.0 37.0 37.0 37.0 37.0 45-49 36.14920000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.260000000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.049099999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.02720000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.9242 37.0 37.0 37.0 37.0 37.0 70-74 35.9488 37.0 37.0 37.0 37.0 37.0 75-79 36.0724 37.0 37.0 37.0 37.0 37.0 80-84 36.037600000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.0718 37.0 37.0 37.0 37.0 37.0 90-94 35.9313 37.0 37.0 37.0 37.0 37.0 95-99 35.68739999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.4481 37.0 37.0 37.0 37.0 37.0 105-109 35.567800000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.6265 37.0 37.0 37.0 37.0 37.0 115-119 35.528800000000004 37.0 37.0 37.0 37.0 37.0 120-124 34.8485 37.0 37.0 37.0 25.0 37.0 125-129 34.6511 37.0 37.0 37.0 25.0 37.0 130-134 35.155899999999995 37.0 37.0 37.0 27.4 37.0 135-139 34.98800000000001 37.0 37.0 37.0 25.0 37.0 140-144 35.0197 37.0 37.0 37.0 27.4 37.0 145-149 34.9504 37.0 37.0 37.0 25.0 37.0 150-151 34.136250000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 5.0 25 7.0 26 8.0 27 12.0 28 18.0 29 21.0 30 40.0 31 42.0 32 88.0 33 158.0 34 282.0 35 593.0 36 2560.0 37 164.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 50.26282853566959 10.112640801001252 5.607008760951189 34.01752190237797 2 25.15 13.700000000000001 30.675 30.475 3 21.775 17.45 24.9 35.875 4 28.199999999999996 23.525 21.3 26.974999999999998 5 28.349999999999998 28.9 21.65 21.099999999999998 6 23.549999999999997 31.05 22.925 22.475 7 18.575 24.3 37.775 19.35 8 20.7 23.7 28.299999999999997 27.3 9 21.525 19.925 31.275 27.275 10-14 23.905 25.935000000000002 24.474999999999998 25.685000000000002 15-19 24.22 24.240000000000002 25.4 26.14 20-24 24.095 24.779999999999998 24.985 26.14 25-29 23.415 24.605 25.035 26.945000000000004 30-34 24.240000000000002 24.43 24.34 26.99 35-39 23.74 23.805 25.715 26.740000000000002 40-44 23.97 24.060000000000002 25.305 26.665 45-49 24.62 24.19 24.845 26.345000000000002 50-54 24.48 23.7 24.195 27.625 55-59 24.34 23.84 24.9 26.919999999999998 60-64 24.745 23.335 24.84 27.08 65-69 23.98 24.07 24.585 27.365000000000002 70-74 25.295 24.23 23.794999999999998 26.68 75-79 25.89 23.775 23.395 26.939999999999998 80-84 25.96 23.705000000000002 24.145 26.19 85-89 25.285000000000004 23.195 24.255 27.265 90-94 25.900000000000002 23.935000000000002 23.625 26.540000000000003 95-99 25.64 23.54 24.47 26.35 100-104 25.715 23.895 23.515 26.875 105-109 25.665 23.47 23.849999999999998 27.015 110-114 26.39 23.735 23.189999999999998 26.685 115-119 26.07 23.43 23.935000000000002 26.565 120-124 25.740000000000002 24.02 23.51 26.729999999999997 125-129 26.11 23.595 23.080000000000002 27.215 130-134 26.229999999999997 23.76 23.27 26.740000000000002 135-139 26.185000000000002 23.494999999999997 23.3 27.02 140-144 27.005000000000003 23.565 22.58 26.85 145-149 26.57 23.3 23.14 26.99 150-151 26.3625 22.7375 23.5 27.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 2.0 26 2.0 27 2.0 28 5.0 29 6.5 30 7.5 31 8.5 32 16.5 33 24.5 34 30.0 35 37.0 36 50.5 37 63.0 38 70.5 39 85.5 40 102.0 41 106.0 42 118.5 43 145.5 44 153.0 45 145.5 46 149.0 47 146.5 48 146.0 49 144.5 50 136.5 51 130.0 52 123.5 53 116.5 54 122.0 55 140.0 56 139.0 57 124.5 58 118.0 59 116.0 60 111.0 61 92.5 62 71.0 63 75.0 64 73.0 65 74.5 66 85.0 67 75.5 68 50.0 69 39.5 70 35.0 71 28.5 72 28.0 73 24.0 74 24.5 75 22.5 76 15.0 77 8.5 78 8.0 79 8.0 80 5.5 81 4.5 82 2.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.175 #Duplication Level Percentage of deduplicated Percentage of total 1 87.96054540179867 75.8 2 9.863649550333625 17.0 3 1.7406440382941688 4.5 4 0.3191180736872643 1.0999999999999999 5 0.02901073397156948 0.125 6 0.02901073397156948 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05802146794313896 1.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTTCCTTATCTCGTAT 33 0.8250000000000001 TruSeq Adapter, Index 16 (97% over 39bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTTCCTTATCGCGTAT 20 0.5 TruSeq Adapter, Index 16 (97% over 39bp) GCCAGCTCCTATAGTGTGACGGGCGGTGTGTACAAGGCCCGGGAACGGAT 6 0.15 No Hit GCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.6625 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.825 0.0 0.0 0.0 0.0 114-115 3.2625 0.0 0.0 0.0 0.0 116-117 3.6125 0.0 0.0 0.0 0.0 118-119 3.9375 0.0 0.0 0.0 0.0 120-121 4.3375 0.0 0.0 0.0 0.0 122-123 4.8125 0.0 0.0 0.0 0.0 124-125 5.2875 0.0 0.0 0.0 0.0 126-127 5.6375 0.0 0.0 0.0 0.0 128-129 6.35 0.0 0.0 0.0 0.0 130-131 6.7875 0.0 0.0 0.0 0.0 132-133 7.2375 0.0 0.0 0.0 0.0 134-135 7.775 0.0 0.0 0.0 0.0 136-137 8.212499999999999 0.0 0.0 0.0 0.0 138-139 8.787500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTTGC 10 0.006830828 145.0 6 >>END_MODULE SRR7814840 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814840_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.069 37.0 37.0 37.0 37.0 37.0 2 35.886 37.0 37.0 37.0 37.0 37.0 3 35.8125 37.0 37.0 37.0 37.0 37.0 4 35.879 37.0 37.0 37.0 37.0 37.0 5 35.9195 37.0 37.0 37.0 37.0 37.0 6 35.6525 37.0 37.0 37.0 37.0 37.0 7 35.535 37.0 37.0 37.0 37.0 37.0 8 35.6145 37.0 37.0 37.0 37.0 37.0 9 35.885 37.0 37.0 37.0 37.0 37.0 10-14 35.6853 37.0 37.0 37.0 37.0 37.0 15-19 35.329899999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.4206 37.0 37.0 37.0 34.6 37.0 25-29 35.272 37.0 37.0 37.0 34.6 37.0 30-34 35.025600000000004 37.0 37.0 37.0 29.8 37.0 35-39 35.0406 37.0 37.0 37.0 32.2 37.0 40-44 34.703 37.0 37.0 37.0 25.0 37.0 45-49 34.826299999999996 37.0 37.0 37.0 25.0 37.0 50-54 34.1687 37.0 37.0 37.0 25.0 37.0 55-59 34.132200000000005 37.0 37.0 37.0 25.0 37.0 60-64 34.4633 37.0 37.0 37.0 25.0 37.0 65-69 34.4257 37.0 37.0 37.0 25.0 37.0 70-74 34.0053 37.0 37.0 37.0 25.0 37.0 75-79 33.8768 37.0 37.0 37.0 22.2 37.0 80-84 33.8701 37.0 37.0 37.0 25.0 37.0 85-89 34.194 37.0 37.0 37.0 25.0 37.0 90-94 33.882 37.0 37.0 37.0 25.0 37.0 95-99 33.097300000000004 37.0 37.0 37.0 11.0 37.0 100-104 33.4641 37.0 37.0 37.0 16.6 37.0 105-109 32.982000000000006 37.0 37.0 37.0 13.8 37.0 110-114 33.3908 37.0 37.0 37.0 19.4 37.0 115-119 33.5273 37.0 37.0 37.0 22.2 37.0 120-124 32.726 37.0 37.0 37.0 11.0 37.0 125-129 32.9631 37.0 37.0 37.0 16.6 37.0 130-134 32.4795 37.0 37.0 37.0 11.0 37.0 135-139 32.45 37.0 37.0 37.0 11.0 37.0 140-144 32.6078 37.0 37.0 37.0 11.0 37.0 145-149 32.21849999999999 37.0 32.2 37.0 11.0 37.0 150-151 31.655749999999998 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 3.0 16 6.0 17 6.0 18 10.0 19 6.0 20 9.0 21 8.0 22 20.0 23 36.0 24 52.0 25 61.0 26 90.0 27 81.0 28 91.0 29 102.0 30 108.0 31 150.0 32 154.0 33 189.0 34 325.0 35 718.0 36 1719.0 37 53.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.175 18.15 7.5 28.175 2 32.0 20.625 26.424999999999997 20.95 3 26.0 22.0 27.625 24.375 4 27.450000000000003 29.75 18.95 23.849999999999998 5 30.225 31.55 18.15 20.075000000000003 6 25.4 34.325 18.925 21.349999999999998 7 25.224999999999998 18.75 31.25 24.775 8 25.174999999999997 21.75 23.474999999999998 29.599999999999998 9 26.700000000000003 21.675 25.1 26.525 10-14 28.115000000000002 24.305 21.275 26.305 15-19 28.415000000000003 23.53 22.665 25.39 20-24 27.61 24.12 23.03 25.240000000000002 25-29 27.389999999999997 24.104999999999997 22.98 25.525 30-34 27.07 24.41 23.57 24.95 35-39 27.725 24.255 22.705000000000002 25.314999999999998 40-44 28.189999999999998 24.675 22.305 24.83 45-49 27.6 25.09 23.02 24.29 50-54 27.560000000000002 24.79 23.189999999999998 24.46 55-59 27.310000000000002 25.130000000000003 22.62 24.94 60-64 27.584999999999997 24.365000000000002 23.315 24.735 65-69 28.37 24.58 21.959999999999997 25.09 70-74 27.544999999999998 25.25 22.93 24.275 75-79 26.85 24.38 23.64 25.130000000000003 80-84 27.689999999999998 24.62 23.515 24.175 85-89 27.67 24.25 23.02 25.06 90-94 28.12 24.58 22.79 24.51 95-99 27.495000000000005 25.3 22.82 24.385 100-104 28.025 24.945 23.24 23.79 105-109 28.449999999999996 25.69 22.165000000000003 23.695 110-114 27.565 25.865 22.259999999999998 24.310000000000002 115-119 27.55 25.34 22.56 24.55 120-124 27.685 26.540000000000003 21.45 24.325 125-129 28.194999999999997 26.325 21.645 23.835 130-134 27.76 26.145000000000003 22.715 23.380000000000003 135-139 28.310000000000002 26.284999999999997 22.705000000000002 22.7 140-144 28.634999999999998 26.3 22.255 22.81 145-149 28.93 26.1 22.86 22.11 150-151 28.7375 26.3125 22.3125 22.6375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 1.0 24 0.5 25 2.0 26 3.5 27 5.5 28 6.0 29 6.0 30 9.0 31 13.0 32 18.0 33 20.5 34 24.5 35 26.0 36 35.0 37 46.5 38 52.0 39 77.5 40 87.0 41 90.0 42 130.0 43 130.5 44 122.0 45 131.0 46 132.0 47 137.0 48 140.5 49 151.0 50 139.0 51 131.0 52 121.0 53 124.5 54 144.5 55 150.5 56 138.5 57 122.5 58 127.0 59 131.0 60 114.5 61 86.0 62 77.0 63 78.0 64 70.5 65 64.0 66 68.5 67 75.0 68 67.0 69 54.5 70 48.0 71 42.0 72 33.5 73 28.5 74 27.0 75 24.0 76 21.5 77 12.0 78 8.5 79 9.0 80 6.0 81 7.5 82 7.5 83 3.5 84 1.5 85 2.0 86 3.0 87 2.5 88 0.5 89 1.0 90 2.5 91 1.5 92 1.0 93 4.0 94 4.5 95 3.0 96 1.5 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.875 #Duplication Level Percentage of deduplicated Percentage of total 1 88.93314366998577 78.14999999999999 2 8.961593172119487 15.75 3 1.5931721194879087 4.2 4 0.3982930298719772 1.4000000000000001 5 0.11379800853485066 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTCCTACCTGCCGCCTCTCACCGTGGAGTCCCTCTTGAAGCAGATCGA 5 0.125 No Hit GGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAA 5 0.125 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 5 0.125 No Hit GGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.2875 0.0 0.0 0.0 0.0 112-113 2.5875000000000004 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.5 0.0 0.0 0.0 0.0 120-121 3.8625 0.0 0.0 0.0 0.0 122-123 4.2875 0.0 0.0 0.0 0.0 124-125 4.6625 0.0 0.0 0.0 0.0 126-127 5.0 0.0 0.0 0.0 0.0 128-129 5.675000000000001 0.0 0.0 0.0 0.0 130-131 6.05 0.0 0.0 0.0 0.0 132-133 6.45 0.0 0.0 0.0 0.0 134-135 6.9 0.0 0.0 0.0 0.0 136-137 7.2875 0.0 0.0 0.0 0.0 138-139 7.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTACAT 10 0.006830828 145.0 1 AAATGTG 10 0.006830828 145.0 4 >>END_MODULE Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303280 spots for SRR7814840.sra Written 1303280 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra Read 1303270 spots for SRR7814840.sra Written 1303270 spots for SRR7814840.sra SRR ids: ['SRR7814840.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jwz3ku9_ SRR7814840.sra spots: 26065410 blocks: [[1, 1303270], [1303271, 2606540], [2606541, 3909810], [3909811, 5213080], [5213081, 6516350], [6516351, 7819620], [7819621, 9122890], [9122891, 10426160], [10426161, 11729430], [11729431, 13032700], [13032701, 14335970], [14335971, 15639240], [15639241, 16942510], [16942511, 18245780], [18245781, 19549050], [19549051, 20852320], [20852321, 22155590], [22155591, 23458860], [23458861, 24762130], [24762131, 26065410]] SRR7814840 file size 8811011 SRR7814840 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814840 SRR7814840_1.fastq SRR7814840_2.fastq Input file: SRR7814840_1.fastq Paired file: SRR7814840_2.fastq trimmed: SRR7814840-trimmed-pair1.fastq, SRR7814840-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:09:04 2024 >> started Fri Dec 6 12:09:32 2024 >> done (28.399s) 26065410 read pairs processed; of these: 172 ( 0.00%) short read pairs filtered out after trimming by size control 337781 ( 1.30%) empty read pairs filtered out after trimming by size control 25727457 (98.70%) read pairs available; of these: 3082772 (11.98%) trimmed read pairs available after processing 22644685 (88.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 12 0.00% 21 5 0.00% 22 11 0.00% 23 16 0.00% 24 23 0.00% 25 17 0.00% 26 21 0.00% 27 25 0.00% 28 36 0.00% 29 25 0.00% 30 40 0.00% 31 38 0.00% 32 47 0.00% 33 43 0.00% 34 32 0.00% 35 36 0.00% 36 39 0.00% 37 48 0.00% 38 44 0.00% 39 48 0.00% 40 56 0.00% 41 60 0.00% 42 82 0.00% 43 71 0.00% 44 63 0.00% 45 77 0.00% 46 94 0.00% 47 111 0.00% 48 152 0.00% 49 168 0.00% 50 167 0.00% 51 182 0.00% 52 209 0.00% 53 243 0.00% 54 269 0.00% 55 279 0.00% 56 297 0.00% 57 353 0.00% 58 382 0.00% 59 477 0.00% 60 592 0.00% 61 654 0.00% 62 723 0.00% 63 782 0.00% 64 807 0.00% 65 892 0.00% 66 1038 0.00% 67 1199 0.00% 68 1401 0.01% 69 1552 0.01% 70 1737 0.01% 71 2018 0.01% 72 2329 0.01% 73 2541 0.01% 74 2930 0.01% 75 3223 0.01% 76 3437 0.01% 77 3882 0.02% 78 4322 0.02% 79 4954 0.02% 80 5552 0.02% 81 6117 0.02% 82 6933 0.03% 83 7410 0.03% 84 8367 0.03% 85 9192 0.04% 86 9803 0.04% 87 10861 0.04% 88 11493 0.04% 89 12272 0.05% 90 13279 0.05% 91 14526 0.06% 92 16016 0.06% 93 17114 0.07% 94 18430 0.07% 95 19587 0.08% 96 20879 0.08% 97 22084 0.09% 98 22558 0.09% 99 23864 0.09% 100 24821 0.10% 101 26092 0.10% 102 27493 0.11% 103 28807 0.11% 104 30008 0.12% 105 30686 0.12% 106 32436 0.13% 107 33365 0.13% 108 34450 0.13% 109 36014 0.14% 110 36520 0.14% 111 38114 0.15% 112 39764 0.15% 113 40485 0.16% 114 42338 0.16% 115 44109 0.17% 116 44884 0.17% 117 45470 0.18% 118 45599 0.18% 119 47115 0.18% 120 49038 0.19% 121 49292 0.19% 122 50249 0.20% 123 52780 0.21% 124 54380 0.21% 125 55867 0.22% 126 57096 0.22% 127 57574 0.22% 128 57892 0.23% 129 59195 0.23% 130 59568 0.23% 131 60848 0.24% 132 61785 0.24% 133 63397 0.25% 134 65136 0.25% 135 66398 0.26% 136 67288 0.26% 137 67082 0.26% 138 67228 0.26% 139 69886 0.27% 140 69897 0.27% 141 70489 0.27% 142 73006 0.28% 143 73921 0.29% 144 76602 0.30% 145 77353 0.30% 146 77828 0.30% 147 79954 0.31% 148 79623 0.31% 149 80094 0.31% 150 81693 0.32% 151 22644685 88.02% 25727457 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=3.50 fanout-score-rank=8 prefix-density=0.87 prefix-fanout=3.3 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=23.68 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=1.4 sequence=GTTCGTTCGTTAGGATGCCTCAGCTGCATACATCACTGCACTTCCACTTGACACCTATTTAAACGGCTCGTCTCGCCGCTACCTTATCCTATTTCCATACTTCTGTCGCTCCATCCCCGTATGGGTGGAGAACCCGTCGCTGTCTCGGCTGTGATACCGGAGGCTCTAGGGAAGTCGGAGGAGAGAGCACTCATCTTGGGGTGGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCTCCGCACTTGGCTACCCAGCGTTTACCGTAGGCACGATAACTGGTACACCAGAGGTGCGTCCTTCCCGGTCCTCTCGTACTAGGGAAAGGTCCTCTCAATGCTCTAACGCCCACACCGGATATGGACCGAACTGTCTCACGA criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=12 prefix-density=0.97 prefix-fanout=2.4 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.16 sequence-density-rank=31 fanout-score=7.31 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=1.8 sequence=AAGAAGTTCGAAACCCTTTCCTACCTGCCGCCTCTCACCGTGGAGTCCCTCTTGAAGCAGATC SRR7814840 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:10:23 Started mapping on | Dec 06 12:10:23 Finished on | Dec 06 12:16:43 Mapping speed, Million of reads per hour | 243.73 Number of input reads | 25727457 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 20751088 Uniquely mapped reads % | 80.66% Average mapped length | 294.23 Number of splices: Total | 18528253 Number of splices: Annotated (sjdb) | 17491394 Number of splices: GT/AG | 18251683 Number of splices: GC/AG | 226283 Number of splices: AT/AC | 6140 Number of splices: Non-canonical | 44147 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1500766 % of reads mapped to multiple loci | 5.83% Number of reads mapped to too many loci | 222982 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.85% % of reads unmapped: other | 5.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3475603 3475603 3475603 N_multimapping 1500766 1500766 1500766 N_noFeature 1731308 20112282 1891013 N_ambiguous 599025 2495 121327 UnstrandedReadsAssigned:18420755 PositiveStrandReadsAssigned:636311 NegativeStrandReadsAssigned:18738748 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814840 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814840-trimmed-pair1.fastq SRR7814840-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,727,457 reads, 19,466,794 reads pseudoaligned [quant] estimated average fragment length: 252.031 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR7814840.ke.tsv 35125 SRR7814840.se.tsv 88098 total ==> SRR7814840.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 685.262 0.118155 0.0101807 PNS24247 1044 792.969 37.1675 2.7675 PNS24249 1928 1676.97 49.2463 1.73392 PNS24246 1044 792.969 37.1675 2.7675 PNS24248 1044 792.969 37.1675 2.7675 PNS24244 1471 1219.97 160.133 7.75019 PNS24243 293 96.5636 3 1.83438 KQK14069 1603 1351.97 5557.65 242.72 KQK14071 474 238.844 54.148 13.3859 ==> SRR7814840.se.tsv <== BRADI_1g14170v3 5684 BRADI_1g53295v3 1014 BRADI_1g59795v3 148 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 292 BRADI_1g74790v3 258 BRADI_1g09890v3 0 BRADI_1g77505v3 465 BRADI_1g48960v3 0 SRR7814840 completed mapping pipeline successfully