Starting /dee2/code/volunteer_pipeline.sh SRR7814841 current disk space = 1551397601280 free memory = 1595740684 SRR7814841 SRAfilesize d8951b7ecf32d5c336be5c25588e1dbb SRR7814841.sra SRR7814841.sra file validated SRR7814841 is paired end SRR7814841 is conventional basespace SRR7814841 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814841_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36425 37.0 37.0 37.0 37.0 37.0 2 36.371 37.0 37.0 37.0 37.0 37.0 3 36.43 37.0 37.0 37.0 37.0 37.0 4 36.423 37.0 37.0 37.0 37.0 37.0 5 36.4915 37.0 37.0 37.0 37.0 37.0 6 36.514 37.0 37.0 37.0 37.0 37.0 7 36.3925 37.0 37.0 37.0 37.0 37.0 8 36.453 37.0 37.0 37.0 37.0 37.0 9 36.4705 37.0 37.0 37.0 37.0 37.0 10-14 36.5005 37.0 37.0 37.0 37.0 37.0 15-19 36.534400000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.4371 37.0 37.0 37.0 37.0 37.0 25-29 36.3805 37.0 37.0 37.0 37.0 37.0 30-34 36.3605 37.0 37.0 37.0 37.0 37.0 35-39 36.325900000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.3731 37.0 37.0 37.0 37.0 37.0 45-49 36.3421 37.0 37.0 37.0 37.0 37.0 50-54 36.309900000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.264399999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.2733 37.0 37.0 37.0 37.0 37.0 65-69 36.2836 37.0 37.0 37.0 37.0 37.0 70-74 36.269000000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.2503 37.0 37.0 37.0 37.0 37.0 80-84 36.186099999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.2033 37.0 37.0 37.0 37.0 37.0 90-94 36.1378 37.0 37.0 37.0 37.0 37.0 95-99 36.146499999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1515 37.0 37.0 37.0 37.0 37.0 105-109 36.1449 37.0 37.0 37.0 37.0 37.0 110-114 36.0389 37.0 37.0 37.0 37.0 37.0 115-119 36.0078 37.0 37.0 37.0 37.0 37.0 120-124 35.943000000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.915200000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.8791 37.0 37.0 37.0 37.0 37.0 135-139 35.8951 37.0 37.0 37.0 37.0 37.0 140-144 35.8655 37.0 37.0 37.0 37.0 37.0 145-149 35.8615 37.0 37.0 37.0 37.0 37.0 150-151 35.282 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 4.0 24 2.0 25 2.0 26 8.0 27 2.0 28 11.0 29 21.0 30 35.0 31 54.0 32 48.0 33 78.0 34 156.0 35 335.0 36 2766.0 37 476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 53.799849510910455 11.888638073739653 5.944319036869826 28.36719337848006 2 27.05 13.425 30.049999999999997 29.475 3 22.45 18.675 24.224999999999998 34.65 4 26.5 25.25 21.8 26.450000000000003 5 26.875 30.775000000000002 22.400000000000002 19.950000000000003 6 24.099999999999998 30.325000000000003 22.325 23.25 7 19.7 22.900000000000002 37.925 19.475 8 21.55 24.3 27.175 26.974999999999998 9 20.025000000000002 21.2 32.074999999999996 26.700000000000003 10-14 23.72 25.97 24.525 25.785000000000004 15-19 24.36 25.06 24.685000000000002 25.895000000000003 20-24 24.205 25.635 24.05 26.11 25-29 24.22 25.445 23.46 26.875 30-34 24.33 24.855 24.29 26.525 35-39 23.815 24.875 24.52 26.790000000000003 40-44 24.725 24.2 24.349999999999998 26.724999999999998 45-49 24.735 24.785 23.62 26.86 50-54 24.349999999999998 25.009999999999998 23.65 26.99 55-59 23.89 25.185000000000002 24.26 26.665 60-64 24.805 24.13 24.075 26.99 65-69 24.665 24.725 23.735 26.875 70-74 24.59 25.22 23.630000000000003 26.56 75-79 25.624999999999996 23.735 23.895 26.745 80-84 24.834999999999997 24.775 23.74 26.650000000000002 85-89 25.465 23.805 24.03 26.700000000000003 90-94 25.39 23.830000000000002 24.154999999999998 26.625 95-99 25.064999999999998 24.27 23.68 26.985 100-104 26.26 23.535 23.5 26.705000000000002 105-109 25.465 23.555 23.919999999999998 27.060000000000002 110-114 25.6 23.465 24.05 26.884999999999998 115-119 25.945 23.830000000000002 23.595 26.63 120-124 26.16 24.315 22.81 26.715 125-129 25.674999999999997 23.244999999999997 23.87 27.21 130-134 25.91 23.825 23.565 26.700000000000003 135-139 26.56 24.555 22.96 25.924999999999997 140-144 26.035000000000004 23.93 22.895 27.139999999999997 145-149 25.915 23.794999999999998 23.485 26.805 150-151 25.887500000000003 23.849999999999998 23.2875 26.974999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 1.0 27 2.0 28 3.5 29 5.5 30 9.0 31 13.0 32 17.5 33 21.0 34 23.5 35 30.5 36 35.5 37 56.0 38 79.0 39 92.5 40 111.5 41 118.5 42 125.5 43 148.0 44 163.5 45 183.5 46 188.5 47 167.0 48 155.0 49 153.0 50 145.0 51 126.0 52 117.5 53 113.5 54 106.0 55 101.5 56 103.5 57 92.5 58 89.5 59 105.0 60 98.0 61 94.0 62 88.5 63 76.5 64 65.0 65 61.5 66 72.0 67 67.0 68 59.0 69 53.5 70 47.5 71 38.0 72 34.0 73 35.0 74 27.5 75 20.0 76 16.5 77 14.0 78 7.0 79 6.0 80 7.5 81 3.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.275 #Duplication Level Percentage of deduplicated Percentage of total 1 89.66676001120135 80.05 2 9.04508541024923 16.150000000000002 3 0.9801176141136937 2.625 4 0.2520302436292355 0.8999999999999999 5 0.02800336040324839 0.125 6 0.02800336040324839 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTGCTGGTGCAGGTGCTGGTGATGGTTCTGGTGGTGGTGGTGGTGATGG 6 0.15 No Hit GCCAAGCCAAGGGGGTCGAAGCTGCCGCCTGGGTAGAGTGGGTCAACAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0125 0.0 0.0 78-79 0.1 0.0 0.025 0.0 0.0 80-81 0.1 0.0 0.025 0.0 0.0 82-83 0.2 0.0 0.025 0.0 0.0 84-85 0.2625 0.0 0.025 0.0 0.0 86-87 0.2875 0.0 0.025 0.0 0.0 88-89 0.32499999999999996 0.0 0.025 0.0 0.0 90-91 0.425 0.0 0.025 0.0 0.0 92-93 0.6125 0.0 0.025 0.0 0.0 94-95 0.7875 0.0 0.025 0.0 0.0 96-97 0.9625 0.0 0.025 0.0 0.0 98-99 1.0499999999999998 0.0 0.025 0.0 0.0 100-101 1.1375 0.0 0.025 0.0 0.0 102-103 1.2375 0.0 0.025 0.0 0.0 104-105 1.45 0.0 0.025 0.0 0.0 106-107 1.7125 0.0 0.025 0.0 0.0 108-109 2.0625 0.0 0.025 0.0 0.0 110-111 2.2875 0.0 0.025 0.0 0.0 112-113 2.5625 0.0 0.025 0.0 0.0 114-115 2.85 0.0 0.025 0.0 0.0 116-117 3.2375 0.0 0.025 0.0 0.0 118-119 3.675 0.0 0.025 0.0 0.0 120-121 4.012499999999999 0.0 0.025 0.0 0.0 122-123 4.4375 0.0 0.025 0.0 0.0 124-125 4.9125 0.0 0.025 0.0 0.0 126-127 5.35 0.0 0.025 0.0 0.0 128-129 5.8125 0.0 0.025 0.0 0.0 130-131 6.3625 0.0 0.025 0.0 0.0 132-133 7.025 0.0 0.025 0.0 0.0 134-135 7.55 0.0 0.05 0.0 0.0 136-137 8.075 0.0 0.05 0.0 0.0 138-139 8.6875 0.0 0.05 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGTCA 10 0.006830828 145.0 5 CATATCC 10 0.006830828 145.0 5 >>END_MODULE SRR7814841 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814841_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.979 37.0 37.0 37.0 37.0 37.0 2 35.4465 37.0 37.0 37.0 37.0 37.0 3 35.594 37.0 37.0 37.0 37.0 37.0 4 35.6845 37.0 37.0 37.0 37.0 37.0 5 35.638 37.0 37.0 37.0 37.0 37.0 6 35.7025 37.0 37.0 37.0 37.0 37.0 7 35.685 37.0 37.0 37.0 37.0 37.0 8 35.6555 37.0 37.0 37.0 37.0 37.0 9 35.648 37.0 37.0 37.0 37.0 37.0 10-14 35.709500000000006 37.0 37.0 37.0 37.0 37.0 15-19 35.5189 37.0 37.0 37.0 37.0 37.0 20-24 35.5378 37.0 37.0 37.0 37.0 37.0 25-29 35.51350000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.5515 37.0 37.0 37.0 37.0 37.0 35-39 35.527499999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.507400000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.4037 37.0 37.0 37.0 37.0 37.0 50-54 35.3908 37.0 37.0 37.0 37.0 37.0 55-59 35.2878 37.0 37.0 37.0 37.0 37.0 60-64 35.2703 37.0 37.0 37.0 34.6 37.0 65-69 35.2548 37.0 37.0 37.0 37.0 37.0 70-74 35.2879 37.0 37.0 37.0 34.6 37.0 75-79 35.1648 37.0 37.0 37.0 29.8 37.0 80-84 35.109700000000004 37.0 37.0 37.0 27.4 37.0 85-89 35.0411 37.0 37.0 37.0 27.4 37.0 90-94 34.9843 37.0 37.0 37.0 27.4 37.0 95-99 34.9938 37.0 37.0 37.0 25.0 37.0 100-104 34.940099999999994 37.0 37.0 37.0 25.0 37.0 105-109 34.9653 37.0 37.0 37.0 25.0 37.0 110-114 34.839200000000005 37.0 37.0 37.0 25.0 37.0 115-119 34.6608 37.0 37.0 37.0 25.0 37.0 120-124 34.763799999999996 37.0 37.0 37.0 25.0 37.0 125-129 34.64919999999999 37.0 37.0 37.0 25.0 37.0 130-134 34.534800000000004 37.0 37.0 37.0 25.0 37.0 135-139 34.3231 37.0 37.0 37.0 25.0 37.0 140-144 34.0595 37.0 37.0 37.0 25.0 37.0 145-149 34.2004 37.0 37.0 37.0 25.0 37.0 150-151 33.42425 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 7.0 14 12.0 15 11.0 16 9.0 17 7.0 18 2.0 19 9.0 20 5.0 21 7.0 22 14.0 23 17.0 24 10.0 25 14.0 26 19.0 27 13.0 28 36.0 29 37.0 30 42.0 31 84.0 32 93.0 33 192.0 34 303.0 35 716.0 36 2210.0 37 128.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.425000000000004 20.1 6.425 25.05 2 31.25 21.625 24.75 22.375 3 27.375 22.55 26.325 23.75 4 27.975 29.925 18.475 23.625 5 31.175000000000004 31.974999999999998 16.3 20.549999999999997 6 25.900000000000002 33.074999999999996 18.65 22.375 7 25.124999999999996 19.125 31.674999999999997 24.075 8 24.3 22.825 22.400000000000002 30.475 9 25.900000000000002 21.9 24.8 27.400000000000002 10-14 27.315 24.3 21.705 26.68 15-19 28.144999999999996 24.395 21.529999999999998 25.929999999999996 20-24 27.485 23.87 22.71 25.935000000000002 25-29 26.810000000000002 24.5 22.34 26.35 30-34 27.38 24.625 21.77 26.224999999999998 35-39 26.875 24.245 22.56 26.32 40-44 28.225 23.505000000000003 22.935 25.335 45-49 27.87 24.385 22.365 25.380000000000003 50-54 26.765 24.305 22.689999999999998 26.240000000000002 55-59 27.134999999999998 24.385 23.145 25.335 60-64 27.315 24.055 22.86 25.77 65-69 27.87 23.755000000000003 22.34 26.035000000000004 70-74 27.634999999999998 23.53 22.81 26.025 75-79 27.395000000000003 23.715 22.73 26.16 80-84 27.400000000000002 23.895 22.765 25.94 85-89 27.500000000000004 23.635 23.044999999999998 25.82 90-94 27.365000000000002 23.555 22.900000000000002 26.179999999999996 95-99 27.625 24.36 22.455 25.56 100-104 27.400000000000002 24.15 22.985 25.465 105-109 27.74 23.53 23.14 25.590000000000003 110-114 27.935 23.735 22.905 25.424999999999997 115-119 27.685 24.09 22.08 26.145000000000003 120-124 27.195000000000004 24.465 22.46 25.88 125-129 28.405 24.115000000000002 22.67 24.81 130-134 28.075 24.59 22.645 24.69 135-139 28.465 24.610000000000003 22.665 24.26 140-144 28.74 24.16 22.81 24.29 145-149 28.93 23.95 23.325000000000003 23.794999999999998 150-151 29.7375 23.6625 22.8625 23.7375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 1.5 5 1.0 6 0.5 7 0.5 8 0.0 9 0.0 10 1.0 11 2.5 12 2.5 13 1.0 14 1.0 15 3.0 16 3.0 17 1.0 18 0.0 19 0.0 20 2.0 21 3.0 22 1.5 23 2.0 24 1.5 25 0.0 26 1.5 27 2.0 28 2.0 29 4.0 30 6.5 31 9.5 32 13.0 33 12.5 34 10.5 35 17.5 36 29.0 37 39.0 38 57.5 39 69.0 40 85.0 41 108.0 42 110.0 43 117.0 44 129.0 45 154.5 46 159.5 47 144.0 48 139.5 49 129.5 50 131.5 51 128.0 52 115.0 53 101.0 54 107.5 55 118.0 56 98.5 57 95.0 58 115.5 59 118.5 60 113.0 61 115.0 62 99.0 63 94.5 64 98.5 65 89.0 66 90.0 67 89.0 68 77.5 69 62.5 70 51.5 71 47.5 72 53.0 73 49.0 74 33.5 75 27.5 76 24.5 77 17.5 78 10.5 79 7.0 80 4.0 81 1.5 82 2.5 83 1.5 84 0.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.5 90 1.0 91 1.0 92 1.5 93 2.0 94 1.5 95 2.5 96 2.0 97 2.0 98 2.5 99 0.5 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.5 #Duplication Level Percentage of deduplicated Percentage of total 1 90.55865921787709 81.05 2 8.016759776536313 14.35 3 0.9776536312849162 2.625 4 0.36312849162011174 1.3 5 0.055865921787709494 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027932960893854747 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit GAGAAACCCTCCTCCCCTCACCGATCCCCTCTCCAATCTCCATGGCGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.6000000000000001 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.425 0.0 0.0 0.0 0.0 106-107 1.6749999999999998 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.225 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.775 0.0 0.0 0.0 0.0 116-117 3.1625 0.0 0.0 0.0 0.0 118-119 3.6 0.0 0.0 0.0 0.0 120-121 3.9375 0.0 0.0 0.0 0.0 122-123 4.362500000000001 0.0 0.0 0.0 0.0 124-125 4.85 0.0 0.0 0.0 0.0 126-127 5.2625 0.0 0.0 0.0 0.0 128-129 5.75 0.0 0.0 0.0 0.0 130-131 6.325 0.0 0.0 0.0 0.0 132-133 6.9875 0.0 0.0 0.0 0.0 134-135 7.525 0.0 0.0 0.0 0.0 136-137 8.025 0.0 0.0 0.0 0.0 138-139 8.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATCCA 10 0.006830828 145.0 1 >>END_MODULE Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2636008 spots for SRR7814841.sra Written 2636008 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra Read 2635991 spots for SRR7814841.sra Written 2635991 spots for SRR7814841.sra SRR ids: ['SRR7814841.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__xfx6hqi SRR7814841.sra spots: 52719837 blocks: [[1, 2635991], [2635992, 5271982], [5271983, 7907973], [7907974, 10543964], [10543965, 13179955], [13179956, 15815946], [15815947, 18451937], [18451938, 21087928], [21087929, 23723919], [23723920, 26359910], [26359911, 28995901], [28995902, 31631892], [31631893, 34267883], [34267884, 36903874], [36903875, 39539865], [39539866, 42175856], [42175857, 44811847], [44811848, 47447838], [47447839, 50083829], [50083830, 52719837]] SRR7814841 file size 17843322 SRR7814841 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814841 SRR7814841_1.fastq SRR7814841_2.fastq Input file: SRR7814841_1.fastq Paired file: SRR7814841_2.fastq trimmed: SRR7814841-trimmed-pair1.fastq, SRR7814841-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:19:17 2024 >> started Fri Dec 6 12:20:21 2024 >> done (63.865s) 52719837 read pairs processed; of these: 247 ( 0.00%) short read pairs filtered out after trimming by size control 36145 ( 0.07%) empty read pairs filtered out after trimming by size control 52683445 (99.93%) read pairs available; of these: 6554267 (12.44%) trimmed read pairs available after processing 46129178 (87.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 12 0.00% 20 24 0.00% 21 19 0.00% 22 18 0.00% 23 29 0.00% 24 44 0.00% 25 36 0.00% 26 53 0.00% 27 62 0.00% 28 73 0.00% 29 62 0.00% 30 65 0.00% 31 68 0.00% 32 59 0.00% 33 73 0.00% 34 71 0.00% 35 81 0.00% 36 97 0.00% 37 80 0.00% 38 113 0.00% 39 103 0.00% 40 106 0.00% 41 126 0.00% 42 152 0.00% 43 132 0.00% 44 138 0.00% 45 146 0.00% 46 189 0.00% 47 190 0.00% 48 205 0.00% 49 249 0.00% 50 304 0.00% 51 329 0.00% 52 350 0.00% 53 378 0.00% 54 437 0.00% 55 461 0.00% 56 497 0.00% 57 594 0.00% 58 705 0.00% 59 740 0.00% 60 902 0.00% 61 1063 0.00% 62 1213 0.00% 63 1371 0.00% 64 1374 0.00% 65 1410 0.00% 66 1624 0.00% 67 1859 0.00% 68 2070 0.00% 69 2358 0.00% 70 2873 0.01% 71 3041 0.01% 72 3810 0.01% 73 4269 0.01% 74 4652 0.01% 75 5071 0.01% 76 5523 0.01% 77 6211 0.01% 78 6981 0.01% 79 7978 0.02% 80 8804 0.02% 81 10075 0.02% 82 11442 0.02% 83 12968 0.02% 84 14194 0.03% 85 15599 0.03% 86 16864 0.03% 87 18078 0.03% 88 19430 0.04% 89 21407 0.04% 90 23468 0.04% 91 25768 0.05% 92 28077 0.05% 93 30989 0.06% 94 33484 0.06% 95 35823 0.07% 96 38176 0.07% 97 40294 0.08% 98 42140 0.08% 99 44210 0.08% 100 47109 0.09% 101 50158 0.10% 102 53152 0.10% 103 56357 0.11% 104 59977 0.11% 105 61712 0.12% 106 65359 0.12% 107 66992 0.13% 108 68718 0.13% 109 72125 0.14% 110 75023 0.14% 111 78031 0.15% 112 81777 0.16% 113 84726 0.16% 114 88644 0.17% 115 93244 0.18% 116 94662 0.18% 117 97967 0.19% 118 97957 0.19% 119 99648 0.19% 120 102725 0.19% 121 106044 0.20% 122 107546 0.20% 123 113263 0.21% 124 118148 0.22% 125 120395 0.23% 126 124241 0.24% 127 125165 0.24% 128 126348 0.24% 129 129676 0.25% 130 130528 0.25% 131 132242 0.25% 132 137397 0.26% 133 141665 0.27% 134 144683 0.27% 135 148776 0.28% 136 150312 0.29% 137 151590 0.29% 138 153704 0.29% 139 156286 0.30% 140 155157 0.29% 141 159084 0.30% 142 162344 0.31% 143 163927 0.31% 144 171006 0.32% 145 173480 0.33% 146 176033 0.33% 147 178481 0.34% 148 178032 0.34% 149 177150 0.34% 150 180876 0.34% 151 46129178 87.56% 52683445 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=3.44 fanout-score-rank=15 prefix-density=0.81 prefix-fanout=3.2 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=91.39 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=5.6 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAG criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=4.02 fanout-score-rank=13 prefix-density=0.79 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=14.34 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.3 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR7814841 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:23:25 Started mapping on | Dec 06 12:23:25 Finished on | Dec 06 12:29:13 Mapping speed, Million of reads per hour | 545.00 Number of input reads | 52683445 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 47440300 Uniquely mapped reads % | 90.05% Average mapped length | 294.31 Number of splices: Total | 41164460 Number of splices: Annotated (sjdb) | 38791218 Number of splices: GT/AG | 40579702 Number of splices: GC/AG | 461652 Number of splices: AT/AC | 13315 Number of splices: Non-canonical | 109791 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.03% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1326406 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 134782 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.38% % of reads unmapped: other | 1.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3916739 3916739 3916739 N_multimapping 1326406 1326406 1326406 N_noFeature 1981497 45908501 2406011 N_ambiguous 1382911 5634 277293 UnstrandedReadsAssigned:44075892 PositiveStrandReadsAssigned:1526165 NegativeStrandReadsAssigned:44756996 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814841 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814841-trimmed-pair1.fastq SRR7814841-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 52,683,445 reads, 45,951,069 reads pseudoaligned [quant] estimated average fragment length: 250.78 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR7814841.ke.tsv 35125 SRR7814841.se.tsv 88098 total ==> SRR7814841.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 686.611 0 0 PNS24247 1044 794.22 120.436 4.03391 PNS24249 1928 1678.22 315.727 5.00464 PNS24246 1044 794.22 120.436 4.03391 PNS24248 1044 794.22 120.436 4.03391 PNS24244 1471 1221.22 488.965 10.6511 PNS24243 293 100.545 2 0.529149 KQK14069 1603 1353.22 52016.4 1022.54 KQK14071 474 243.935 1152.4 125.672 ==> SRR7814841.se.tsv <== BRADI_1g14170v3 56619 BRADI_1g53295v3 5012 BRADI_1g59795v3 441 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 1074 BRADI_1g74790v3 1250 BRADI_1g09890v3 4 BRADI_1g77505v3 700 BRADI_1g48960v3 1 SRR7814841 completed mapping pipeline successfully