Starting /dee2/code/volunteer_pipeline.sh SRR7814842 current disk space = 1551450652672 free memory = 1595749488 SRR7814842 SRAfilesize 405a51ff0713a34229c3882e66f0e75e SRR7814842.sra SRR7814842.sra file validated SRR7814842 is paired end SRR7814842 is conventional basespace SRR7814842 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814842_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.166 37.0 37.0 37.0 37.0 37.0 2 36.30075 37.0 37.0 37.0 37.0 37.0 3 36.3785 37.0 37.0 37.0 37.0 37.0 4 36.532 37.0 37.0 37.0 37.0 37.0 5 36.5195 37.0 37.0 37.0 37.0 37.0 6 36.5325 37.0 37.0 37.0 37.0 37.0 7 36.445 37.0 37.0 37.0 37.0 37.0 8 36.5965 37.0 37.0 37.0 37.0 37.0 9 36.525 37.0 37.0 37.0 37.0 37.0 10-14 36.5264 37.0 37.0 37.0 37.0 37.0 15-19 36.5165 37.0 37.0 37.0 37.0 37.0 20-24 36.5103 37.0 37.0 37.0 37.0 37.0 25-29 36.449600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.411500000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4375 37.0 37.0 37.0 37.0 37.0 40-44 36.359100000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.3331 37.0 37.0 37.0 37.0 37.0 50-54 36.3264 37.0 37.0 37.0 37.0 37.0 55-59 36.297 37.0 37.0 37.0 37.0 37.0 60-64 36.2919 37.0 37.0 37.0 37.0 37.0 65-69 36.19799999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.161500000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.084799999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.1256 37.0 37.0 37.0 37.0 37.0 85-89 36.0858 37.0 37.0 37.0 37.0 37.0 90-94 35.9165 37.0 37.0 37.0 37.0 37.0 95-99 35.88680000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.907599999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.922700000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.875099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.702799999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.599599999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.6235 37.0 37.0 37.0 37.0 37.0 130-134 35.4482 37.0 37.0 37.0 37.0 37.0 135-139 35.3858 37.0 37.0 37.0 34.6 37.0 140-144 35.3053 37.0 37.0 37.0 32.2 37.0 145-149 35.0878 37.0 37.0 37.0 27.4 37.0 150-151 34.263999999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 4.0 25 5.0 26 12.0 27 11.0 28 15.0 29 23.0 30 33.0 31 51.0 32 55.0 33 116.0 34 195.0 35 411.0 36 2779.0 37 287.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 50.15060240963856 10.542168674698797 5.647590361445784 33.65963855421687 2 26.581645411352838 13.053263315828959 32.78319579894974 27.581895473868467 3 22.1 17.875 22.475 37.55 4 29.475 23.849999999999998 19.725 26.950000000000003 5 28.549999999999997 29.825000000000003 21.2 20.424999999999997 6 23.775 31.4 20.9 23.925 7 19.575 23.925 36.725 19.775000000000002 8 21.125 21.525 28.375 28.975 9 21.025 21.175 31.6 26.200000000000003 10-14 25.19 24.98 23.655 26.174999999999997 15-19 25.185000000000002 24.035 24.55 26.229999999999997 20-24 24.535 24.755 24.515 26.195 25-29 24.779999999999998 24.175 24.095 26.950000000000003 30-34 25.025 23.849999999999998 24.52 26.605 35-39 24.985 24.25 24.224999999999998 26.540000000000003 40-44 24.975 24.075 24.64 26.31 45-49 24.725 24.465 24.13 26.68 50-54 25.019999999999996 24.175 24.0 26.805 55-59 25.335 24.2 23.685000000000002 26.779999999999998 60-64 24.92 23.89 24.16 27.029999999999998 65-69 25.35 23.830000000000002 23.965 26.855 70-74 25.46 23.549999999999997 23.935000000000002 27.055 75-79 25.09 24.315 24.075 26.52 80-84 25.31 24.365000000000002 24.12 26.205000000000002 85-89 25.445 24.295 23.625 26.634999999999998 90-94 25.83 24.39 23.46 26.32 95-99 25.395 23.625 24.055 26.924999999999997 100-104 25.415 23.925 23.87 26.790000000000003 105-109 25.979999999999997 23.54 23.599999999999998 26.88 110-114 25.915 23.995 23.369999999999997 26.72 115-119 25.75 23.94 23.465 26.845000000000002 120-124 25.71 23.974999999999998 23.3 27.015 125-129 25.490000000000002 24.8 22.91 26.8 130-134 25.46 23.87 23.44 27.229999999999997 135-139 26.5 23.69 23.080000000000002 26.729999999999997 140-144 25.775 23.935000000000002 22.905 27.384999999999998 145-149 25.635 24.02 23.51 26.834999999999997 150-151 26.087500000000002 23.799999999999997 23.3 26.8125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 3.0 28 4.5 29 5.5 30 6.0 31 9.0 32 15.5 33 20.0 34 20.0 35 24.5 36 36.5 37 50.0 38 75.0 39 99.5 40 110.0 41 116.0 42 136.5 43 147.5 44 157.5 45 172.5 46 171.5 47 174.0 48 160.5 49 149.0 50 136.5 51 130.0 52 119.0 53 97.5 54 99.5 55 97.0 56 97.0 57 107.0 58 104.0 59 88.5 60 85.0 61 77.5 62 67.5 63 80.0 64 76.5 65 65.0 66 68.0 67 73.5 68 73.0 69 62.5 70 55.5 71 50.5 72 48.0 73 41.5 74 31.5 75 27.0 76 22.0 77 18.5 78 14.5 79 9.5 80 6.0 81 2.0 82 0.5 83 1.5 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.41404612159329 91.025 2 4.40251572327044 8.4 3 0.1310272536687631 0.375 4 0.052410901467505246 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.025 5 0.0 0.0 0.0 0.0 0.025 6 0.0 0.0 0.0 0.0 0.025 7 0.0 0.0 0.0 0.0 0.025 8 0.0 0.0 0.0 0.0 0.025 9 0.0 0.0 0.0 0.0 0.025 10-11 0.0 0.0 0.0 0.0 0.025 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0125 0.0 0.0 0.0 0.025 66-67 0.025 0.0 0.0 0.0 0.025 68-69 0.0625 0.0 0.0 0.0 0.025 70-71 0.075 0.0 0.0 0.0 0.025 72-73 0.1125 0.0 0.0 0.0 0.025 74-75 0.15 0.0 0.0 0.0 0.025 76-77 0.2125 0.0 0.0 0.0 0.025 78-79 0.2625 0.0 0.0 0.0 0.025 80-81 0.2875 0.0 0.0 0.0 0.025 82-83 0.32499999999999996 0.0 0.0 0.0 0.025 84-85 0.48750000000000004 0.0 0.0 0.0 0.025 86-87 0.6375 0.0 0.0 0.0 0.025 88-89 0.7 0.0 0.0 0.0 0.025 90-91 0.8375 0.0 0.0 0.0 0.025 92-93 1.0875 0.0 0.0 0.0 0.025 94-95 1.3375 0.0 0.0 0.0 0.025 96-97 1.5875 0.0 0.0 0.0 0.025 98-99 2.0125 0.0 0.0 0.0 0.025 100-101 2.4375 0.0 0.0 0.0 0.025 102-103 2.825 0.0 0.0 0.0 0.025 104-105 3.225 0.0 0.0 0.0 0.025 106-107 3.7125 0.0 0.0 0.0 0.025 108-109 4.237500000000001 0.0 0.0 0.0 0.025 110-111 4.625 0.0 0.0 0.0 0.025 112-113 5.175 0.0 0.0 0.0 0.025 114-115 5.675000000000001 0.0 0.0 0.0 0.025 116-117 6.262499999999999 0.0 0.0 0.0 0.025 118-119 6.9125 0.0 0.0 0.0 0.025 120-121 7.4625 0.0 0.0 0.0 0.025 122-123 8.0875 0.0 0.0 0.0 0.025 124-125 8.587499999999999 0.0 0.0 0.0 0.025 126-127 9.274999999999999 0.0 0.0 0.0 0.025 128-129 9.8625 0.0 0.0 0.0 0.025 130-131 10.600000000000001 0.0 0.0 0.0 0.025 132-133 11.350000000000001 0.0 0.0 0.0 0.025 134-135 12.2125 0.0 0.0 0.0 0.025 136-137 12.975 0.0 0.0 0.0 0.025 138-139 13.85 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814842 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814842_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3665 37.0 37.0 37.0 37.0 37.0 2 36.1385 37.0 37.0 37.0 37.0 37.0 3 36.205 37.0 37.0 37.0 37.0 37.0 4 36.2615 37.0 37.0 37.0 37.0 37.0 5 36.3775 37.0 37.0 37.0 37.0 37.0 6 36.224 37.0 37.0 37.0 37.0 37.0 7 36.1765 37.0 37.0 37.0 37.0 37.0 8 36.2415 37.0 37.0 37.0 37.0 37.0 9 36.2815 37.0 37.0 37.0 37.0 37.0 10-14 36.2342 37.0 37.0 37.0 37.0 37.0 15-19 36.2266 37.0 37.0 37.0 37.0 37.0 20-24 36.1894 37.0 37.0 37.0 37.0 37.0 25-29 36.1522 37.0 37.0 37.0 37.0 37.0 30-34 36.1329 37.0 37.0 37.0 37.0 37.0 35-39 36.04780000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.032799999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.022000000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.9882 37.0 37.0 37.0 37.0 37.0 55-59 35.9868 37.0 37.0 37.0 37.0 37.0 60-64 35.8626 37.0 37.0 37.0 37.0 37.0 65-69 35.831900000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.7687 37.0 37.0 37.0 37.0 37.0 75-79 35.75840000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.648700000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.606899999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.4938 37.0 37.0 37.0 37.0 37.0 95-99 35.4638 37.0 37.0 37.0 37.0 37.0 100-104 35.4332 37.0 37.0 37.0 37.0 37.0 105-109 35.3917 37.0 37.0 37.0 37.0 37.0 110-114 35.1106 37.0 37.0 37.0 27.4 37.0 115-119 35.0511 37.0 37.0 37.0 25.0 37.0 120-124 34.9932 37.0 37.0 37.0 25.0 37.0 125-129 34.9102 37.0 37.0 37.0 25.0 37.0 130-134 34.763 37.0 37.0 37.0 25.0 37.0 135-139 34.424699999999994 37.0 37.0 37.0 25.0 37.0 140-144 34.1727 37.0 37.0 37.0 25.0 37.0 145-149 34.0428 37.0 37.0 37.0 25.0 37.0 150-151 33.3895 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 2.0 15 2.0 16 5.0 17 2.0 18 2.0 19 2.0 20 5.0 21 4.0 22 6.0 23 4.0 24 10.0 25 12.0 26 10.0 27 11.0 28 15.0 29 28.0 30 35.0 31 60.0 32 83.0 33 157.0 34 303.0 35 788.0 36 2327.0 37 126.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.324999999999996 17.675 7.9 30.099999999999998 2 30.725 22.075 25.374999999999996 21.825 3 24.224999999999998 24.575 24.925 26.275 4 27.85 29.5 19.325 23.325000000000003 5 28.975 32.475 17.175 21.375 6 24.05 35.075 16.55 24.325 7 24.0 19.2 33.475 23.325000000000003 8 25.15 20.575 22.575 31.7 9 24.8 21.775 25.650000000000002 27.775 10-14 26.810000000000002 25.045 21.87 26.275 15-19 27.125 23.599999999999998 23.244999999999997 26.029999999999998 20-24 26.57 24.845 22.825 25.759999999999998 25-29 26.765 24.755 22.509999999999998 25.97 30-34 26.779999999999998 24.425 23.025000000000002 25.77 35-39 26.25 24.625 23.18 25.945 40-44 26.85 24.255 22.64 26.255 45-49 26.955000000000002 24.16 22.67 26.215 50-54 26.450000000000003 24.395 22.869999999999997 26.284999999999997 55-59 27.185 23.645 22.515 26.655 60-64 26.634999999999998 23.465 23.150000000000002 26.75 65-69 26.119999999999997 24.055 23.39 26.435 70-74 27.245 23.905 22.555 26.295 75-79 26.905 23.575 23.3 26.22 80-84 27.185 23.5 23.18 26.135 85-89 27.165 23.724999999999998 22.755 26.355 90-94 27.435 23.98 22.98 25.605 95-99 27.389999999999997 23.965 23.095 25.55 100-104 27.644999999999996 24.104999999999997 23.085 25.165 105-109 27.42 24.37 22.720000000000002 25.490000000000002 110-114 28.02 24.455 22.62 24.905 115-119 29.09 23.985 22.03 24.895 120-124 29.34 24.285 21.935 24.44 125-129 28.4 24.175 22.455 24.97 130-134 28.955 24.195 22.38 24.47 135-139 29.104999999999997 24.215 22.555 24.125 140-144 30.580000000000002 24.154999999999998 22.355 22.91 145-149 31.580000000000002 23.599999999999998 22.314999999999998 22.505 150-151 31.924999999999997 23.5 21.4125 23.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.0 24 1.5 25 2.0 26 1.5 27 2.5 28 3.0 29 5.0 30 7.0 31 8.0 32 9.0 33 13.0 34 18.0 35 24.0 36 31.0 37 37.5 38 56.5 39 78.0 40 106.0 41 113.0 42 108.0 43 124.5 44 144.0 45 153.0 46 156.0 47 159.5 48 158.0 49 156.0 50 133.0 51 139.0 52 126.5 53 93.5 54 106.5 55 104.0 56 102.0 57 104.5 58 96.0 59 96.0 60 90.0 61 90.0 62 93.0 63 81.0 64 84.5 65 97.0 66 93.5 67 80.5 68 68.5 69 66.0 70 61.5 71 56.5 72 59.0 73 48.0 74 32.0 75 26.0 76 20.0 77 15.0 78 12.0 79 8.0 80 6.5 81 6.0 82 4.0 83 1.5 84 1.5 85 1.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 1.0 94 0.5 95 1.0 96 1.0 97 0.0 98 0.5 99 2.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.475 #Duplication Level Percentage of deduplicated Percentage of total 1 95.0251389256417 89.775 2 4.577930669489283 8.649999999999999 3 0.21169621593014024 0.6 4 0.05292405398253506 0.2 5 0.10584810796507012 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02646202699126753 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit CCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCC 5 0.125 No Hit GCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTT 5 0.125 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.8125 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.3624999999999998 0.0 0.0 0.0 0.0 96-97 1.6375 0.0 0.0 0.0 0.0 98-99 2.0375 0.0 0.0 0.0 0.0 100-101 2.4375 0.0 0.0 0.0 0.0 102-103 2.825 0.0 0.0 0.0 0.0 104-105 3.225 0.0 0.0 0.0 0.0 106-107 3.6875 0.0 0.0 0.0 0.0 108-109 4.2375 0.0 0.0 0.0 0.0 110-111 4.637499999999999 0.0 0.0 0.0 0.0 112-113 5.175 0.0 0.0 0.0 0.0 114-115 5.675000000000001 0.0 0.0 0.0 0.0 116-117 6.2875 0.0 0.0 0.0 0.0 118-119 6.9625 0.0 0.0 0.0 0.0 120-121 7.512499999999999 0.0 0.0 0.0 0.0 122-123 8.1 0.0 0.0 0.0 0.0 124-125 8.6125 0.0 0.0 0.0 0.0 126-127 9.325 0.0 0.0 0.0 0.0 128-129 9.95 0.0 0.0 0.0 0.0 130-131 10.675 0.0 0.0 0.0 0.0 132-133 11.3875 0.0 0.0 0.0 0.0 134-135 12.2125 0.0 0.0 0.0 0.0 136-137 12.975000000000001 0.0 0.0 0.0 0.0 138-139 13.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAATGA 10 0.006830828 145.0 6 GCCTCAC 10 0.006830828 145.0 9 GCCAGCC 10 0.006830828 145.0 5 CAGAGCC 10 0.006830828 145.0 1 AGAGCCA 10 0.006830828 145.0 2 AAAACTA 10 0.006830828 145.0 2 AAAAACT 10 0.006830828 145.0 1 >>END_MODULE Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239591 spots for SRR7814842.sra Written 2239591 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra Read 2239581 spots for SRR7814842.sra Written 2239581 spots for SRR7814842.sra SRR ids: ['SRR7814842.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9t7_zjr8 SRR7814842.sra spots: 44791630 blocks: [[1, 2239581], [2239582, 4479162], [4479163, 6718743], [6718744, 8958324], [8958325, 11197905], [11197906, 13437486], [13437487, 15677067], [15677068, 17916648], [17916649, 20156229], [20156230, 22395810], [22395811, 24635391], [24635392, 26874972], [26874973, 29114553], [29114554, 31354134], [31354135, 33593715], [33593716, 35833296], [35833297, 38072877], [38072878, 40312458], [40312459, 42552039], [42552040, 44791630]] SRR7814842 file size 15156713 SRR7814842 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814842 SRR7814842_1.fastq SRR7814842_2.fastq Input file: SRR7814842_1.fastq Paired file: SRR7814842_2.fastq trimmed: SRR7814842-trimmed-pair1.fastq, SRR7814842-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:15:42 2024 >> started Fri Dec 6 12:16:43 2024 >> done (61.278s) 44791630 read pairs processed; of these: 393 ( 0.00%) short read pairs filtered out after trimming by size control 17912 ( 0.04%) empty read pairs filtered out after trimming by size control 44773325 (99.96%) read pairs available; of these: 8666834 (19.36%) trimmed read pairs available after processing 36106491 (80.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 28 0.00% 19 27 0.00% 20 23 0.00% 21 35 0.00% 22 46 0.00% 23 51 0.00% 24 61 0.00% 25 44 0.00% 26 63 0.00% 27 61 0.00% 28 86 0.00% 29 84 0.00% 30 80 0.00% 31 100 0.00% 32 96 0.00% 33 85 0.00% 34 81 0.00% 35 130 0.00% 36 114 0.00% 37 127 0.00% 38 153 0.00% 39 180 0.00% 40 177 0.00% 41 177 0.00% 42 208 0.00% 43 221 0.00% 44 199 0.00% 45 244 0.00% 46 256 0.00% 47 304 0.00% 48 392 0.00% 49 471 0.00% 50 470 0.00% 51 535 0.00% 52 627 0.00% 53 607 0.00% 54 621 0.00% 55 700 0.00% 56 802 0.00% 57 953 0.00% 58 1178 0.00% 59 1239 0.00% 60 1499 0.00% 61 1698 0.00% 62 1916 0.00% 63 2147 0.00% 64 2232 0.00% 65 2443 0.01% 66 2929 0.01% 67 3183 0.01% 68 3667 0.01% 69 4095 0.01% 70 4848 0.01% 71 5537 0.01% 72 6200 0.01% 73 7065 0.02% 74 7876 0.02% 75 8924 0.02% 76 9647 0.02% 77 10739 0.02% 78 12033 0.03% 79 13856 0.03% 80 15243 0.03% 81 17010 0.04% 82 19056 0.04% 83 21154 0.05% 84 23893 0.05% 85 25742 0.06% 86 27737 0.06% 87 30248 0.07% 88 33270 0.07% 89 35735 0.08% 90 39139 0.09% 91 42283 0.09% 92 45966 0.10% 93 49536 0.11% 94 53529 0.12% 95 56749 0.13% 96 60450 0.14% 97 64051 0.14% 98 67157 0.15% 99 71340 0.16% 100 75725 0.17% 101 79509 0.18% 102 83545 0.19% 103 87874 0.20% 104 91281 0.20% 105 94227 0.21% 106 98900 0.22% 107 101208 0.23% 108 105102 0.23% 109 108580 0.24% 110 112029 0.25% 111 115438 0.26% 112 120818 0.27% 113 123853 0.28% 114 127601 0.28% 115 132100 0.30% 116 133644 0.30% 117 137932 0.31% 118 138677 0.31% 119 141329 0.32% 120 144443 0.32% 121 147843 0.33% 122 150194 0.34% 123 154515 0.35% 124 157074 0.35% 125 160476 0.36% 126 163137 0.36% 127 165010 0.37% 128 165506 0.37% 129 168676 0.38% 130 169784 0.38% 131 171214 0.38% 132 175596 0.39% 133 178269 0.40% 134 179047 0.40% 135 181599 0.41% 136 183306 0.41% 137 182768 0.41% 138 183797 0.41% 139 187399 0.42% 140 187607 0.42% 141 189753 0.42% 142 193699 0.43% 143 192905 0.43% 144 197414 0.44% 145 199530 0.45% 146 200371 0.45% 147 202292 0.45% 148 200551 0.45% 149 199583 0.45% 150 200146 0.45% 151 36106491 80.64% 44773325 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=18 prefix-density=0.74 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=14.99 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.8 sequence=AATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTTGAGCTGACCCACTTGCGCA criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=19 prefix-density=0.48 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=79.23 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=6.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7814842 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:17:35 Started mapping on | Dec 06 12:17:35 Finished on | Dec 06 12:22:40 Mapping speed, Million of reads per hour | 528.47 Number of input reads | 44773325 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 41987551 Uniquely mapped reads % | 93.78% Average mapped length | 290.17 Number of splices: Total | 40522523 Number of splices: Annotated (sjdb) | 38180655 Number of splices: GT/AG | 39936635 Number of splices: GC/AG | 483524 Number of splices: AT/AC | 13772 Number of splices: Non-canonical | 88592 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.02% Deletion average length | 3.04 Insertion rate per base | 0.02% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 792370 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 63404 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.52% % of reads unmapped: other | 0.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1993404 1993404 1993404 N_multimapping 792370 792370 792370 N_noFeature 1457407 40636787 1928749 N_ambiguous 1063248 5376 185253 UnstrandedReadsAssigned:39466896 PositiveStrandReadsAssigned:1345388 NegativeStrandReadsAssigned:39873549 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814842 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814842-trimmed-pair1.fastq SRR7814842-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,773,325 reads, 40,415,308 reads pseudoaligned [quant] estimated average fragment length: 236.603 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,453 rounds 52973 SRR7814842.ke.tsv 35125 SRR7814842.se.tsv 88098 total ==> SRR7814842.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 700.824 0 0 PNS24247 1044 808.397 95.8374 4.01967 PNS24249 1928 1692.4 286.99 5.74969 PNS24246 1044 808.397 95.8374 4.01967 PNS24248 1044 808.397 95.8374 4.01967 PNS24244 1471 1235.4 66.4979 1.82508 PNS24243 293 109.565 2 0.618927 KQK14069 1603 1367.4 4403.19 109.183 KQK14071 474 256.077 246.007 32.5729 ==> SRR7814842.se.tsv <== BRADI_1g14170v3 5550 BRADI_1g53295v3 1583 BRADI_1g59795v3 206 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 1136 BRADI_1g74790v3 488 BRADI_1g09890v3 4 BRADI_1g77505v3 684 BRADI_1g48960v3 0 SRR7814842 completed mapping pipeline successfully