Starting /dee2/code/volunteer_pipeline.sh SRR7814843 current disk space = 1551422189568 free memory = 1602059480 SRR7814843 SRAfilesize 6afc99a1bdaba15c077c790374665cf1 SRR7814843.sra SRR7814843.sra file validated SRR7814843 is paired end SRR7814843 is conventional basespace SRR7814843 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814843_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.38125 37.0 37.0 37.0 37.0 37.0 2 36.1075 37.0 37.0 37.0 37.0 37.0 3 36.3675 37.0 37.0 37.0 37.0 37.0 4 36.426 37.0 37.0 37.0 37.0 37.0 5 36.5215 37.0 37.0 37.0 37.0 37.0 6 36.544 37.0 37.0 37.0 37.0 37.0 7 36.375 37.0 37.0 37.0 37.0 37.0 8 36.5005 37.0 37.0 37.0 37.0 37.0 9 36.441 37.0 37.0 37.0 37.0 37.0 10-14 36.454 37.0 37.0 37.0 37.0 37.0 15-19 36.499300000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.4587 37.0 37.0 37.0 37.0 37.0 25-29 36.389700000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.3339 37.0 37.0 37.0 37.0 37.0 35-39 36.3262 37.0 37.0 37.0 37.0 37.0 40-44 36.31269999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.2633 37.0 37.0 37.0 37.0 37.0 50-54 36.2596 37.0 37.0 37.0 37.0 37.0 55-59 36.185700000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.15990000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.1385 37.0 37.0 37.0 37.0 37.0 70-74 36.1021 37.0 37.0 37.0 37.0 37.0 75-79 36.0423 37.0 37.0 37.0 37.0 37.0 80-84 36.0449 37.0 37.0 37.0 37.0 37.0 85-89 36.026900000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.943200000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.866400000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.7899 37.0 37.0 37.0 37.0 37.0 105-109 35.8444 37.0 37.0 37.0 37.0 37.0 110-114 35.8112 37.0 37.0 37.0 37.0 37.0 115-119 35.6968 37.0 37.0 37.0 37.0 37.0 120-124 35.5756 37.0 37.0 37.0 37.0 37.0 125-129 35.528499999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.408100000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.326 37.0 37.0 37.0 34.6 37.0 140-144 35.188300000000005 37.0 37.0 37.0 32.2 37.0 145-149 34.8101 37.0 37.0 37.0 25.0 37.0 150-151 34.15075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 6.0 26 9.0 27 15.0 28 14.0 29 25.0 30 56.0 31 58.0 32 89.0 33 115.0 34 178.0 35 435.0 36 2703.0 37 294.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 53.04587615943846 11.13060917523189 3.685134118826774 32.13838054650288 2 24.512256128064035 12.88144072036018 35.26763381690846 27.33866933466733 3 21.675 18.575 24.125 35.625 4 29.475 24.725 19.275000000000002 26.525 5 28.000000000000004 29.299999999999997 22.825 19.875 6 21.425 30.7 24.325 23.549999999999997 7 18.9 21.675 39.15 20.275000000000002 8 19.75 22.225 30.2 27.825 9 21.475 19.875 32.45 26.200000000000003 10-14 24.990000000000002 25.679999999999996 24.044999999999998 25.285000000000004 15-19 24.64 24.595 24.705 26.06 20-24 24.779999999999998 24.44 24.72 26.06 25-29 24.279999999999998 24.755 24.705 26.26 30-34 24.7 24.66 24.465 26.174999999999997 35-39 24.6 23.79 24.965 26.645000000000003 40-44 24.825 23.825 25.135 26.215 45-49 25.15 23.97 24.404999999999998 26.474999999999998 50-54 24.0 24.635 24.98 26.384999999999998 55-59 24.01 24.62 24.67 26.700000000000003 60-64 25.540000000000003 23.505000000000003 24.47 26.484999999999996 65-69 25.005 23.86 24.490000000000002 26.645000000000003 70-74 24.959999999999997 24.695 24.295 26.05 75-79 25.314999999999998 23.24 24.58 26.865 80-84 24.845 23.415 24.69 27.05 85-89 25.474999999999998 24.285 23.794999999999998 26.445 90-94 25.395 23.84 24.33 26.435 95-99 25.619999999999997 23.674999999999997 24.145 26.56 100-104 25.009999999999998 24.305 24.535 26.150000000000002 105-109 25.395 24.245 24.485 25.874999999999996 110-114 24.92 23.98 24.47 26.63 115-119 25.105 24.555 23.745 26.595000000000002 120-124 25.045 24.375 23.555 27.025 125-129 24.98 24.38 23.630000000000003 27.01 130-134 25.485000000000003 24.46 23.41 26.645000000000003 135-139 25.765 24.740000000000002 22.93 26.565 140-144 25.185000000000002 24.51 23.57 26.735 145-149 25.27 24.83 23.150000000000002 26.75 150-151 26.1125 24.8125 22.7125 26.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.0 27 1.0 28 2.5 29 3.0 30 3.5 31 9.5 32 16.0 33 19.5 34 21.0 35 24.0 36 36.0 37 55.0 38 74.0 39 85.5 40 110.0 41 142.0 42 146.0 43 141.5 44 150.5 45 175.5 46 192.0 47 189.5 48 187.0 49 164.5 50 148.0 51 141.5 52 124.0 53 110.0 54 99.5 55 93.5 56 89.0 57 90.0 58 90.0 59 84.5 60 81.0 61 78.5 62 70.5 63 63.5 64 68.0 65 69.0 66 68.5 67 72.5 68 63.5 69 54.0 70 50.5 71 45.0 72 36.0 73 40.0 74 38.0 75 24.5 76 16.5 77 9.5 78 11.5 79 9.0 80 2.5 81 1.5 82 1.5 83 0.5 84 1.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.9300237655136 89.875 2 4.5946659625033 8.7 3 0.39609189331925004 1.125 4 0.07921837866385001 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.23750000000000002 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.5874999999999999 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.9625 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.7625000000000002 0.0 0.0 0.0 0.0 102-103 2.075 0.0 0.0 0.0 0.0 104-105 2.4375 0.0 0.0 0.0 0.0 106-107 2.8625 0.0 0.0 0.0 0.0 108-109 3.375 0.0 0.0 0.0 0.0 110-111 3.8375 0.0 0.0 0.0 0.0 112-113 4.2125 0.0 0.0 0.0 0.0 114-115 4.6125 0.0 0.0 0.0 0.0 116-117 5.0375 0.0 0.0 0.0 0.0 118-119 5.525 0.0 0.0 0.0 0.0 120-121 6.125 0.0 0.0 0.0 0.0 122-123 6.6875 0.0 0.0 0.0 0.0 124-125 7.1 0.0 0.0 0.0 0.0 126-127 7.5625 0.0 0.0 0.0 0.0 128-129 8.05 0.0 0.0 0.0 0.0 130-131 8.875 0.0 0.0 0.0 0.0 132-133 9.575 0.0 0.0 0.0 0.0 134-135 10.2875 0.0 0.0 0.0 0.0 136-137 10.9125 0.0 0.0 0.0 0.0 138-139 11.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814843 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814843_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2885 37.0 37.0 37.0 37.0 37.0 2 35.9395 37.0 37.0 37.0 37.0 37.0 3 35.9845 37.0 37.0 37.0 37.0 37.0 4 36.0635 37.0 37.0 37.0 37.0 37.0 5 36.151 37.0 37.0 37.0 37.0 37.0 6 35.998 37.0 37.0 37.0 37.0 37.0 7 36.098 37.0 37.0 37.0 37.0 37.0 8 36.253 37.0 37.0 37.0 37.0 37.0 9 36.246 37.0 37.0 37.0 37.0 37.0 10-14 36.1351 37.0 37.0 37.0 37.0 37.0 15-19 36.0564 37.0 37.0 37.0 37.0 37.0 20-24 36.0355 37.0 37.0 37.0 37.0 37.0 25-29 36.0219 37.0 37.0 37.0 37.0 37.0 30-34 35.9722 37.0 37.0 37.0 37.0 37.0 35-39 35.9123 37.0 37.0 37.0 37.0 37.0 40-44 35.886900000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.8251 37.0 37.0 37.0 37.0 37.0 50-54 35.8171 37.0 37.0 37.0 37.0 37.0 55-59 35.747899999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.668600000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.6605 37.0 37.0 37.0 37.0 37.0 70-74 35.642399999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.603500000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.529999999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.4752 37.0 37.0 37.0 37.0 37.0 90-94 35.4322 37.0 37.0 37.0 37.0 37.0 95-99 35.3186 37.0 37.0 37.0 34.6 37.0 100-104 35.2807 37.0 37.0 37.0 34.6 37.0 105-109 35.2516 37.0 37.0 37.0 34.6 37.0 110-114 35.053999999999995 37.0 37.0 37.0 25.0 37.0 115-119 35.0261 37.0 37.0 37.0 25.0 37.0 120-124 34.8404 37.0 37.0 37.0 25.0 37.0 125-129 34.8042 37.0 37.0 37.0 25.0 37.0 130-134 34.734500000000004 37.0 37.0 37.0 25.0 37.0 135-139 34.382099999999994 37.0 37.0 37.0 25.0 37.0 140-144 34.2478 37.0 37.0 37.0 25.0 37.0 145-149 34.2376 37.0 37.0 37.0 25.0 37.0 150-151 33.504 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 2.0 15 2.0 16 3.0 17 2.0 18 2.0 19 2.0 20 2.0 21 8.0 22 9.0 23 7.0 24 15.0 25 8.0 26 9.0 27 18.0 28 23.0 29 36.0 30 46.0 31 58.0 32 91.0 33 140.0 34 289.0 35 786.0 36 2314.0 37 121.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.35 20.175 6.6000000000000005 27.875 2 30.5 23.65 25.75 20.1 3 23.974999999999998 24.875 27.825 23.325000000000003 4 27.6 32.05 18.675 21.675 5 26.650000000000002 33.875 19.275000000000002 20.200000000000003 6 22.85 35.199999999999996 19.475 22.475 7 23.400000000000002 18.825 34.2 23.575 8 23.549999999999997 23.25 23.05 30.15 9 24.675 21.25 26.525 27.55 10-14 26.275 25.729999999999997 22.29 25.705 15-19 27.075 24.86 23.43 24.635 20-24 26.31 24.86 23.44 25.39 25-29 26.135 25.019999999999996 23.25 25.595000000000002 30-34 26.384999999999998 25.025 23.3 25.290000000000003 35-39 26.484999999999996 24.615000000000002 23.405 25.495 40-44 26.455000000000002 25.03 23.235 25.28 45-49 26.825 25.069999999999997 22.675 25.430000000000003 50-54 26.135 24.585 23.345 25.935000000000002 55-59 27.134999999999998 24.195 23.265 25.405 60-64 26.985 24.275 22.82 25.919999999999998 65-69 26.724999999999998 25.025 22.88 25.369999999999997 70-74 26.66 24.195 23.275000000000002 25.869999999999997 75-79 26.825 23.5 23.98 25.695 80-84 27.189999999999998 24.29 23.265 25.255 85-89 26.805 24.5 22.58 26.115 90-94 27.125 24.37 23.06 25.445 95-99 26.995 24.565 23.145 25.295 100-104 27.084999999999997 25.06 22.56 25.295 105-109 27.72 24.92 22.900000000000002 24.46 110-114 28.025 24.525 22.965 24.485 115-119 28.03 24.3 23.005 24.665 120-124 27.939999999999998 24.825 22.68 24.555 125-129 28.18 25.525 22.2 24.095 130-134 28.34 24.945 22.905 23.810000000000002 135-139 29.005 24.4 22.82 23.775 140-144 28.360000000000003 25.545 22.31 23.785 145-149 28.08 25.290000000000003 22.71 23.919999999999998 150-151 30.6375 24.1125 22.0625 23.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 1.0 12 1.0 13 1.0 14 0.5 15 0.5 16 1.5 17 1.5 18 1.0 19 1.0 20 0.5 21 0.0 22 1.0 23 1.5 24 0.5 25 0.5 26 0.5 27 2.5 28 6.5 29 5.0 30 5.0 31 11.0 32 11.0 33 17.0 34 25.5 35 24.5 36 30.0 37 44.5 38 63.0 39 85.0 40 102.0 41 116.0 42 128.5 43 142.5 44 159.5 45 168.0 46 164.5 47 168.5 48 167.5 49 147.5 50 144.0 51 138.0 52 115.5 53 104.0 54 102.5 55 93.0 56 82.0 57 86.5 58 93.0 59 97.5 60 96.5 61 97.0 62 105.0 63 91.0 64 76.5 65 73.5 66 74.5 67 73.0 68 65.5 69 65.0 70 56.0 71 53.0 72 47.5 73 33.5 74 29.0 75 26.5 76 19.5 77 10.5 78 9.0 79 6.5 80 3.0 81 2.0 82 0.5 83 1.0 84 1.0 85 0.5 86 1.5 87 1.0 88 0.0 89 0.0 90 0.5 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 2.5 99 2.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 94.91886139930833 89.2 2 4.2298483639265765 7.95 3 0.5852620377760043 1.6500000000000001 4 0.13301409949454643 0.5 5 0.10641127959563715 0.5 6 0.0 0.0 7 0.0 0.0 8 0.026602819898909287 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 5 0.125 No Hit CAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.23750000000000002 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.5874999999999999 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.025 94-95 0.975 0.0 0.0 0.0 0.025 96-97 1.175 0.0 0.0 0.0 0.025 98-99 1.4375 0.0 0.0 0.0 0.025 100-101 1.7374999999999998 0.0 0.0 0.0 0.025 102-103 2.05 0.0 0.0 0.0 0.025 104-105 2.4124999999999996 0.0 0.0 0.0 0.025 106-107 2.825 0.0 0.0 0.0 0.025 108-109 3.325 0.0 0.0 0.0 0.025 110-111 3.7750000000000004 0.0 0.0 0.0 0.025 112-113 4.15 0.0 0.0 0.0 0.025 114-115 4.5625 0.0 0.0 0.0 0.025 116-117 5.0 0.0 0.0 0.0 0.025 118-119 5.475 0.0 0.0 0.0 0.025 120-121 6.0625 0.0 0.0 0.0 0.025 122-123 6.625 0.0 0.0 0.0 0.025 124-125 7.0 0.0 0.0 0.0 0.025 126-127 7.487500000000001 0.0 0.0 0.0 0.025 128-129 7.9625 0.0 0.0 0.0 0.025 130-131 8.775 0.0 0.0 0.0 0.025 132-133 9.45 0.0 0.0 0.0 0.025 134-135 10.1375 0.0 0.0 0.0 0.025 136-137 10.725 0.0 0.0 0.0 0.025 138-139 11.3625 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCAA 10 0.006830828 145.0 6 GGCATCC 10 0.006830828 145.0 2 TCACCGT 10 0.006830828 145.0 6 GCATCCT 10 0.006830828 145.0 3 CCCCCCC 35 0.0035366106 20.714287 60-64 >>END_MODULE Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454149 spots for SRR7814843.sra Written 1454149 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra Read 1454148 spots for SRR7814843.sra Written 1454148 spots for SRR7814843.sra SRR ids: ['SRR7814843.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_phzzljc9 SRR7814843.sra spots: 29082961 blocks: [[1, 1454148], [1454149, 2908296], [2908297, 4362444], [4362445, 5816592], [5816593, 7270740], [7270741, 8724888], [8724889, 10179036], [10179037, 11633184], [11633185, 13087332], [13087333, 14541480], [14541481, 15995628], [15995629, 17449776], [17449777, 18903924], [18903925, 20358072], [20358073, 21812220], [21812221, 23266368], [23266369, 24720516], [24720517, 26174664], [26174665, 27628812], [27628813, 29082961]] SRR7814843 file size 9833560 SRR7814843 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814843 SRR7814843_1.fastq SRR7814843_2.fastq Input file: SRR7814843_1.fastq Paired file: SRR7814843_2.fastq trimmed: SRR7814843-trimmed-pair1.fastq, SRR7814843-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:14:38 2024 >> started Fri Dec 6 12:15:39 2024 >> done (61.183s) 29082961 read pairs processed; of these: 307 ( 0.00%) short read pairs filtered out after trimming by size control 11219 ( 0.04%) empty read pairs filtered out after trimming by size control 29071435 (99.96%) read pairs available; of these: 4403769 (15.15%) trimmed read pairs available after processing 24667666 (84.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 19 0.00% 20 25 0.00% 21 26 0.00% 22 32 0.00% 23 36 0.00% 24 22 0.00% 25 28 0.00% 26 39 0.00% 27 35 0.00% 28 36 0.00% 29 51 0.00% 30 60 0.00% 31 56 0.00% 32 64 0.00% 33 69 0.00% 34 57 0.00% 35 91 0.00% 36 84 0.00% 37 75 0.00% 38 100 0.00% 39 101 0.00% 40 119 0.00% 41 123 0.00% 42 146 0.00% 43 125 0.00% 44 117 0.00% 45 134 0.00% 46 139 0.00% 47 156 0.00% 48 192 0.00% 49 249 0.00% 50 245 0.00% 51 265 0.00% 52 310 0.00% 53 322 0.00% 54 302 0.00% 55 362 0.00% 56 401 0.00% 57 479 0.00% 58 519 0.00% 59 611 0.00% 60 701 0.00% 61 802 0.00% 62 920 0.00% 63 1053 0.00% 64 1089 0.00% 65 1194 0.00% 66 1306 0.00% 67 1458 0.01% 68 1720 0.01% 69 1924 0.01% 70 2259 0.01% 71 2471 0.01% 72 3059 0.01% 73 3420 0.01% 74 3700 0.01% 75 4231 0.01% 76 4575 0.02% 77 5154 0.02% 78 5766 0.02% 79 6440 0.02% 80 7106 0.02% 81 7853 0.03% 82 9125 0.03% 83 9995 0.03% 84 11342 0.04% 85 12125 0.04% 86 13126 0.05% 87 14255 0.05% 88 15629 0.05% 89 16918 0.06% 90 18250 0.06% 91 20091 0.07% 92 21713 0.07% 93 23306 0.08% 94 25118 0.09% 95 26945 0.09% 96 29291 0.10% 97 30863 0.11% 98 31638 0.11% 99 34263 0.12% 100 36002 0.12% 101 37454 0.13% 102 39759 0.14% 103 41752 0.14% 104 43361 0.15% 105 45078 0.16% 106 47763 0.16% 107 48849 0.17% 108 50970 0.18% 109 53072 0.18% 110 54389 0.19% 111 56047 0.19% 112 58202 0.20% 113 59975 0.21% 114 62361 0.21% 115 64678 0.22% 116 65805 0.23% 117 68192 0.23% 118 69196 0.24% 119 70561 0.24% 120 71870 0.25% 121 73588 0.25% 122 74567 0.26% 123 76997 0.26% 124 79245 0.27% 125 80486 0.28% 126 81725 0.28% 127 83883 0.29% 128 84962 0.29% 129 86308 0.30% 130 87406 0.30% 131 88021 0.30% 132 90065 0.31% 133 91572 0.31% 134 92508 0.32% 135 95014 0.33% 136 95404 0.33% 137 95980 0.33% 138 97709 0.34% 139 99650 0.34% 140 99480 0.34% 141 100641 0.35% 142 102879 0.35% 143 103024 0.35% 144 104901 0.36% 145 105717 0.36% 146 107125 0.37% 147 110045 0.38% 148 110156 0.38% 149 110111 0.38% 150 110625 0.38% 151 24667666 84.85% 29071435 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=21 prefix-density=0.83 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=21.46 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.4 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.44 fanout-score-rank=15 prefix-density=0.52 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=72.42 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.1 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7814843 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:17:06 Started mapping on | Dec 06 12:17:07 Finished on | Dec 06 12:21:03 Mapping speed, Million of reads per hour | 443.46 Number of input reads | 29071435 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 27420777 Uniquely mapped reads % | 94.32% Average mapped length | 292.67 Number of splices: Total | 27790371 Number of splices: Annotated (sjdb) | 26180505 Number of splices: GT/AG | 27382578 Number of splices: GC/AG | 337229 Number of splices: AT/AC | 9889 Number of splices: Non-canonical | 60675 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.02% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 337596 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 16354 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.20% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1313062 1313062 1313062 N_multimapping 337596 337596 337596 N_noFeature 912982 26514965 1211647 N_ambiguous 720970 4020 114507 UnstrandedReadsAssigned:25786825 PositiveStrandReadsAssigned:901792 NegativeStrandReadsAssigned:26094623 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814843 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814843-trimmed-pair1.fastq SRR7814843-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,071,435 reads, 26,361,939 reads pseudoaligned [quant] estimated average fragment length: 253.856 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52973 SRR7814843.ke.tsv 35125 SRR7814843.se.tsv 88098 total ==> SRR7814843.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.704 0 0 PNS24247 1044 791.144 57.9962 3.87408 PNS24249 1928 1675.14 122.233 3.85621 PNS24246 1044 791.144 57.9962 3.87408 PNS24248 1044 791.144 57.9962 3.87408 PNS24244 1471 1218.14 91.7786 3.98169 PNS24243 293 103.255 0 0 KQK14069 1603 1350.14 4227.62 165.478 KQK14071 474 242.543 201.864 43.9841 ==> SRR7814843.se.tsv <== BRADI_1g14170v3 5729 BRADI_1g53295v3 1233 BRADI_1g59795v3 207 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 841 BRADI_1g74790v3 231 BRADI_1g09890v3 0 BRADI_1g77505v3 393 BRADI_1g48960v3 0 SRR7814843 completed mapping pipeline successfully