Starting /dee2/code/volunteer_pipeline.sh SRR7814844 current disk space = 1551413080064 free memory = 1601448972 SRR7814844 SRAfilesize 607258fe940a9a538a174d72d75eb356 SRR7814844.sra SRR7814844.sra file validated SRR7814844 is paired end SRR7814844 is conventional basespace SRR7814844 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814844_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.23675 37.0 37.0 37.0 37.0 37.0 2 36.2035 37.0 37.0 37.0 37.0 37.0 3 36.4265 37.0 37.0 37.0 37.0 37.0 4 36.5295 37.0 37.0 37.0 37.0 37.0 5 36.524 37.0 37.0 37.0 37.0 37.0 6 36.504 37.0 37.0 37.0 37.0 37.0 7 36.441 37.0 37.0 37.0 37.0 37.0 8 36.4455 37.0 37.0 37.0 37.0 37.0 9 36.439 37.0 37.0 37.0 37.0 37.0 10-14 36.47959999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4991 37.0 37.0 37.0 37.0 37.0 20-24 36.4651 37.0 37.0 37.0 37.0 37.0 25-29 36.414500000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.379200000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.3637 37.0 37.0 37.0 37.0 37.0 40-44 36.333800000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.310900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.218599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.1999 37.0 37.0 37.0 37.0 37.0 60-64 36.1848 37.0 37.0 37.0 37.0 37.0 65-69 36.1849 37.0 37.0 37.0 37.0 37.0 70-74 36.083299999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.150800000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.0544 37.0 37.0 37.0 37.0 37.0 85-89 36.0389 37.0 37.0 37.0 37.0 37.0 90-94 35.941900000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.9031 37.0 37.0 37.0 37.0 37.0 100-104 35.8434 37.0 37.0 37.0 37.0 37.0 105-109 35.930899999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.794799999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.7013 37.0 37.0 37.0 37.0 37.0 120-124 35.6857 37.0 37.0 37.0 37.0 37.0 125-129 35.684799999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.5212 37.0 37.0 37.0 37.0 37.0 135-139 35.394099999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.3483 37.0 37.0 37.0 37.0 37.0 145-149 35.0712 37.0 37.0 37.0 25.0 37.0 150-151 34.349 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 3.0 25 5.0 26 6.0 27 14.0 28 15.0 29 29.0 30 41.0 31 49.0 32 86.0 33 109.0 34 168.0 35 393.0 36 2818.0 37 261.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.242545727887745 11.550989726885492 5.311951891756452 30.894512653470308 2 25.18759379689845 14.132066033016507 30.71535767883942 29.964982491245625 3 20.875 19.425 24.5 35.199999999999996 4 25.874999999999996 26.75 20.599999999999998 26.775 5 25.15 30.975 21.825 22.05 6 21.925 32.7 22.225 23.150000000000002 7 16.950000000000003 22.625 40.6 19.825 8 20.674999999999997 22.35 29.049999999999997 27.925 9 20.849999999999998 21.099999999999998 31.974999999999998 26.075 10-14 23.200000000000003 26.465 25.124999999999996 25.21 15-19 23.599999999999998 25.27 25.19 25.94 20-24 23.07 25.47 25.505 25.955000000000002 25-29 23.474999999999998 25.55 24.495 26.479999999999997 30-34 23.285 25.924999999999997 24.935 25.855 35-39 23.474999999999998 25.230000000000004 24.995 26.3 40-44 23.48 25.564999999999998 25.009999999999998 25.945 45-49 23.75 25.53 24.58 26.14 50-54 23.07 25.36 25.44 26.13 55-59 23.880000000000003 25.095 24.86 26.165 60-64 23.23 25.480000000000004 24.57 26.72 65-69 23.965 24.915000000000003 24.529999999999998 26.590000000000003 70-74 23.865 25.415 24.404999999999998 26.314999999999998 75-79 23.86 24.435000000000002 24.67 27.034999999999997 80-84 23.974999999999998 24.93 24.505 26.590000000000003 85-89 24.265 25.53 24.025 26.179999999999996 90-94 24.07 25.06 24.66 26.21 95-99 23.955000000000002 25.230000000000004 24.3 26.515 100-104 24.73 24.560000000000002 24.715 25.995 105-109 24.485 24.875 24.435000000000002 26.205000000000002 110-114 24.845 24.8 24.099999999999998 26.255 115-119 24.445 25.145 23.47 26.939999999999998 120-124 24.85 25.2 23.73 26.22 125-129 24.245 25.25 24.33 26.174999999999997 130-134 24.715 24.745 24.265 26.275 135-139 24.65 25.52 23.575 26.255 140-144 24.66 24.685000000000002 24.26 26.395000000000003 145-149 24.985 25.3 23.22 26.495 150-151 24.775 25.412499999999998 22.912499999999998 26.900000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 2.5 28 3.0 29 2.5 30 6.5 31 10.0 32 14.5 33 21.5 34 26.5 35 33.5 36 43.5 37 56.5 38 78.0 39 95.0 40 116.0 41 131.0 42 139.5 43 167.0 44 182.0 45 189.5 46 192.0 47 186.0 48 175.5 49 171.0 50 172.0 51 154.5 52 142.5 53 149.5 54 143.0 55 120.0 56 98.0 57 77.5 58 73.0 59 73.5 60 77.0 61 75.0 62 58.5 63 59.5 64 63.0 65 52.5 66 50.5 67 46.0 68 38.0 69 35.0 70 37.0 71 38.5 72 30.0 73 21.5 74 17.0 75 14.5 76 11.5 77 8.5 78 5.0 79 2.5 80 2.5 81 1.5 82 0.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.3 #Duplication Level Percentage of deduplicated Percentage of total 1 95.3305351521511 90.85 2 4.4071353620146905 8.4 3 0.26232948583420773 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.4500000000000002 0.0 0.0 0.0 0.0 106-107 1.7 0.0 0.0 0.0 0.0 108-109 1.95 0.0 0.0 0.0 0.0 110-111 2.2750000000000004 0.0 0.0 0.0 0.0 112-113 2.7 0.0 0.0 0.0 0.0 114-115 3.1375 0.0 0.0 0.0 0.0 116-117 3.5 0.0 0.0 0.0 0.0 118-119 3.9875 0.0 0.0 0.0 0.0 120-121 4.35 0.0 0.0 0.0 0.0 122-123 4.699999999999999 0.0 0.0 0.0 0.0 124-125 5.112500000000001 0.0 0.0 0.0 0.0 126-127 5.65 0.0 0.0 0.0 0.0 128-129 6.225 0.0 0.0 0.0 0.0 130-131 6.875 0.0 0.0 0.0 0.0 132-133 7.2875 0.0 0.0 0.0 0.0 134-135 7.887499999999999 0.0 0.0 0.0 0.0 136-137 8.5875 0.0 0.0 0.0 0.0 138-139 9.149999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTTTT 10 0.006830828 145.0 7 GTTTTTT 10 0.006830828 145.0 8 GATCCAT 15 1.1411342E-4 145.0 5 >>END_MODULE SRR7814844 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814844_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.299 37.0 37.0 37.0 37.0 37.0 2 36.108 37.0 37.0 37.0 37.0 37.0 3 36.103 37.0 37.0 37.0 37.0 37.0 4 36.1545 37.0 37.0 37.0 37.0 37.0 5 36.2235 37.0 37.0 37.0 37.0 37.0 6 36.0555 37.0 37.0 37.0 37.0 37.0 7 36.042 37.0 37.0 37.0 37.0 37.0 8 36.12 37.0 37.0 37.0 37.0 37.0 9 36.1265 37.0 37.0 37.0 37.0 37.0 10-14 36.127300000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.034800000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.9715 37.0 37.0 37.0 37.0 37.0 25-29 36.00359999999999 37.0 37.0 37.0 37.0 37.0 30-34 35.8871 37.0 37.0 37.0 37.0 37.0 35-39 35.8029 37.0 37.0 37.0 37.0 37.0 40-44 35.875499999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.7896 37.0 37.0 37.0 37.0 37.0 50-54 35.7631 37.0 37.0 37.0 37.0 37.0 55-59 35.7205 37.0 37.0 37.0 37.0 37.0 60-64 35.6533 37.0 37.0 37.0 37.0 37.0 65-69 35.5752 37.0 37.0 37.0 37.0 37.0 70-74 35.537 37.0 37.0 37.0 37.0 37.0 75-79 35.5719 37.0 37.0 37.0 37.0 37.0 80-84 35.436099999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.3748 37.0 37.0 37.0 37.0 37.0 90-94 35.3082 37.0 37.0 37.0 34.6 37.0 95-99 35.3389 37.0 37.0 37.0 34.6 37.0 100-104 35.294500000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.237199999999994 37.0 37.0 37.0 32.2 37.0 110-114 35.075199999999995 37.0 37.0 37.0 25.0 37.0 115-119 35.025999999999996 37.0 37.0 37.0 25.0 37.0 120-124 34.9133 37.0 37.0 37.0 25.0 37.0 125-129 34.8724 37.0 37.0 37.0 25.0 37.0 130-134 34.7781 37.0 37.0 37.0 25.0 37.0 135-139 34.4872 37.0 37.0 37.0 25.0 37.0 140-144 34.4364 37.0 37.0 37.0 25.0 37.0 145-149 34.4193 37.0 37.0 37.0 25.0 37.0 150-151 33.6075 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 8.0 15 10.0 16 5.0 17 4.0 18 5.0 19 4.0 20 7.0 21 7.0 22 15.0 23 5.0 24 9.0 25 9.0 26 11.0 27 14.0 28 17.0 29 22.0 30 30.0 31 52.0 32 98.0 33 145.0 34 257.0 35 729.0 36 2396.0 37 137.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.3 18.5 6.800000000000001 26.400000000000002 2 29.725 22.3 26.075 21.9 3 24.5 24.275 28.975 22.25 4 30.5 28.749999999999996 18.5 22.25 5 28.025 32.824999999999996 18.65 20.5 6 25.8 34.225 17.375 22.6 7 24.25 19.25 32.225 24.275 8 24.725 22.900000000000002 23.275000000000002 29.099999999999998 9 25.05 22.875 23.849999999999998 28.225 10-14 27.400000000000002 25.455 21.37 25.775 15-19 27.405 24.68 22.925 24.990000000000002 20-24 27.365000000000002 24.465 22.895 25.275 25-29 27.365000000000002 24.375 23.01 25.25 30-34 26.21 25.195 23.765 24.83 35-39 26.790000000000003 24.965 23.595 24.65 40-44 27.22 24.990000000000002 22.805 24.985 45-49 27.145000000000003 24.395 23.419999999999998 25.040000000000003 50-54 27.145000000000003 25.05 23.175 24.63 55-59 27.334999999999997 25.095 23.11 24.46 60-64 27.42 25.1 23.294999999999998 24.185000000000002 65-69 27.29 24.955 23.685000000000002 24.07 70-74 27.275 23.985 24.25 24.490000000000002 75-79 27.065 25.105 23.515 24.315 80-84 27.650000000000002 24.635 23.65 24.065 85-89 27.725 24.709999999999997 23.64 23.925 90-94 27.189999999999998 24.759999999999998 23.96 24.09 95-99 27.36 24.985 23.669999999999998 23.985 100-104 27.284999999999997 25.25 23.805 23.66 105-109 27.305 24.779999999999998 24.215 23.7 110-114 27.24 25.145 23.835 23.78 115-119 27.565 25.81 22.775000000000002 23.849999999999998 120-124 27.865000000000002 25.314999999999998 22.965 23.855 125-129 27.889999999999997 25.580000000000002 23.39 23.14 130-134 28.335 25.365 22.82 23.48 135-139 28.04 26.075 23.34 22.545 140-144 28.515 26.38 23.34 21.765 145-149 29.395 25.83 22.8 21.975 150-151 28.375 26.075 22.3125 23.2375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 1.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 2.5 21 2.0 22 2.0 23 1.5 24 3.0 25 2.0 26 0.5 27 0.5 28 1.0 29 4.0 30 6.5 31 6.5 32 8.5 33 13.0 34 21.5 35 28.0 36 32.5 37 47.0 38 63.0 39 72.5 40 85.5 41 113.5 42 142.5 43 146.5 44 152.5 45 169.0 46 185.0 47 173.0 48 153.5 49 146.5 50 145.0 51 156.0 52 153.0 53 134.0 54 114.5 55 112.5 56 107.0 57 98.0 58 87.5 59 87.0 60 93.5 61 84.5 62 72.0 63 76.5 64 77.0 65 70.0 66 74.5 67 73.5 68 66.0 69 53.5 70 37.0 71 37.5 72 44.0 73 34.0 74 27.0 75 21.5 76 14.0 77 8.5 78 5.0 79 4.0 80 2.0 81 1.0 82 2.0 83 2.5 84 2.0 85 1.5 86 1.0 87 1.0 88 0.5 89 0.5 90 1.5 91 1.0 92 0.0 93 1.0 94 2.0 95 1.5 96 1.5 97 1.5 98 1.5 99 1.0 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.22301398785959 90.2 2 4.407495381367115 8.35 3 0.3167062549485352 0.8999999999999999 4 0.026392187912377938 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026392187912377938 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 18 0.44999999999999996 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.9749999999999999 0.0 0.0 0.0 0.0 110-111 2.2750000000000004 0.0 0.0 0.0 0.0 112-113 2.7125 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.5250000000000004 0.0 0.0 0.0 0.0 118-119 4.0375 0.0 0.0 0.0 0.0 120-121 4.4 0.0 0.0 0.0 0.0 122-123 4.7625 0.0 0.0 0.0 0.0 124-125 5.1875 0.0 0.0 0.0 0.0 126-127 5.737500000000001 0.0 0.0 0.0 0.0 128-129 6.3125 0.0 0.0 0.0 0.0 130-131 6.9 0.0 0.0 0.0 0.0 132-133 7.35 0.0 0.0 0.0 0.0 134-135 7.9875 0.0 0.0 0.0 0.0 136-137 8.6875 0.0 0.0 0.0 0.0 138-139 9.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTAGCG 10 0.006830828 145.0 1 CTAGCGA 10 0.006830828 145.0 2 >>END_MODULE Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890540 spots for SRR7814844.sra Written 1890540 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra Read 1890523 spots for SRR7814844.sra Written 1890523 spots for SRR7814844.sra SRR ids: ['SRR7814844.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w1fuzop_ SRR7814844.sra spots: 37810477 blocks: [[1, 1890523], [1890524, 3781046], [3781047, 5671569], [5671570, 7562092], [7562093, 9452615], [9452616, 11343138], [11343139, 13233661], [13233662, 15124184], [15124185, 17014707], [17014708, 18905230], [18905231, 20795753], [20795754, 22686276], [22686277, 24576799], [24576800, 26467322], [26467323, 28357845], [28357846, 30248368], [30248369, 32138891], [32138892, 34029414], [34029415, 35919937], [35919938, 37810477]] SRR7814844 file size 12791029 SRR7814844 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814844 SRR7814844_1.fastq SRR7814844_2.fastq Input file: SRR7814844_1.fastq Paired file: SRR7814844_2.fastq trimmed: SRR7814844-trimmed-pair1.fastq, SRR7814844-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:16:02 2024 >> started Fri Dec 6 12:16:41 2024 >> done (39.376s) 37810477 read pairs processed; of these: 241 ( 0.00%) short read pairs filtered out after trimming by size control 25106 ( 0.07%) empty read pairs filtered out after trimming by size control 37785130 (99.93%) read pairs available; of these: 4993744 (13.22%) trimmed read pairs available after processing 32791386 (86.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 21 0.00% 20 17 0.00% 21 24 0.00% 22 38 0.00% 23 43 0.00% 24 36 0.00% 25 53 0.00% 26 39 0.00% 27 58 0.00% 28 45 0.00% 29 75 0.00% 30 72 0.00% 31 54 0.00% 32 86 0.00% 33 87 0.00% 34 62 0.00% 35 76 0.00% 36 81 0.00% 37 102 0.00% 38 92 0.00% 39 109 0.00% 40 104 0.00% 41 110 0.00% 42 118 0.00% 43 145 0.00% 44 138 0.00% 45 146 0.00% 46 171 0.00% 47 168 0.00% 48 212 0.00% 49 232 0.00% 50 285 0.00% 51 312 0.00% 52 284 0.00% 53 305 0.00% 54 323 0.00% 55 374 0.00% 56 405 0.00% 57 476 0.00% 58 565 0.00% 59 585 0.00% 60 775 0.00% 61 827 0.00% 62 911 0.00% 63 998 0.00% 64 1104 0.00% 65 1131 0.00% 66 1349 0.00% 67 1441 0.00% 68 1547 0.00% 69 1779 0.00% 70 2176 0.01% 71 2441 0.01% 72 2776 0.01% 73 3107 0.01% 74 3508 0.01% 75 3972 0.01% 76 4209 0.01% 77 4798 0.01% 78 5396 0.01% 79 5980 0.02% 80 6554 0.02% 81 7682 0.02% 82 8661 0.02% 83 9544 0.03% 84 10727 0.03% 85 11675 0.03% 86 12539 0.03% 87 13646 0.04% 88 15153 0.04% 89 16298 0.04% 90 17945 0.05% 91 19545 0.05% 92 21484 0.06% 93 23798 0.06% 94 25509 0.07% 95 27097 0.07% 96 28946 0.08% 97 31004 0.08% 98 32533 0.09% 99 34343 0.09% 100 36503 0.10% 101 38257 0.10% 102 41655 0.11% 103 43738 0.12% 104 45778 0.12% 105 48227 0.13% 106 50324 0.13% 107 51007 0.13% 108 53745 0.14% 109 56313 0.15% 110 57272 0.15% 111 60398 0.16% 112 63350 0.17% 113 65641 0.17% 114 68950 0.18% 115 71406 0.19% 116 72664 0.19% 117 73592 0.19% 118 75722 0.20% 119 77305 0.20% 120 79738 0.21% 121 81648 0.22% 122 83761 0.22% 123 87046 0.23% 124 91271 0.24% 125 91757 0.24% 126 94411 0.25% 127 96194 0.25% 128 95680 0.25% 129 98518 0.26% 130 100003 0.26% 131 101093 0.27% 132 104181 0.28% 133 106913 0.28% 134 109299 0.29% 135 112118 0.30% 136 114273 0.30% 137 114134 0.30% 138 115955 0.31% 139 118071 0.31% 140 118662 0.31% 141 120924 0.32% 142 122649 0.32% 143 124177 0.33% 144 127705 0.34% 145 130003 0.34% 146 132244 0.35% 147 133104 0.35% 148 133448 0.35% 149 134005 0.35% 150 137261 0.36% 151 32791386 86.78% 37785130 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=9.96 fanout-score-rank=20 prefix-density=0.34 prefix-fanout=6.0 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTTACCAGATCGCCTGTCGATCTTGGTCACCAGCTCGGCAAACTTCACAGCAATGTGGGAGGTGTGGCAGTCCAGCACTGGGGCGTAGCCGTTGCCAATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCAGCCTCCTTGGCAGGGTCATCCTTGGAGTTGGATGCAACAAACCCACGCTTGAGATCCTTCACAGCAACGTTCTTGACGTTGAAGCCAACATTGTCACCAGGAAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=485.83 fanout-score-rank=1 prefix-density=1.23 prefix-fanout=32.3 sequence=CTTCTTCTTGAT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=34 prefix-density=0.55 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=32 fanout-score=474.62 fanout-score-rank=1 prefix-density=1.10 prefix-fanout=17.8 sequence=CGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR7814844 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:17:33 Started mapping on | Dec 06 12:17:34 Finished on | Dec 06 12:24:19 Mapping speed, Million of reads per hour | 335.87 Number of input reads | 37785130 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 33889210 Uniquely mapped reads % | 89.69% Average mapped length | 293.76 Number of splices: Total | 32811877 Number of splices: Annotated (sjdb) | 30907256 Number of splices: GT/AG | 32339990 Number of splices: GC/AG | 370429 Number of splices: AT/AC | 25984 Number of splices: Non-canonical | 75474 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 3.02 Insertion rate per base | 0.03% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 657475 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 87826 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.92% % of reads unmapped: other | 1.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3238445 3238445 3238445 N_multimapping 657475 657475 657475 N_noFeature 870901 32987425 1199919 N_ambiguous 661647 3910 90004 UnstrandedReadsAssigned:32356662 PositiveStrandReadsAssigned:897875 NegativeStrandReadsAssigned:32599287 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814844 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814844-trimmed-pair1.fastq SRR7814844-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,785,130 reads, 33,399,177 reads pseudoaligned [quant] estimated average fragment length: 250.859 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 SRR7814844.ke.tsv 35125 SRR7814844.se.tsv 88098 total ==> SRR7814844.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 686.569 96.1589 5.51753 PNS24247 1044 794.141 85.6897 4.2508 PNS24249 1928 1678.14 337.812 7.93023 PNS24246 1044 794.141 85.6897 4.2508 PNS24248 1044 794.141 85.6897 4.2508 PNS24244 1471 1221.14 343.96 11.0964 PNS24243 293 99.3265 1 0.39662 KQK14069 1603 1353.14 3139.75 91.4095 KQK14071 474 243.936 15.1236 2.4424 ==> SRR7814844.se.tsv <== BRADI_1g14170v3 3171 BRADI_1g53295v3 1116 BRADI_1g59795v3 132 BRADI_1g07683v3 0 BRADI_1g00485v3 78 BRADI_1g20270v3 3593 BRADI_1g74790v3 281 BRADI_1g09890v3 2 BRADI_1g77505v3 667 BRADI_1g48960v3 0 SRR7814844 completed mapping pipeline successfully