Starting /dee2/code/volunteer_pipeline.sh SRR7814845 current disk space = 1551389376512 free memory = 1398432276 SRR7814845 SRAfilesize 073680da50ab0055d3ce60d792743c75 SRR7814845.sra SRR7814845.sra file validated SRR7814845 is paired end SRR7814845 is conventional basespace SRR7814845 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814845_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.256 37.0 37.0 37.0 37.0 37.0 2 36.281 37.0 37.0 37.0 37.0 37.0 3 36.3675 37.0 37.0 37.0 37.0 37.0 4 36.4315 37.0 37.0 37.0 37.0 37.0 5 36.454 37.0 37.0 37.0 37.0 37.0 6 36.372 37.0 37.0 37.0 37.0 37.0 7 36.4685 37.0 37.0 37.0 37.0 37.0 8 36.4605 37.0 37.0 37.0 37.0 37.0 9 36.424 37.0 37.0 37.0 37.0 37.0 10-14 36.464099999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.4483 37.0 37.0 37.0 37.0 37.0 20-24 36.457 37.0 37.0 37.0 37.0 37.0 25-29 36.3619 37.0 37.0 37.0 37.0 37.0 30-34 36.341300000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.2892 37.0 37.0 37.0 37.0 37.0 40-44 36.2564 37.0 37.0 37.0 37.0 37.0 45-49 36.07299999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.1494 37.0 37.0 37.0 37.0 37.0 55-59 36.0351 37.0 37.0 37.0 37.0 37.0 60-64 35.999 37.0 37.0 37.0 37.0 37.0 65-69 35.936600000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.9328 37.0 37.0 37.0 37.0 37.0 75-79 36.0032 37.0 37.0 37.0 37.0 37.0 80-84 35.956999999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.9025 37.0 37.0 37.0 37.0 37.0 90-94 35.8829 37.0 37.0 37.0 37.0 37.0 95-99 35.756600000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.772999999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.796099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.6995 37.0 37.0 37.0 37.0 37.0 115-119 35.601299999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.608399999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.580200000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.4257 37.0 37.0 37.0 37.0 37.0 135-139 35.301199999999994 37.0 37.0 37.0 34.6 37.0 140-144 35.2501 37.0 37.0 37.0 32.2 37.0 145-149 35.0581 37.0 37.0 37.0 27.4 37.0 150-151 34.35875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 3.0 22 1.0 23 5.0 24 2.0 25 10.0 26 12.0 27 17.0 28 19.0 29 26.0 30 40.0 31 58.0 32 74.0 33 131.0 34 217.0 35 399.0 36 2704.0 37 281.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 53.60540811216825 11.617426139208813 6.284426639959941 28.492739108662995 2 26.0 13.3 30.375000000000004 30.325000000000003 3 22.675 19.425 24.25 33.650000000000006 4 27.55 24.65 20.974999999999998 26.825 5 27.675 28.449999999999996 22.25 21.625 6 24.375 30.599999999999998 22.875 22.15 7 19.175 24.8 36.625 19.400000000000002 8 19.925 24.575 28.275 27.224999999999998 9 21.55 20.9 30.125 27.425 10-14 24.495 26.040000000000003 23.73 25.735000000000003 15-19 24.695 24.725 24.445 26.135 20-24 23.76 25.085 24.41 26.745 25-29 24.165 25.419999999999998 23.73 26.685 30-34 24.775 24.63 23.965 26.63 35-39 24.755 24.455 23.91 26.88 40-44 24.48 25.11 23.23 27.18 45-49 24.945 24.79 23.87 26.395000000000003 50-54 24.59 25.06 23.525 26.825 55-59 24.060000000000002 24.834999999999997 24.36 26.745 60-64 25.035 24.095 23.52 27.35 65-69 24.615000000000002 24.915000000000003 23.330000000000002 27.139999999999997 70-74 26.224999999999998 24.2 23.05 26.525 75-79 26.1 24.07 23.215 26.615 80-84 26.1 23.669999999999998 23.215 27.015 85-89 26.58 23.445 23.115 26.86 90-94 26.400000000000002 24.07 22.994999999999997 26.534999999999997 95-99 25.855 23.61 23.02 27.515 100-104 26.195 24.02 22.615 27.169999999999998 105-109 26.955000000000002 23.385 22.64 27.02 110-114 26.369999999999997 23.94 22.295 27.395000000000003 115-119 27.11 22.975 22.85 27.065 120-124 27.07 22.994999999999997 23.165 26.77 125-129 26.740000000000002 23.59 22.365 27.305 130-134 27.11 23.44 22.2 27.250000000000004 135-139 27.01 23.825 22.025 27.139999999999997 140-144 26.590000000000003 23.445 22.470000000000002 27.495000000000005 145-149 26.68 23.315 21.98 28.025 150-151 27.725 23.05 21.675 27.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.5 27 2.0 28 3.5 29 3.5 30 8.0 31 11.5 32 11.0 33 16.0 34 24.0 35 33.5 36 45.0 37 64.0 38 81.0 39 93.5 40 108.0 41 131.5 42 146.5 43 145.5 44 151.5 45 157.5 46 158.5 47 157.0 48 149.0 49 133.5 50 117.5 51 123.5 52 113.0 53 97.0 54 95.5 55 90.5 56 86.0 57 82.0 58 93.5 59 100.5 60 94.5 61 93.5 62 90.0 63 78.5 64 87.5 65 96.5 66 89.5 67 90.0 68 91.5 69 68.0 70 47.5 71 44.5 72 39.5 73 36.0 74 31.5 75 22.0 76 15.0 77 13.5 78 10.5 79 7.5 80 5.0 81 2.0 82 1.5 83 1.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.375 #Duplication Level Percentage of deduplicated Percentage of total 1 94.00267737617135 87.775 2 5.568942436412316 10.4 3 0.3748326639892905 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0535475234270415 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTTAACATCTCGTAT 18 0.44999999999999996 TruSeq Adapter, Index 2 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTTAACATCGCGTAT 13 0.325 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.5125 0.0 0.0 0.0 0.0 104-105 1.8624999999999998 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.4 0.0 0.0 0.0 0.0 110-111 2.8499999999999996 0.0 0.0 0.0 0.0 112-113 3.15 0.0 0.0 0.0 0.0 114-115 3.6125 0.0 0.0 0.0 0.0 116-117 4.175000000000001 0.0 0.0 0.0 0.0 118-119 4.65 0.0 0.0 0.0 0.0 120-121 4.9875 0.0 0.0 0.0 0.0 122-123 5.449999999999999 0.0 0.0 0.0 0.0 124-125 5.9875 0.0 0.0 0.0 0.0 126-127 6.4125 0.0 0.0 0.0 0.0 128-129 6.9375 0.0 0.0 0.0 0.0 130-131 7.5875 0.0 0.0 0.0 0.0 132-133 8.15 0.0 0.0 0.0 0.0 134-135 8.8875 0.0 0.0 0.0 0.0 136-137 9.5875 0.0 0.0 0.0 0.0 138-139 10.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814845 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814845_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.26 37.0 37.0 37.0 37.0 37.0 2 35.894 37.0 37.0 37.0 37.0 37.0 3 35.886 37.0 37.0 37.0 37.0 37.0 4 36.058 37.0 37.0 37.0 37.0 37.0 5 36.088 37.0 37.0 37.0 37.0 37.0 6 35.983 37.0 37.0 37.0 37.0 37.0 7 35.969 37.0 37.0 37.0 37.0 37.0 8 36.0085 37.0 37.0 37.0 37.0 37.0 9 35.981 37.0 37.0 37.0 37.0 37.0 10-14 35.9021 37.0 37.0 37.0 37.0 37.0 15-19 35.795300000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.7822 37.0 37.0 37.0 37.0 37.0 25-29 35.741200000000006 37.0 37.0 37.0 37.0 37.0 30-34 35.6365 37.0 37.0 37.0 37.0 37.0 35-39 35.585699999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.581100000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.50920000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.535900000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.485299999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.417500000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.3465 37.0 37.0 37.0 37.0 37.0 70-74 35.2529 37.0 37.0 37.0 37.0 37.0 75-79 35.2832 37.0 37.0 37.0 37.0 37.0 80-84 35.2264 37.0 37.0 37.0 32.2 37.0 85-89 35.2327 37.0 37.0 37.0 34.6 37.0 90-94 35.1825 37.0 37.0 37.0 34.6 37.0 95-99 35.061099999999996 37.0 37.0 37.0 25.0 37.0 100-104 35.107600000000005 37.0 37.0 37.0 29.8 37.0 105-109 35.05159999999999 37.0 37.0 37.0 25.0 37.0 110-114 34.887899999999995 37.0 37.0 37.0 25.0 37.0 115-119 34.783699999999996 37.0 37.0 37.0 25.0 37.0 120-124 34.675200000000004 37.0 37.0 37.0 25.0 37.0 125-129 34.6078 37.0 37.0 37.0 25.0 37.0 130-134 34.5004 37.0 37.0 37.0 25.0 37.0 135-139 34.178399999999996 37.0 37.0 37.0 25.0 37.0 140-144 33.8643 37.0 37.0 37.0 25.0 37.0 145-149 33.737300000000005 37.0 37.0 37.0 25.0 37.0 150-151 33.09825 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 9.0 15 9.0 16 8.0 17 4.0 18 8.0 19 2.0 20 8.0 21 10.0 22 17.0 23 15.0 24 12.0 25 15.0 26 12.0 27 19.0 28 30.0 29 32.0 30 38.0 31 67.0 32 92.0 33 158.0 34 306.0 35 773.0 36 2260.0 37 90.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.85 18.15 8.1 24.9 2 32.925 20.575 24.325 22.175 3 26.3 23.825 25.6 24.275 4 30.425 27.450000000000003 18.025 24.099999999999998 5 29.775000000000002 30.925000000000004 17.224999999999998 22.075 6 26.55 32.875 17.8 22.775000000000002 7 27.450000000000003 16.625 31.924999999999997 24.0 8 27.075 21.0 21.45 30.475 9 25.4 21.2 25.05 28.349999999999998 10-14 29.21 23.69 20.505000000000003 26.595000000000002 15-19 28.665000000000003 23.335 21.884999999999998 26.115 20-24 28.13 23.505000000000003 22.465 25.900000000000002 25-29 28.544999999999998 23.595 21.775 26.085 30-34 28.310000000000002 23.265 22.285 26.14 35-39 27.88 23.62 22.14 26.36 40-44 28.765 23.77 21.575 25.89 45-49 28.110000000000003 24.095 21.95 25.845000000000002 50-54 27.810000000000002 23.625 22.355 26.21 55-59 28.660000000000004 23.82 21.615000000000002 25.905 60-64 28.22 23.75 21.59 26.44 65-69 28.384999999999998 23.66 22.32 25.635 70-74 28.265 23.28 22.295 26.16 75-79 27.99 23.305 22.535 26.169999999999998 80-84 28.27 23.095 22.66 25.974999999999998 85-89 28.384999999999998 23.41 22.16 26.045 90-94 28.205000000000002 22.634999999999998 22.46 26.700000000000003 95-99 28.749999999999996 23.825 21.955 25.47 100-104 29.01 22.86 22.259999999999998 25.869999999999997 105-109 28.975 23.825 21.560000000000002 25.64 110-114 28.720000000000002 23.990000000000002 21.85 25.44 115-119 28.935 24.025 21.795 25.245 120-124 29.23 24.055 21.775 24.94 125-129 30.080000000000002 23.68 22.040000000000003 24.2 130-134 29.57 24.154999999999998 21.565 24.709999999999997 135-139 30.15 23.65 21.959999999999997 24.240000000000002 140-144 30.505 24.335 21.05 24.11 145-149 30.895 23.544999999999998 21.88 23.68 150-151 32.074999999999996 24.1375 20.9 22.8875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.5 7 1.5 8 1.0 9 1.5 10 1.5 11 1.0 12 0.0 13 2.0 14 2.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 2.0 22 1.5 23 1.0 24 1.0 25 0.5 26 1.0 27 1.5 28 2.0 29 3.0 30 4.5 31 4.0 32 7.0 33 10.5 34 12.5 35 18.5 36 30.0 37 39.0 38 40.5 39 57.5 40 72.0 41 89.0 42 111.0 43 107.0 44 123.5 45 148.0 46 148.5 47 149.0 48 134.5 49 129.5 50 129.0 51 125.5 52 117.0 53 106.0 54 105.0 55 103.5 56 102.0 57 98.5 58 101.0 59 108.0 60 103.5 61 95.0 62 112.0 63 119.0 64 103.5 65 94.5 66 94.5 67 99.0 68 94.5 69 87.5 70 83.5 71 63.0 72 47.5 73 46.0 74 40.5 75 30.5 76 22.5 77 21.0 78 14.5 79 6.0 80 6.0 81 4.0 82 1.5 83 2.5 84 2.0 85 1.5 86 1.0 87 2.0 88 3.5 89 3.0 90 1.0 91 0.0 92 1.0 93 2.0 94 1.0 95 0.5 96 1.0 97 1.5 98 3.0 99 4.0 100 10.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.61189650573486 88.675 2 4.88130168044812 9.15 3 0.2667377967457989 0.75 4 0.13336889837289945 0.5 5 0.08002133902373967 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026673779674579887 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 22 0.5499999999999999 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.7124999999999999 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.0750000000000002 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.4500000000000002 0.0 0.0 0.0 0.0 104-105 1.7999999999999998 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.7750000000000004 0.0 0.0 0.0 0.0 112-113 3.0875000000000004 0.0 0.0 0.0 0.0 114-115 3.5625 0.0 0.0 0.0 0.0 116-117 4.125 0.0 0.0 0.0 0.0 118-119 4.625 0.0 0.0 0.0 0.0 120-121 4.9625 0.0 0.0 0.0 0.0 122-123 5.425000000000001 0.0 0.0 0.0 0.0 124-125 5.9625 0.0 0.0 0.0 0.0 126-127 6.375 0.0 0.0 0.0 0.0 128-129 6.9125 0.0 0.0 0.0 0.0 130-131 7.5625 0.0 0.0 0.0 0.0 132-133 8.125 0.0 0.0 0.0 0.0 134-135 8.8625 0.0 0.0 0.0 0.0 136-137 9.575 0.0 0.0 0.0 0.0 138-139 10.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGCGGG 10 0.006830828 145.0 145 TCCAACG 10 0.006830828 145.0 7 >>END_MODULE Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574580 spots for SRR7814845.sra Written 1574580 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra Read 1574561 spots for SRR7814845.sra Written 1574561 spots for SRR7814845.sra SRR ids: ['SRR7814845.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7lpr2q6s SRR7814845.sra spots: 31491239 blocks: [[1, 1574561], [1574562, 3149122], [3149123, 4723683], [4723684, 6298244], [6298245, 7872805], [7872806, 9447366], [9447367, 11021927], [11021928, 12596488], [12596489, 14171049], [14171050, 15745610], [15745611, 17320171], [17320172, 18894732], [18894733, 20469293], [20469294, 22043854], [22043855, 23618415], [23618416, 25192976], [25192977, 26767537], [26767538, 28342098], [28342099, 29916659], [29916660, 31491239]] SRR7814845 file size 10649647 SRR7814845 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814845 SRR7814845_1.fastq SRR7814845_2.fastq Input file: SRR7814845_1.fastq Paired file: SRR7814845_2.fastq trimmed: SRR7814845-trimmed-pair1.fastq, SRR7814845-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:20:34 2024 >> started Fri Dec 6 12:21:42 2024 >> done (68.219s) 31491239 read pairs processed; of these: 234 ( 0.00%) short read pairs filtered out after trimming by size control 222305 ( 0.71%) empty read pairs filtered out after trimming by size control 31268700 (99.29%) read pairs available; of these: 4134903 (13.22%) trimmed read pairs available after processing 27133797 (86.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 12 0.00% 20 14 0.00% 21 14 0.00% 22 29 0.00% 23 41 0.00% 24 27 0.00% 25 34 0.00% 26 44 0.00% 27 36 0.00% 28 50 0.00% 29 52 0.00% 30 50 0.00% 31 53 0.00% 32 54 0.00% 33 60 0.00% 34 60 0.00% 35 65 0.00% 36 68 0.00% 37 68 0.00% 38 73 0.00% 39 84 0.00% 40 86 0.00% 41 89 0.00% 42 95 0.00% 43 109 0.00% 44 119 0.00% 45 125 0.00% 46 129 0.00% 47 149 0.00% 48 135 0.00% 49 174 0.00% 50 173 0.00% 51 220 0.00% 52 264 0.00% 53 261 0.00% 54 238 0.00% 55 275 0.00% 56 308 0.00% 57 341 0.00% 58 448 0.00% 59 478 0.00% 60 547 0.00% 61 659 0.00% 62 674 0.00% 63 732 0.00% 64 802 0.00% 65 864 0.00% 66 923 0.00% 67 1047 0.00% 68 1214 0.00% 69 1343 0.00% 70 1567 0.01% 71 1836 0.01% 72 2116 0.01% 73 2360 0.01% 74 2516 0.01% 75 2824 0.01% 76 3133 0.01% 77 3438 0.01% 78 4010 0.01% 79 4400 0.01% 80 4912 0.02% 81 5657 0.02% 82 6528 0.02% 83 7317 0.02% 84 8194 0.03% 85 8596 0.03% 86 9338 0.03% 87 10197 0.03% 88 11349 0.04% 89 12098 0.04% 90 13488 0.04% 91 15250 0.05% 92 16345 0.05% 93 17951 0.06% 94 19626 0.06% 95 20962 0.07% 96 22522 0.07% 97 23981 0.08% 98 24948 0.08% 99 26567 0.08% 100 28439 0.09% 101 30087 0.10% 102 32528 0.10% 103 34556 0.11% 104 36655 0.12% 105 37939 0.12% 106 40203 0.13% 107 41660 0.13% 108 42497 0.14% 109 44673 0.14% 110 46921 0.15% 111 48577 0.16% 112 50946 0.16% 113 53632 0.17% 114 55468 0.18% 115 58547 0.19% 116 59771 0.19% 117 61766 0.20% 118 62283 0.20% 119 63304 0.20% 120 65857 0.21% 121 66697 0.21% 122 68623 0.22% 123 70993 0.23% 124 74258 0.24% 125 76031 0.24% 126 78721 0.25% 127 79870 0.26% 128 81839 0.26% 129 83291 0.27% 130 83648 0.27% 131 85643 0.27% 132 88635 0.28% 133 90476 0.29% 134 93000 0.30% 135 94784 0.30% 136 96159 0.31% 137 97224 0.31% 138 96993 0.31% 139 99261 0.32% 140 100635 0.32% 141 101053 0.32% 142 102987 0.33% 143 105203 0.34% 144 110052 0.35% 145 110893 0.35% 146 111875 0.36% 147 115335 0.37% 148 114013 0.36% 149 114886 0.37% 150 117468 0.38% 151 27133797 86.78% 31268700 reads passed initial QC criterion=sequence-density sequence-density=1.49 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=27 prefix-density=1.52 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.17 sequence-density-rank=31 fanout-score=12.32 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=2.9 sequence=AGCATGGCCCACCTGCAGTGGATCACCTC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=18 prefix-density=0.80 prefix-fanout=2.7 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=35 fanout-score=25.91 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=3.4 sequence=CCCGCTCGGCTTCGGCACCAAGAGCGACAAGGAGTTGGCAGAGCTCAAGCTCAAGGAGATCAA SRR7814845 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:22:43 Started mapping on | Dec 06 12:22:43 Finished on | Dec 06 12:25:48 Mapping speed, Million of reads per hour | 608.47 Number of input reads | 31268700 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 28999565 Uniquely mapped reads % | 92.74% Average mapped length | 293.99 Number of splices: Total | 23241124 Number of splices: Annotated (sjdb) | 21943902 Number of splices: GT/AG | 22934410 Number of splices: GC/AG | 251688 Number of splices: AT/AC | 6750 Number of splices: Non-canonical | 48276 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271735 % of reads mapped to multiple loci | 0.87% Number of reads mapped to too many loci | 14312 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.11% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1997400 1997400 1997400 N_multimapping 271735 271735 271735 N_noFeature 512058 28005958 742136 N_ambiguous 896286 3656 133466 UnstrandedReadsAssigned:27591221 PositiveStrandReadsAssigned:989951 NegativeStrandReadsAssigned:28123963 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814845 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814845-trimmed-pair1.fastq SRR7814845-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,268,700 reads, 28,708,403 reads pseudoaligned [quant] estimated average fragment length: 245.267 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR7814845.ke.tsv 35125 SRR7814845.se.tsv 88098 total ==> SRR7814845.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 692.006 0 0 PNS24247 1044 799.733 35.1242 1.76546 PNS24249 1928 1683.73 85.6051 2.04373 PNS24246 1044 799.733 35.1242 1.76546 PNS24248 1044 799.733 35.1242 1.76546 PNS24244 1471 1226.73 212.022 6.9475 PNS24243 293 100.347 1 0.400584 KQK14069 1603 1358.73 2490.27 73.673 KQK14071 474 244.793 8.57099 1.40743 ==> SRR7814845.se.tsv <== BRADI_1g14170v3 2550 BRADI_1g53295v3 257 BRADI_1g59795v3 754 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 458 BRADI_1g74790v3 871 BRADI_1g09890v3 1 BRADI_1g77505v3 679 BRADI_1g48960v3 0 SRR7814845 completed mapping pipeline successfully