Starting /dee2/code/volunteer_pipeline.sh SRR7814846 current disk space = 1551446568960 free memory = 1601434504 SRR7814846 SRAfilesize 3f3025dc433cf99b87fd4b78a41a0e37 SRR7814846.sra SRR7814846.sra file validated SRR7814846 is paired end SRR7814846 is conventional basespace SRR7814846 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814846_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.34225 37.0 37.0 37.0 37.0 37.0 2 36.3575 37.0 37.0 37.0 37.0 37.0 3 36.457 37.0 37.0 37.0 37.0 37.0 4 36.4985 37.0 37.0 37.0 37.0 37.0 5 36.6565 37.0 37.0 37.0 37.0 37.0 6 36.4875 37.0 37.0 37.0 37.0 37.0 7 36.426 37.0 37.0 37.0 37.0 37.0 8 36.5025 37.0 37.0 37.0 37.0 37.0 9 36.539 37.0 37.0 37.0 37.0 37.0 10-14 36.5279 37.0 37.0 37.0 37.0 37.0 15-19 36.5492 37.0 37.0 37.0 37.0 37.0 20-24 36.5317 37.0 37.0 37.0 37.0 37.0 25-29 36.4499 37.0 37.0 37.0 37.0 37.0 30-34 36.3903 37.0 37.0 37.0 37.0 37.0 35-39 36.407500000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.381699999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.3732 37.0 37.0 37.0 37.0 37.0 50-54 36.3429 37.0 37.0 37.0 37.0 37.0 55-59 36.3258 37.0 37.0 37.0 37.0 37.0 60-64 36.3464 37.0 37.0 37.0 37.0 37.0 65-69 36.278 37.0 37.0 37.0 37.0 37.0 70-74 36.329899999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.243700000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.241 37.0 37.0 37.0 37.0 37.0 85-89 36.200300000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.1931 37.0 37.0 37.0 37.0 37.0 95-99 36.1785 37.0 37.0 37.0 37.0 37.0 100-104 36.19160000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.154999999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.1453 37.0 37.0 37.0 37.0 37.0 115-119 36.0667 37.0 37.0 37.0 37.0 37.0 120-124 35.951699999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.9919 37.0 37.0 37.0 37.0 37.0 130-134 35.9397 37.0 37.0 37.0 37.0 37.0 135-139 35.9016 37.0 37.0 37.0 37.0 37.0 140-144 35.8757 37.0 37.0 37.0 37.0 37.0 145-149 35.9188 37.0 37.0 37.0 37.0 37.0 150-151 35.272999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 2.0 26 3.0 27 9.0 28 18.0 29 22.0 30 26.0 31 43.0 32 51.0 33 67.0 34 141.0 35 324.0 36 2814.0 37 477.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 57.2396486825596 11.51819322459222 4.316185696361355 26.925972396486824 2 26.400000000000002 13.525 30.75 29.325000000000003 3 21.45 19.475 23.974999999999998 35.099999999999994 4 29.575000000000003 25.324999999999996 19.400000000000002 25.7 5 27.875 30.075000000000003 21.475 20.575 6 22.900000000000002 31.874999999999996 23.075000000000003 22.15 7 19.900000000000002 22.3 38.224999999999994 19.575 8 20.625 22.6 28.425 28.349999999999998 9 19.85 21.875 31.974999999999998 26.3 10-14 24.57 25.61 24.165 25.655 15-19 24.63 24.545 25.040000000000003 25.785000000000004 20-24 24.060000000000002 24.69 25.374999999999996 25.874999999999996 25-29 24.075 24.565 24.834999999999997 26.525 30-34 24.12 23.72 25.25 26.91 35-39 24.135 24.6 24.88 26.384999999999998 40-44 24.375 24.715 24.775 26.135 45-49 24.245 24.245 24.54 26.97 50-54 24.310000000000002 24.805 24.205 26.68 55-59 24.555 24.169999999999998 24.435000000000002 26.840000000000003 60-64 24.87 24.11 24.57 26.450000000000003 65-69 24.365000000000002 24.625 24.82 26.19 70-74 24.86 24.5 24.29 26.35 75-79 24.945 23.755000000000003 24.6 26.700000000000003 80-84 24.355 24.95 24.29 26.405 85-89 24.834999999999997 24.15 24.59 26.424999999999997 90-94 25.540000000000003 23.685000000000002 23.995 26.779999999999998 95-99 25.45 24.224999999999998 24.13 26.195 100-104 25.069999999999997 23.915 24.445 26.57 105-109 25.085 23.945 24.365000000000002 26.605 110-114 25.5 24.474999999999998 24.185000000000002 25.840000000000003 115-119 25.085 24.68 24.310000000000002 25.924999999999997 120-124 25.91 24.51 23.72 25.86 125-129 25.835 24.5 23.415 26.25 130-134 25.495 24.12 23.685000000000002 26.700000000000003 135-139 24.52 24.805 24.015 26.66 140-144 25.195 24.560000000000002 23.95 26.295 145-149 25.705 24.085 23.65 26.56 150-151 25.687500000000004 24.2 22.875 27.237499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 1.5 26 1.5 27 2.0 28 2.0 29 1.5 30 5.0 31 7.5 32 12.5 33 13.0 34 25.0 35 38.5 36 37.5 37 46.0 38 66.5 39 92.5 40 100.0 41 117.0 42 147.0 43 158.5 44 168.0 45 185.5 46 196.5 47 184.5 48 176.5 49 167.5 50 149.0 51 148.0 52 142.0 53 118.0 54 107.0 55 103.5 56 97.0 57 92.0 58 87.5 59 78.5 60 78.5 61 77.0 62 64.5 63 61.5 64 65.5 65 67.5 66 60.5 67 66.0 68 70.0 69 61.5 70 50.0 71 39.0 72 34.0 73 33.0 74 29.5 75 20.5 76 13.0 77 11.0 78 7.5 79 3.0 80 2.5 81 2.0 82 2.0 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.5 #Duplication Level Percentage of deduplicated Percentage of total 1 90.1657458563536 81.6 2 9.226519337016574 16.7 3 0.5524861878453038 1.5 4 0.05524861878453039 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.1125 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.55 0.0 0.0 0.0 0.0 118-119 4.125 0.0 0.0 0.0 0.0 120-121 4.475 0.0 0.0 0.0 0.0 122-123 4.9125 0.0 0.0 0.0 0.0 124-125 5.262499999999999 0.0 0.0 0.0 0.0 126-127 5.6 0.0 0.0 0.0 0.0 128-129 6.0625 0.0 0.0 0.0 0.0 130-131 6.5125 0.0 0.0 0.0 0.0 132-133 6.8 0.0 0.0 0.0 0.0 134-135 7.1 0.0 0.0 0.0 0.0 136-137 7.8125 0.0 0.0 0.0 0.0 138-139 8.337499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATGGC 10 0.006832588 144.9875 7 >>END_MODULE SRR7814846 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814846_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2245 37.0 37.0 37.0 37.0 37.0 2 35.8435 37.0 37.0 37.0 37.0 37.0 3 35.9785 37.0 37.0 37.0 37.0 37.0 4 35.886 37.0 37.0 37.0 37.0 37.0 5 35.993 37.0 37.0 37.0 37.0 37.0 6 36.008 37.0 37.0 37.0 37.0 37.0 7 35.9745 37.0 37.0 37.0 37.0 37.0 8 36.028 37.0 37.0 37.0 37.0 37.0 9 35.9875 37.0 37.0 37.0 37.0 37.0 10-14 35.94689999999999 37.0 37.0 37.0 37.0 37.0 15-19 35.8944 37.0 37.0 37.0 37.0 37.0 20-24 35.9357 37.0 37.0 37.0 37.0 37.0 25-29 35.8786 37.0 37.0 37.0 37.0 37.0 30-34 35.8867 37.0 37.0 37.0 37.0 37.0 35-39 35.765 37.0 37.0 37.0 37.0 37.0 40-44 35.871 37.0 37.0 37.0 37.0 37.0 45-49 35.7876 37.0 37.0 37.0 37.0 37.0 50-54 35.7915 37.0 37.0 37.0 37.0 37.0 55-59 35.6659 37.0 37.0 37.0 37.0 37.0 60-64 35.6314 37.0 37.0 37.0 37.0 37.0 65-69 35.6372 37.0 37.0 37.0 37.0 37.0 70-74 35.6102 37.0 37.0 37.0 37.0 37.0 75-79 35.5955 37.0 37.0 37.0 37.0 37.0 80-84 35.5003 37.0 37.0 37.0 37.0 37.0 85-89 35.43429999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.4353 37.0 37.0 37.0 37.0 37.0 95-99 35.4847 37.0 37.0 37.0 37.0 37.0 100-104 35.41709999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.4625 37.0 37.0 37.0 37.0 37.0 110-114 35.327600000000004 37.0 37.0 37.0 34.6 37.0 115-119 35.262299999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.1137 37.0 37.0 37.0 27.4 37.0 125-129 35.182100000000005 37.0 37.0 37.0 32.2 37.0 130-134 35.074799999999996 37.0 37.0 37.0 32.2 37.0 135-139 34.8785 37.0 37.0 37.0 25.0 37.0 140-144 34.5819 37.0 37.0 37.0 25.0 37.0 145-149 34.5616 37.0 37.0 37.0 25.0 37.0 150-151 33.8335 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 5.0 15 3.0 16 5.0 17 3.0 18 3.0 19 10.0 20 5.0 21 8.0 22 10.0 23 16.0 24 9.0 25 14.0 26 15.0 27 14.0 28 18.0 29 31.0 30 23.0 31 70.0 32 65.0 33 139.0 34 240.0 35 604.0 36 2488.0 37 196.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.775 19.125 6.575 25.525 2 30.3 21.925 25.275 22.5 3 25.174999999999997 23.275000000000002 27.400000000000002 24.15 4 29.325000000000003 29.15 18.9 22.625 5 29.025000000000002 32.6 18.125 20.25 6 24.375 33.85 18.025 23.75 7 23.45 20.200000000000003 33.275 23.075000000000003 8 23.775 22.375 23.275000000000002 30.575000000000003 9 23.275000000000002 22.125 25.724999999999998 28.875 10-14 26.77 24.740000000000002 22.35 26.14 15-19 26.340000000000003 24.25 23.06 26.35 20-24 26.21 24.695 23.990000000000002 25.105 25-29 26.41 24.85 23.035 25.705 30-34 26.505000000000003 25.045 22.795 25.655 35-39 26.119999999999997 24.975 23.285 25.619999999999997 40-44 26.86 25.35 22.445 25.345000000000002 45-49 26.840000000000003 24.92 23.169999999999998 25.069999999999997 50-54 26.490000000000002 24.474999999999998 23.32 25.715 55-59 26.974999999999998 24.77 23.26 24.995 60-64 26.424999999999997 23.95 23.46 26.165 65-69 26.605 24.740000000000002 23.375 25.28 70-74 26.115 24.54 23.69 25.655 75-79 26.455000000000002 24.915000000000003 23.150000000000002 25.480000000000004 80-84 26.195 24.72 23.330000000000002 25.755 85-89 26.985 24.169999999999998 23.075000000000003 25.77 90-94 26.345000000000002 24.775 23.125 25.755 95-99 26.305 24.779999999999998 23.615 25.3 100-104 27.495000000000005 24.62 23.189999999999998 24.695 105-109 27.11 24.529999999999998 23.185 25.174999999999997 110-114 27.279999999999998 25.240000000000002 22.634999999999998 24.845 115-119 27.634999999999998 24.610000000000003 23.51 24.245 120-124 27.735 25.130000000000003 22.939999999999998 24.195 125-129 27.139999999999997 25.045 22.99 24.825 130-134 27.474999999999998 25.025 23.45 24.05 135-139 27.83 25.83 22.770000000000003 23.57 140-144 28.549999999999997 24.855 22.95 23.645 145-149 28.294999999999998 25.595000000000002 22.189999999999998 23.919999999999998 150-151 28.212500000000002 25.35 22.900000000000002 23.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 1.5 10 2.0 11 1.5 12 1.0 13 1.0 14 2.0 15 3.0 16 2.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 2.0 24 2.5 25 1.0 26 1.0 27 2.5 28 2.5 29 3.0 30 8.0 31 11.0 32 11.5 33 12.5 34 17.0 35 20.0 36 33.5 37 44.5 38 50.0 39 73.5 40 99.5 41 131.0 42 141.5 43 140.5 44 156.0 45 164.0 46 171.5 47 172.0 48 155.0 49 151.5 50 148.0 51 133.0 52 125.0 53 109.5 54 98.0 55 97.5 56 94.5 57 80.5 58 90.0 59 106.0 60 89.5 61 90.0 62 101.5 63 96.5 64 86.5 65 80.5 66 75.5 67 70.5 68 69.0 69 63.0 70 55.0 71 50.0 72 42.0 73 32.0 74 22.5 75 21.5 76 20.0 77 12.5 78 10.0 79 5.0 80 1.5 81 2.0 82 1.5 83 1.0 84 1.0 85 1.0 86 1.0 87 1.0 88 2.0 89 2.5 90 1.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.5 96 0.5 97 0.5 98 0.5 99 0.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.17500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.29664541169947 81.425 2 8.927086221236484 16.1 3 0.6653728860548933 1.7999999999999998 4 0.02772387025228722 0.1 5 0.02772387025228722 0.125 6 0.0 0.0 7 0.0 0.0 8 0.02772387025228722 0.2 9 0.0 0.0 >10 0.02772387025228722 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 8 0.2 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.45 0.0 0.0 0.0 0.0 104-105 1.6125 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.2875 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 3.05 0.0 0.0 0.0 0.0 116-117 3.475 0.0 0.0 0.0 0.0 118-119 4.05 0.0 0.0 0.0 0.0 120-121 4.4 0.0 0.0 0.0 0.0 122-123 4.8375 0.0 0.0 0.0 0.0 124-125 5.2125 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 6.0375 0.0 0.0 0.0 0.0 130-131 6.512499999999999 0.0 0.0 0.0 0.0 132-133 6.8125 0.0 0.0 0.0 0.0 134-135 7.1 0.0 0.0 0.0 0.0 136-137 7.8125 0.0 0.0 0.0 0.0 138-139 8.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTCGC 10 0.006830828 145.0 6 CTCGCTT 10 0.006830828 145.0 8 >>END_MODULE Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022881 spots for SRR7814846.sra Written 3022881 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra Read 3022876 spots for SRR7814846.sra Written 3022876 spots for SRR7814846.sra SRR ids: ['SRR7814846.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_66dpxhjt SRR7814846.sra spots: 60457525 blocks: [[1, 3022876], [3022877, 6045752], [6045753, 9068628], [9068629, 12091504], [12091505, 15114380], [15114381, 18137256], [18137257, 21160132], [21160133, 24183008], [24183009, 27205884], [27205885, 30228760], [30228761, 33251636], [33251637, 36274512], [36274513, 39297388], [39297389, 42320264], [42320265, 45343140], [45343141, 48366016], [48366017, 51388892], [51388893, 54411768], [54411769, 57434644], [57434645, 60457525]] SRR7814846 file size 20465371 SRR7814846 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814846 SRR7814846_1.fastq SRR7814846_2.fastq Input file: SRR7814846_1.fastq Paired file: SRR7814846_2.fastq trimmed: SRR7814846-trimmed-pair1.fastq, SRR7814846-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:22:23 2024 >> started Fri Dec 6 12:23:31 2024 >> done (67.356s) 60457525 read pairs processed; of these: 393 ( 0.00%) short read pairs filtered out after trimming by size control 30538 ( 0.05%) empty read pairs filtered out after trimming by size control 60426594 (99.95%) read pairs available; of these: 6815736 (11.28%) trimmed read pairs available after processing 53610858 (88.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 24 0.00% 19 33 0.00% 20 35 0.00% 21 38 0.00% 22 50 0.00% 23 40 0.00% 24 51 0.00% 25 47 0.00% 26 45 0.00% 27 59 0.00% 28 80 0.00% 29 77 0.00% 30 89 0.00% 31 70 0.00% 32 89 0.00% 33 89 0.00% 34 99 0.00% 35 83 0.00% 36 113 0.00% 37 133 0.00% 38 111 0.00% 39 113 0.00% 40 128 0.00% 41 146 0.00% 42 173 0.00% 43 162 0.00% 44 162 0.00% 45 193 0.00% 46 216 0.00% 47 251 0.00% 48 283 0.00% 49 341 0.00% 50 353 0.00% 51 416 0.00% 52 437 0.00% 53 443 0.00% 54 463 0.00% 55 512 0.00% 56 606 0.00% 57 667 0.00% 58 810 0.00% 59 926 0.00% 60 1177 0.00% 61 1262 0.00% 62 1455 0.00% 63 1598 0.00% 64 1733 0.00% 65 1875 0.00% 66 2059 0.00% 67 2272 0.00% 68 2567 0.00% 69 3184 0.01% 70 3527 0.01% 71 4053 0.01% 72 4764 0.01% 73 5230 0.01% 74 5743 0.01% 75 6630 0.01% 76 7013 0.01% 77 7902 0.01% 78 8739 0.01% 79 9982 0.02% 80 11202 0.02% 81 12672 0.02% 82 14064 0.02% 83 15409 0.03% 84 16933 0.03% 85 18672 0.03% 86 19952 0.03% 87 21386 0.04% 88 23693 0.04% 89 25477 0.04% 90 27710 0.05% 91 30407 0.05% 92 33605 0.06% 93 35748 0.06% 94 38186 0.06% 95 40754 0.07% 96 42598 0.07% 97 45168 0.07% 98 46947 0.08% 99 49803 0.08% 100 52407 0.09% 101 55274 0.09% 102 58644 0.10% 103 62020 0.10% 104 64598 0.11% 105 66843 0.11% 106 70026 0.12% 107 71377 0.12% 108 73561 0.12% 109 76663 0.13% 110 79321 0.13% 111 82809 0.14% 112 87170 0.14% 113 89912 0.15% 114 93127 0.15% 115 95967 0.16% 116 97350 0.16% 117 99573 0.16% 118 101232 0.17% 119 103260 0.17% 120 107381 0.18% 121 110050 0.18% 122 112808 0.19% 123 117331 0.19% 124 119552 0.20% 125 123794 0.20% 126 125607 0.21% 127 127267 0.21% 128 128580 0.21% 129 131349 0.22% 130 132577 0.22% 131 134581 0.22% 132 140393 0.23% 133 143645 0.24% 134 145938 0.24% 135 149807 0.25% 136 152463 0.25% 137 151910 0.25% 138 154279 0.26% 139 157417 0.26% 140 158185 0.26% 141 161385 0.27% 142 164500 0.27% 143 168166 0.28% 144 174440 0.29% 145 176227 0.29% 146 177307 0.29% 147 179410 0.30% 148 181331 0.30% 149 180285 0.30% 150 184230 0.30% 151 53610858 88.72% 60426594 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=14 prefix-density=0.51 prefix-fanout=3.4 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=206.46 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=13.0 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=4.23 fanout-score-rank=16 prefix-density=0.47 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=22 fanout-score=141.10 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=20.8 sequence=GCCGCCGCCGCC SRR7814846 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:24:19 Started mapping on | Dec 06 12:24:20 Finished on | Dec 06 12:30:48 Mapping speed, Million of reads per hour | 560.66 Number of input reads | 60426594 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 55705719 Uniquely mapped reads % | 92.19% Average mapped length | 294.80 Number of splices: Total | 55484990 Number of splices: Annotated (sjdb) | 52316559 Number of splices: GT/AG | 54707318 Number of splices: GC/AG | 630616 Number of splices: AT/AC | 26070 Number of splices: Non-canonical | 120986 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.16 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1007334 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 88648 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.09% % of reads unmapped: other | 0.91% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3713541 3713541 3713541 N_multimapping 1007334 1007334 1007334 N_noFeature 1797615 54133905 2340820 N_ambiguous 1232926 9065 205812 UnstrandedReadsAssigned:52675178 PositiveStrandReadsAssigned:1562749 NegativeStrandReadsAssigned:53159087 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814846 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814846-trimmed-pair1.fastq SRR7814846-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 60,426,594 reads, 54,246,383 reads pseudoaligned [quant] estimated average fragment length: 257.73 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52973 SRR7814846.ke.tsv 35125 SRR7814846.se.tsv 88098 total ==> SRR7814846.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 679.931 0 0 PNS24247 1044 787.27 150.825 4.85509 PNS24249 1928 1671.27 472.776 7.16896 PNS24246 1044 787.27 150.825 4.85509 PNS24248 1044 787.27 150.825 4.85509 PNS24244 1471 1214.27 227.75 4.75325 PNS24243 293 95.6491 0 0 KQK14069 1603 1346.27 28901.4 544.046 KQK14071 474 238.649 820.547 87.1349 ==> SRR7814846.se.tsv <== BRADI_1g14170v3 32770 BRADI_1g53295v3 6181 BRADI_1g59795v3 449 BRADI_1g07683v3 0 BRADI_1g00485v3 155 BRADI_1g20270v3 9165 BRADI_1g74790v3 905 BRADI_1g09890v3 51 BRADI_1g77505v3 775 BRADI_1g48960v3 0 SRR7814846 completed mapping pipeline successfully