Starting /dee2/code/volunteer_pipeline.sh SRR7814847 current disk space = 1551373144064 free memory = 1602206612 SRR7814847 SRAfilesize f2967250fd35dd1df6edd4db6130cba2 SRR7814847.sra SRR7814847.sra file validated SRR7814847 is paired end SRR7814847 is conventional basespace SRR7814847 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814847_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3725 37.0 37.0 37.0 37.0 37.0 2 36.30125 37.0 37.0 37.0 37.0 37.0 3 36.3315 37.0 37.0 37.0 37.0 37.0 4 36.44 37.0 37.0 37.0 37.0 37.0 5 36.506 37.0 37.0 37.0 37.0 37.0 6 36.5125 37.0 37.0 37.0 37.0 37.0 7 36.358 37.0 37.0 37.0 37.0 37.0 8 36.4985 37.0 37.0 37.0 37.0 37.0 9 36.41 37.0 37.0 37.0 37.0 37.0 10-14 36.4631 37.0 37.0 37.0 37.0 37.0 15-19 36.4967 37.0 37.0 37.0 37.0 37.0 20-24 36.459199999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4416 37.0 37.0 37.0 37.0 37.0 30-34 36.3774 37.0 37.0 37.0 37.0 37.0 35-39 36.359500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.3472 37.0 37.0 37.0 37.0 37.0 45-49 36.2582 37.0 37.0 37.0 37.0 37.0 50-54 36.2244 37.0 37.0 37.0 37.0 37.0 55-59 36.1652 37.0 37.0 37.0 37.0 37.0 60-64 36.1647 37.0 37.0 37.0 37.0 37.0 65-69 36.098400000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.03830000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.1475 37.0 37.0 37.0 37.0 37.0 80-84 36.1164 37.0 37.0 37.0 37.0 37.0 85-89 36.063100000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.9518 37.0 37.0 37.0 37.0 37.0 95-99 35.8767 37.0 37.0 37.0 37.0 37.0 100-104 35.8242 37.0 37.0 37.0 37.0 37.0 105-109 35.8851 37.0 37.0 37.0 37.0 37.0 110-114 35.8504 37.0 37.0 37.0 37.0 37.0 115-119 35.704600000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.67380000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.5587 37.0 37.0 37.0 37.0 37.0 130-134 35.445299999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.3197 37.0 37.0 37.0 34.6 37.0 140-144 35.3566 37.0 37.0 37.0 34.6 37.0 145-149 35.0992 37.0 37.0 37.0 27.4 37.0 150-151 34.519000000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 4.0 26 8.0 27 12.0 28 16.0 29 34.0 30 39.0 31 59.0 32 81.0 33 121.0 34 183.0 35 380.0 36 2786.0 37 276.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.31963927855711 9.744488977955912 5.435871743486974 37.5 2 25.406351587896975 14.528632158039509 30.532633158289574 29.532383095773945 3 22.675 17.575 22.6 37.15 4 28.375 23.9 19.75 27.975 5 28.199999999999996 28.65 21.85 21.3 6 23.400000000000002 31.225 23.200000000000003 22.175 7 18.4 23.775 37.075 20.75 8 21.45 21.349999999999998 29.849999999999998 27.35 9 22.0 20.599999999999998 31.900000000000002 25.5 10-14 24.68 25.94 24.09 25.290000000000003 15-19 24.6 24.4 24.7 26.3 20-24 24.465 25.005 24.610000000000003 25.919999999999998 25-29 24.55 24.535 24.27 26.645000000000003 30-34 24.64 23.685000000000002 24.535 27.139999999999997 35-39 24.555 24.215 24.709999999999997 26.52 40-44 24.705 24.33 24.13 26.834999999999997 45-49 24.44 23.995 24.834999999999997 26.729999999999997 50-54 25.255 23.89 24.535 26.32 55-59 24.825 24.404999999999998 23.875 26.895000000000003 60-64 25.09 24.29 24.07 26.55 65-69 24.995 23.62 25.040000000000003 26.345000000000002 70-74 25.230000000000004 23.875 24.605 26.290000000000003 75-79 24.935 23.415 24.55 27.1 80-84 24.905 23.549999999999997 24.505 27.04 85-89 25.205 23.68 24.315 26.8 90-94 25.805 22.939999999999998 24.41 26.845000000000002 95-99 25.86 23.62 23.9 26.619999999999997 100-104 25.275 23.925 24.14 26.66 105-109 25.215 24.335 23.880000000000003 26.57 110-114 25.805 23.345 24.169999999999998 26.68 115-119 25.655 24.099999999999998 24.015 26.229999999999997 120-124 25.775 23.935000000000002 23.36 26.93 125-129 25.985000000000003 23.955000000000002 23.785 26.275 130-134 25.775 23.78 23.335 27.11 135-139 25.779999999999998 23.98 23.325000000000003 26.915 140-144 25.124999999999996 23.465 24.44 26.97 145-149 25.66 23.985 23.605 26.75 150-151 25.4375 23.5625 23.849999999999998 27.150000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 1.0 28 1.5 29 3.5 30 6.5 31 6.5 32 8.5 33 14.5 34 20.5 35 25.0 36 32.5 37 47.0 38 59.5 39 80.0 40 95.5 41 119.5 42 140.5 43 148.0 44 167.0 45 171.5 46 172.5 47 178.0 48 178.0 49 164.0 50 159.0 51 152.5 52 136.5 53 116.0 54 100.5 55 107.5 56 109.0 57 96.0 58 90.5 59 92.5 60 84.0 61 82.0 62 84.0 63 83.0 64 78.0 65 77.5 66 73.5 67 60.0 68 58.0 69 60.0 70 56.0 71 43.5 72 32.5 73 29.5 74 30.0 75 23.0 76 10.5 77 9.0 78 10.5 79 5.0 80 2.0 81 2.5 82 1.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.07376185458376 90.225 2 4.662802950474183 8.85 3 0.23709167544783985 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026343519494204423 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCTTGTTATCTCGTAT 10 0.25 TruSeq Adapter, Index 11 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.26249999999999996 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.1125 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.9249999999999998 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.4625 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.45 0.0 0.0 0.0 0.0 118-119 3.975 0.0 0.0 0.0 0.0 120-121 4.6 0.0 0.0 0.0 0.0 122-123 5.05 0.0 0.0 0.0 0.0 124-125 5.4875 0.0 0.0 0.0 0.0 126-127 5.9375 0.0 0.0 0.0 0.0 128-129 6.4625 0.0 0.0 0.0 0.0 130-131 6.9 0.0 0.0 0.0 0.0 132-133 7.3125 0.0 0.0 0.0 0.0 134-135 7.7375 0.0 0.0 0.0 0.0 136-137 8.125 0.0 0.0 0.0 0.0 138-139 8.587499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCATTT 10 0.006830828 145.0 2 CGATCTC 10 0.006830828 145.0 3 >>END_MODULE SRR7814847 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814847_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2245 37.0 37.0 37.0 37.0 37.0 2 35.784 37.0 37.0 37.0 37.0 37.0 3 35.9875 37.0 37.0 37.0 37.0 37.0 4 36.063 37.0 37.0 37.0 37.0 37.0 5 36.123 37.0 37.0 37.0 37.0 37.0 6 35.9955 37.0 37.0 37.0 37.0 37.0 7 35.921 37.0 37.0 37.0 37.0 37.0 8 36.167 37.0 37.0 37.0 37.0 37.0 9 36.1015 37.0 37.0 37.0 37.0 37.0 10-14 36.049499999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.010299999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.02210000000001 37.0 37.0 37.0 37.0 37.0 25-29 35.8906 37.0 37.0 37.0 37.0 37.0 30-34 35.8534 37.0 37.0 37.0 37.0 37.0 35-39 35.7998 37.0 37.0 37.0 37.0 37.0 40-44 35.7877 37.0 37.0 37.0 37.0 37.0 45-49 35.751 37.0 37.0 37.0 37.0 37.0 50-54 35.7281 37.0 37.0 37.0 37.0 37.0 55-59 35.7312 37.0 37.0 37.0 37.0 37.0 60-64 35.643299999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.540499999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.491 37.0 37.0 37.0 37.0 37.0 75-79 35.46169999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.3976 37.0 37.0 37.0 37.0 37.0 85-89 35.39149999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.325799999999994 37.0 37.0 37.0 34.6 37.0 95-99 35.2278 37.0 37.0 37.0 29.8 37.0 100-104 35.231100000000005 37.0 37.0 37.0 32.2 37.0 105-109 35.2254 37.0 37.0 37.0 32.2 37.0 110-114 34.944500000000005 37.0 37.0 37.0 25.0 37.0 115-119 34.9998 37.0 37.0 37.0 25.0 37.0 120-124 34.880700000000004 37.0 37.0 37.0 25.0 37.0 125-129 34.7712 37.0 37.0 37.0 25.0 37.0 130-134 34.570899999999995 37.0 37.0 37.0 25.0 37.0 135-139 34.335 37.0 37.0 37.0 25.0 37.0 140-144 34.162099999999995 37.0 37.0 37.0 25.0 37.0 145-149 34.0923 37.0 37.0 37.0 25.0 37.0 150-151 33.42125 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 4.0 15 4.0 16 2.0 17 3.0 18 2.0 19 4.0 20 3.0 21 5.0 22 12.0 23 5.0 24 14.0 25 11.0 26 21.0 27 19.0 28 24.0 29 30.0 30 37.0 31 72.0 32 89.0 33 135.0 34 328.0 35 842.0 36 2251.0 37 79.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.025 18.099999999999998 7.9 31.974999999999998 2 30.225 21.525 26.950000000000003 21.3 3 25.900000000000002 23.200000000000003 25.525 25.374999999999996 4 27.450000000000003 29.425 19.5 23.625 5 28.000000000000004 31.900000000000002 18.725 21.375 6 23.825 34.849999999999994 18.825 22.5 7 24.2 19.2 31.15 25.45 8 23.775 22.725 23.200000000000003 30.3 9 25.124999999999996 20.575 26.8 27.500000000000004 10-14 27.389999999999997 24.67 21.485000000000003 26.455000000000002 15-19 27.029999999999998 24.13 22.755 26.085 20-24 26.779999999999998 24.62 22.57 26.029999999999998 25-29 26.825 24.455 22.82 25.900000000000002 30-34 27.115000000000002 24.235 22.865 25.785000000000004 35-39 27.26 24.725 22.509999999999998 25.505 40-44 27.029999999999998 24.39 22.900000000000002 25.679999999999996 45-49 27.395000000000003 24.3 22.32 25.985000000000003 50-54 27.334999999999997 24.22 23.34 25.105 55-59 27.529999999999998 24.060000000000002 22.685 25.724999999999998 60-64 27.445000000000004 24.169999999999998 22.1 26.284999999999997 65-69 28.144999999999996 24.095 22.564999999999998 25.195 70-74 27.48 24.2 22.634999999999998 25.685000000000002 75-79 26.86 23.794999999999998 23.39 25.955000000000002 80-84 27.76 24.3 22.17 25.77 85-89 27.644999999999996 23.86 22.535 25.96 90-94 27.43 24.685000000000002 23.05 24.834999999999997 95-99 27.525 24.88 22.78 24.815 100-104 27.855 24.85 22.215 25.080000000000002 105-109 27.485 23.585 23.425 25.505 110-114 27.18 24.415 23.45 24.955 115-119 28.095 24.104999999999997 22.735 25.064999999999998 120-124 27.655 25.155 21.72 25.47 125-129 28.765 24.55 22.18 24.505 130-134 28.43 24.55 22.189999999999998 24.83 135-139 28.845 24.12 22.685 24.349999999999998 140-144 29.409999999999997 24.34 22.509999999999998 23.74 145-149 29.49 24.185000000000002 22.45 23.875 150-151 29.1375 23.7 23.0375 24.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 2.0 26 1.5 27 1.5 28 2.0 29 3.0 30 5.0 31 7.0 32 9.0 33 15.0 34 19.0 35 21.0 36 24.5 37 37.0 38 52.0 39 62.5 40 81.5 41 102.0 42 118.0 43 125.0 44 133.0 45 157.0 46 156.5 47 143.5 48 157.0 49 158.5 50 155.0 51 149.5 52 123.5 53 118.5 54 120.0 55 112.5 56 105.0 57 105.0 58 118.5 59 119.0 60 109.5 61 90.5 62 83.5 63 84.5 64 84.5 65 90.5 66 90.5 67 89.0 68 77.5 69 63.5 70 61.5 71 60.0 72 46.0 73 29.0 74 24.5 75 21.5 76 13.5 77 11.5 78 8.5 79 4.0 80 4.0 81 3.5 82 2.5 83 1.5 84 1.5 85 1.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.5 91 1.0 92 1.0 93 1.5 94 1.0 95 0.0 96 1.0 97 2.0 98 1.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.625 #Duplication Level Percentage of deduplicated Percentage of total 1 95.0330250990753 89.925 2 4.491413474240423 8.5 3 0.36988110964332893 1.05 4 0.0 0.0 5 0.07926023778071334 0.375 6 0.02642007926023778 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit GTTCTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit CCTTACCAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.26249999999999996 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.7375 0.0 0.0 0.0 0.0 108-109 1.9500000000000002 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.9875 0.0 0.0 0.0 0.0 116-117 3.425 0.0 0.0 0.0 0.0 118-119 3.975 0.0 0.0 0.0 0.0 120-121 4.5625 0.0 0.0 0.0 0.0 122-123 5.0 0.0 0.0 0.0 0.0 124-125 5.4625 0.0 0.0 0.0 0.0 126-127 5.9125 0.0 0.0 0.0 0.0 128-129 6.425 0.0 0.0 0.0 0.0 130-131 6.862500000000001 0.0 0.0 0.0 0.0 132-133 7.262499999999999 0.0 0.0 0.0 0.0 134-135 7.6875 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.462499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATGAC 10 0.006830828 145.0 5 TTTTTTT 20 0.00593511 29.0 140-144 >>END_MODULE Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215626 spots for SRR7814847.sra Written 2215626 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra Read 2215616 spots for SRR7814847.sra Written 2215616 spots for SRR7814847.sra SRR ids: ['SRR7814847.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wikacdbk SRR7814847.sra spots: 44312330 blocks: [[1, 2215616], [2215617, 4431232], [4431233, 6646848], [6646849, 8862464], [8862465, 11078080], [11078081, 13293696], [13293697, 15509312], [15509313, 17724928], [17724929, 19940544], [19940545, 22156160], [22156161, 24371776], [24371777, 26587392], [26587393, 28803008], [28803009, 31018624], [31018625, 33234240], [33234241, 35449856], [35449857, 37665472], [37665473, 39881088], [39881089, 42096704], [42096705, 44312330]] SRR7814847 file size 14994294 SRR7814847 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814847 SRR7814847_1.fastq SRR7814847_2.fastq Input file: SRR7814847_1.fastq Paired file: SRR7814847_2.fastq trimmed: SRR7814847-trimmed-pair1.fastq, SRR7814847-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:21:23 2024 >> started Fri Dec 6 12:22:44 2024 >> done (81.153s) 44312330 read pairs processed; of these: 350 ( 0.00%) short read pairs filtered out after trimming by size control 68902 ( 0.16%) empty read pairs filtered out after trimming by size control 44243078 (99.84%) read pairs available; of these: 5417137 (12.24%) trimmed read pairs available after processing 38825941 (87.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 28 0.00% 20 29 0.00% 21 27 0.00% 22 26 0.00% 23 42 0.00% 24 42 0.00% 25 38 0.00% 26 48 0.00% 27 44 0.00% 28 52 0.00% 29 52 0.00% 30 68 0.00% 31 58 0.00% 32 75 0.00% 33 73 0.00% 34 63 0.00% 35 86 0.00% 36 95 0.00% 37 86 0.00% 38 91 0.00% 39 108 0.00% 40 122 0.00% 41 134 0.00% 42 107 0.00% 43 138 0.00% 44 141 0.00% 45 143 0.00% 46 173 0.00% 47 155 0.00% 48 207 0.00% 49 209 0.00% 50 246 0.00% 51 270 0.00% 52 319 0.00% 53 344 0.00% 54 346 0.00% 55 323 0.00% 56 422 0.00% 57 447 0.00% 58 551 0.00% 59 577 0.00% 60 715 0.00% 61 811 0.00% 62 888 0.00% 63 1051 0.00% 64 1115 0.00% 65 1191 0.00% 66 1317 0.00% 67 1475 0.00% 68 1753 0.00% 69 1894 0.00% 70 2159 0.00% 71 2516 0.01% 72 2896 0.01% 73 3387 0.01% 74 3755 0.01% 75 4069 0.01% 76 4499 0.01% 77 5001 0.01% 78 5526 0.01% 79 6294 0.01% 80 7075 0.02% 81 7884 0.02% 82 9127 0.02% 83 10121 0.02% 84 11161 0.03% 85 12529 0.03% 86 13424 0.03% 87 14748 0.03% 88 15998 0.04% 89 17426 0.04% 90 19062 0.04% 91 20650 0.05% 92 22643 0.05% 93 24734 0.06% 94 26733 0.06% 95 28810 0.07% 96 30615 0.07% 97 32899 0.07% 98 34603 0.08% 99 36449 0.08% 100 39447 0.09% 101 41563 0.09% 102 43804 0.10% 103 46458 0.11% 104 48769 0.11% 105 51233 0.12% 106 53644 0.12% 107 55872 0.13% 108 57678 0.13% 109 60213 0.14% 110 62141 0.14% 111 64531 0.15% 112 67964 0.15% 113 70127 0.16% 114 73012 0.17% 115 75621 0.17% 116 77373 0.17% 117 79923 0.18% 118 82482 0.19% 119 83772 0.19% 120 86362 0.20% 121 88521 0.20% 122 90169 0.20% 123 93534 0.21% 124 96124 0.22% 125 99077 0.22% 126 101576 0.23% 127 103778 0.23% 128 104537 0.24% 129 107473 0.24% 130 109301 0.25% 131 111296 0.25% 132 113784 0.26% 133 116483 0.26% 134 118975 0.27% 135 121352 0.27% 136 123678 0.28% 137 123951 0.28% 138 125131 0.28% 139 129160 0.29% 140 130139 0.29% 141 132380 0.30% 142 136834 0.31% 143 136825 0.31% 144 140156 0.32% 145 143587 0.32% 146 144423 0.33% 147 147303 0.33% 148 148971 0.34% 149 149644 0.34% 150 151353 0.34% 151 38825941 87.76% 44243078 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=20 prefix-density=0.59 prefix-fanout=3.3 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=30.33 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.5 sequence=AATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTTGAGCTGACCCACTTGCGCA criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=17 prefix-density=0.54 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=81.19 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=6.3 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7814847 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:23:34 Started mapping on | Dec 06 12:23:34 Finished on | Dec 06 12:28:02 Mapping speed, Million of reads per hour | 594.31 Number of input reads | 44243078 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 41661811 Uniquely mapped reads % | 94.17% Average mapped length | 294.59 Number of splices: Total | 42624515 Number of splices: Annotated (sjdb) | 40237819 Number of splices: GT/AG | 42011458 Number of splices: GC/AG | 510596 Number of splices: AT/AC | 14154 Number of splices: Non-canonical | 88307 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.02% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 839456 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 67792 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.88% % of reads unmapped: other | 0.91% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1741811 1741811 1741811 N_multimapping 839456 839456 839456 N_noFeature 1500267 40331937 1908382 N_ambiguous 1085545 5426 165870 UnstrandedReadsAssigned:39075999 PositiveStrandReadsAssigned:1324448 NegativeStrandReadsAssigned:39587559 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814847 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814847-trimmed-pair1.fastq SRR7814847-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,243,078 reads, 40,044,794 reads pseudoaligned [quant] estimated average fragment length: 257.742 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR7814847.ke.tsv 35125 SRR7814847.se.tsv 88098 total ==> SRR7814847.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 679.834 0 0 PNS24247 1044 787.258 101.92 4.39001 PNS24249 1928 1671.26 168.715 3.42322 PNS24246 1044 787.258 101.92 4.39001 PNS24248 1044 787.258 101.92 4.39001 PNS24244 1471 1214.26 154.526 4.31533 PNS24243 293 97.7549 1 0.346885 KQK14069 1603 1346.26 3639.77 91.679 KQK14071 474 240.204 141.083 19.9167 ==> SRR7814847.se.tsv <== BRADI_1g14170v3 4549 BRADI_1g53295v3 1666 BRADI_1g59795v3 225 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 1172 BRADI_1g74790v3 454 BRADI_1g09890v3 0 BRADI_1g77505v3 564 BRADI_1g48960v3 0 SRR7814847 completed mapping pipeline successfully