Starting /dee2/code/volunteer_pipeline.sh SRR7814848 current disk space = 1550640717824 free memory = 1598567484 SRR7814848 SRAfilesize eb2ca5158936dfeee10bc93b7f5a674c SRR7814848.sra SRR7814848.sra file validated SRR7814848 is paired end SRR7814848 is conventional basespace SRR7814848 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814848_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.24825 37.0 37.0 37.0 37.0 37.0 2 36.21 37.0 37.0 37.0 37.0 37.0 3 36.355 37.0 37.0 37.0 37.0 37.0 4 36.4285 37.0 37.0 37.0 37.0 37.0 5 36.37 37.0 37.0 37.0 37.0 37.0 6 36.5415 37.0 37.0 37.0 37.0 37.0 7 36.3675 37.0 37.0 37.0 37.0 37.0 8 36.4125 37.0 37.0 37.0 37.0 37.0 9 36.4065 37.0 37.0 37.0 37.0 37.0 10-14 36.4593 37.0 37.0 37.0 37.0 37.0 15-19 36.4894 37.0 37.0 37.0 37.0 37.0 20-24 36.4183 37.0 37.0 37.0 37.0 37.0 25-29 36.36 37.0 37.0 37.0 37.0 37.0 30-34 36.3258 37.0 37.0 37.0 37.0 37.0 35-39 36.3035 37.0 37.0 37.0 37.0 37.0 40-44 36.29090000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.28060000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.1702 37.0 37.0 37.0 37.0 37.0 55-59 36.1903 37.0 37.0 37.0 37.0 37.0 60-64 36.1317 37.0 37.0 37.0 37.0 37.0 65-69 36.0569 37.0 37.0 37.0 37.0 37.0 70-74 36.0134 37.0 37.0 37.0 37.0 37.0 75-79 36.0144 37.0 37.0 37.0 37.0 37.0 80-84 35.9688 37.0 37.0 37.0 37.0 37.0 85-89 35.964000000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.875800000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.769000000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.7568 37.0 37.0 37.0 37.0 37.0 105-109 35.8053 37.0 37.0 37.0 37.0 37.0 110-114 35.763400000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.617399999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.5558 37.0 37.0 37.0 37.0 37.0 125-129 35.491499999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.4827 37.0 37.0 37.0 37.0 37.0 135-139 35.165099999999995 37.0 37.0 37.0 29.8 37.0 140-144 35.15429999999999 37.0 37.0 37.0 27.4 37.0 145-149 34.9921 37.0 37.0 37.0 27.4 37.0 150-151 34.196250000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 5.0 25 8.0 26 8.0 27 20.0 28 19.0 29 38.0 30 27.0 31 61.0 32 89.0 33 121.0 34 182.0 35 440.0 36 2719.0 37 262.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.12797992471769 11.166875784190715 4.466750313676286 30.238393977415306 2 28.58929464732366 11.830915457728866 30.71535767883942 28.864432216108053 3 23.175 19.075 22.5 35.25 4 29.849999999999998 23.875 20.125 26.150000000000002 5 28.975 28.65 21.0 21.375 6 24.175 31.3 20.9 23.625 7 20.599999999999998 21.475 37.15 20.775 8 21.875 21.4 28.475 28.249999999999996 9 21.875 20.674999999999997 30.3 27.150000000000002 10-14 25.75 24.665 23.93 25.655 15-19 25.635 24.085 24.01 26.27 20-24 25.775 23.9 24.355 25.97 25-29 25.674999999999997 23.544999999999998 24.23 26.55 30-34 25.34 23.880000000000003 23.835 26.945000000000004 35-39 25.585 23.400000000000002 24.759999999999998 26.255 40-44 26.35 23.645 23.44 26.565 45-49 25.585 24.055 23.47 26.889999999999997 50-54 25.595000000000002 22.93 24.26 27.215 55-59 26.064999999999998 22.770000000000003 23.265 27.900000000000002 60-64 26.1 23.48 23.255 27.165 65-69 26.095000000000002 23.395 23.655 26.855 70-74 26.200000000000003 23.43 23.02 27.35 75-79 26.125 22.68 24.310000000000002 26.884999999999998 80-84 26.515 23.21 23.465 26.810000000000002 85-89 27.015 23.494999999999997 23.03 26.46 90-94 26.314999999999998 23.68 22.945 27.060000000000002 95-99 26.77 22.645 23.71 26.875 100-104 26.484999999999996 23.369999999999997 23.215 26.93 105-109 27.16 23.395 23.13 26.314999999999998 110-114 26.174999999999997 23.26 23.66 26.905 115-119 26.58 23.315 23.419999999999998 26.685 120-124 26.305 22.93 23.325000000000003 27.439999999999998 125-129 26.795 23.325000000000003 23.03 26.85 130-134 26.875 22.825 23.32 26.979999999999997 135-139 26.040000000000003 23.630000000000003 22.79 27.54 140-144 26.939999999999998 23.26 22.64 27.16 145-149 26.979999999999997 23.275000000000002 22.37 27.375 150-151 26.575 23.6625 22.287499999999998 27.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 1.0 26 0.5 27 1.5 28 3.0 29 3.5 30 5.0 31 7.5 32 10.0 33 14.0 34 20.5 35 33.0 36 45.5 37 49.5 38 44.5 39 63.0 40 94.0 41 107.5 42 117.0 43 135.5 44 158.5 45 158.5 46 140.5 47 147.0 48 149.5 49 151.0 50 140.5 51 119.5 52 114.0 53 106.5 54 107.5 55 107.5 56 98.5 57 97.0 58 114.5 59 113.0 60 105.5 61 101.5 62 86.0 63 83.0 64 96.0 65 98.0 66 85.0 67 78.0 68 74.0 69 66.0 70 62.5 71 53.5 72 42.5 73 36.0 74 33.5 75 35.0 76 28.5 77 20.0 78 14.5 79 8.5 80 5.0 81 3.5 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.90899498812978 89.95 2 4.7217093115273014 8.95 3 0.3165391717225006 0.8999999999999999 4 0.052756528620416784 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.5750000000000002 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.3499999999999996 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.85 0.0 0.0 0.0 0.0 124-125 4.1625 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 4.775 0.0 0.0 0.0 0.0 130-131 5.3375 0.0 0.0 0.0 0.0 132-133 5.9125 0.0 0.0 0.0 0.0 134-135 6.625 0.0 0.0 0.0 0.0 136-137 7.225 0.0 0.0 0.0 0.0 138-139 7.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814848 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814848_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.32 37.0 37.0 37.0 37.0 37.0 2 36.0645 37.0 37.0 37.0 37.0 37.0 3 36.1305 37.0 37.0 37.0 37.0 37.0 4 36.1095 37.0 37.0 37.0 37.0 37.0 5 36.2425 37.0 37.0 37.0 37.0 37.0 6 36.1775 37.0 37.0 37.0 37.0 37.0 7 36.1655 37.0 37.0 37.0 37.0 37.0 8 36.2685 37.0 37.0 37.0 37.0 37.0 9 36.2145 37.0 37.0 37.0 37.0 37.0 10-14 36.148799999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.1712 37.0 37.0 37.0 37.0 37.0 20-24 36.1331 37.0 37.0 37.0 37.0 37.0 25-29 36.0935 37.0 37.0 37.0 37.0 37.0 30-34 36.067899999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.966899999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.970600000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.0055 37.0 37.0 37.0 37.0 37.0 50-54 35.924400000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.8566 37.0 37.0 37.0 37.0 37.0 60-64 35.7724 37.0 37.0 37.0 37.0 37.0 65-69 35.717200000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.7111 37.0 37.0 37.0 37.0 37.0 75-79 35.691100000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.6443 37.0 37.0 37.0 37.0 37.0 85-89 35.5209 37.0 37.0 37.0 37.0 37.0 90-94 35.4664 37.0 37.0 37.0 37.0 37.0 95-99 35.286 37.0 37.0 37.0 34.6 37.0 100-104 35.323600000000006 37.0 37.0 37.0 34.6 37.0 105-109 35.254599999999996 37.0 37.0 37.0 32.2 37.0 110-114 35.0859 37.0 37.0 37.0 27.4 37.0 115-119 34.9599 37.0 37.0 37.0 25.0 37.0 120-124 34.947500000000005 37.0 37.0 37.0 25.0 37.0 125-129 34.8489 37.0 37.0 37.0 25.0 37.0 130-134 34.7358 37.0 37.0 37.0 25.0 37.0 135-139 34.4225 37.0 37.0 37.0 25.0 37.0 140-144 34.3317 37.0 37.0 37.0 25.0 37.0 145-149 34.1627 37.0 37.0 37.0 25.0 37.0 150-151 33.42675 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 3.0 15 3.0 16 4.0 17 3.0 18 1.0 19 3.0 20 3.0 21 3.0 22 5.0 23 13.0 24 13.0 25 11.0 26 10.0 27 21.0 28 19.0 29 29.0 30 24.0 31 60.0 32 91.0 33 148.0 34 286.0 35 776.0 36 2353.0 37 114.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.725 18.224999999999998 5.775 29.275000000000002 2 30.775000000000002 21.125 24.9 23.200000000000003 3 25.6 22.925 25.3 26.174999999999997 4 27.925 29.349999999999998 17.75 24.975 5 27.825 33.4 17.275 21.5 6 24.725 33.775 17.05 24.45 7 23.7 18.95 31.65 25.7 8 23.150000000000002 22.7 22.325 31.825 9 25.275 20.7 25.3 28.725 10-14 26.82 24.695 21.154999999999998 27.33 15-19 26.52 24.115000000000002 21.884999999999998 27.48 20-24 26.790000000000003 23.985 21.965 27.26 25-29 26.779999999999998 23.84 21.69 27.689999999999998 30-34 26.619999999999997 24.03 22.28 27.07 35-39 26.735 23.995 22.189999999999998 27.08 40-44 26.919999999999998 23.75 22.259999999999998 27.07 45-49 27.42 23.775 21.61 27.195000000000004 50-54 26.950000000000003 23.630000000000003 22.34 27.08 55-59 27.045 23.395 22.085 27.474999999999998 60-64 26.91 23.380000000000003 21.89 27.82 65-69 26.840000000000003 23.505000000000003 22.05 27.605 70-74 26.72 22.84 22.835 27.605 75-79 26.284999999999997 22.805 22.09 28.82 80-84 26.99 22.75 22.495 27.765 85-89 27.189999999999998 22.830000000000002 22.03 27.950000000000003 90-94 27.295 22.830000000000002 22.220000000000002 27.655 95-99 27.015 23.93 22.06 26.995 100-104 27.76 23.625 21.465 27.150000000000002 105-109 27.200000000000003 23.16 21.945 27.694999999999997 110-114 27.98 23.799999999999997 21.735 26.484999999999996 115-119 27.22 23.674999999999997 22.005 27.1 120-124 28.22 23.3 22.045 26.435 125-129 28.275 23.175 22.02 26.529999999999998 130-134 28.625 23.549999999999997 22.31 25.515 135-139 28.384999999999998 23.435 22.165000000000003 26.015 140-144 29.525000000000002 23.98 21.285 25.21 145-149 28.494999999999997 24.515 21.34 25.650000000000002 150-151 29.25 24.4875 21.6875 24.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.5 13 1.5 14 1.0 15 1.0 16 1.0 17 1.0 18 0.5 19 0.5 20 1.5 21 1.0 22 2.0 23 2.5 24 0.5 25 2.0 26 2.5 27 1.0 28 1.0 29 2.5 30 4.0 31 5.5 32 7.0 33 10.0 34 11.5 35 23.5 36 30.5 37 34.5 38 45.5 39 61.0 40 70.5 41 80.5 42 108.0 43 126.5 44 126.0 45 124.5 46 127.5 47 124.5 48 132.0 49 138.0 50 120.5 51 107.5 52 103.5 53 98.5 54 108.0 55 114.5 56 115.5 57 112.5 58 120.5 59 130.0 60 126.5 61 125.5 62 117.0 63 117.0 64 107.5 65 102.5 66 107.0 67 95.5 68 82.0 69 77.5 70 70.5 71 58.5 72 60.0 73 52.0 74 37.5 75 28.5 76 20.0 77 15.0 78 13.5 79 10.0 80 4.5 81 3.0 82 3.5 83 2.0 84 0.5 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 1.0 91 1.0 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.5 98 0.5 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.35 #Duplication Level Percentage of deduplicated Percentage of total 1 94.59025174076058 88.3 2 4.472415640064274 8.35 3 0.6695232994108195 1.875 4 0.05356186395286556 0.2 5 0.10712372790573112 0.5 6 0.02678093197643278 0.15 7 0.02678093197643278 0.17500000000000002 8 0.0 0.0 9 0.05356186395286556 0.44999999999999996 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 9 0.22499999999999998 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 9 0.22499999999999998 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CACCACACAAGCAAGCAAGCAAGCTCTCAGCTCTCAGCAGCAATGGCGAC 5 0.125 No Hit GCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCGACCG 5 0.125 No Hit GTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCA 5 0.125 No Hit CAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.5750000000000002 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.3499999999999996 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 3.125 0.0 0.0 0.0 0.0 120-121 3.475 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.1375 0.0 0.0 0.0 0.0 126-127 4.449999999999999 0.0 0.0 0.0 0.0 128-129 4.75 0.0 0.0 0.0 0.0 130-131 5.275 0.0 0.0 0.0 0.0 132-133 5.8375 0.0 0.0 0.0 0.0 134-135 6.525 0.0 0.0 0.0 0.0 136-137 7.2 0.0 0.0 0.0 0.0 138-139 7.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTTCCC 10 0.006830828 145.0 7 GTTCCCG 10 0.006830828 145.0 8 CACTGTC 10 0.006830828 145.0 145 TTCCCGG 10 0.006830828 145.0 9 TCGTTCC 10 0.006830828 145.0 6 >>END_MODULE Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733068 spots for SRR7814848.sra Written 1733068 spots for SRR7814848.sra Read 1733070 spots for SRR7814848.sra Written 1733070 spots for SRR7814848.sra SRR ids: ['SRR7814848.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qc8ob034 SRR7814848.sra spots: 34661362 blocks: [[1, 1733068], [1733069, 3466136], [3466137, 5199204], [5199205, 6932272], [6932273, 8665340], [8665341, 10398408], [10398409, 12131476], [12131477, 13864544], [13864545, 15597612], [15597613, 17330680], [17330681, 19063748], [19063749, 20796816], [20796817, 22529884], [22529885, 24262952], [24262953, 25996020], [25996021, 27729088], [27729089, 29462156], [29462157, 31195224], [31195225, 32928292], [32928293, 34661362]] SRR7814848 file size 11723897 SRR7814848 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814848 SRR7814848_1.fastq SRR7814848_2.fastq Input file: SRR7814848_1.fastq Paired file: SRR7814848_2.fastq trimmed: SRR7814848-trimmed-pair1.fastq, SRR7814848-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:27:24 2024 >> started Fri Dec 6 12:28:16 2024 >> done (52.707s) 34661362 read pairs processed; of these: 257 ( 0.00%) short read pairs filtered out after trimming by size control 6270 ( 0.02%) empty read pairs filtered out after trimming by size control 34654835 (99.98%) read pairs available; of these: 4052151 (11.69%) trimmed read pairs available after processing 30602684 (88.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 22 0.00% 20 28 0.00% 21 23 0.00% 22 26 0.00% 23 30 0.00% 24 44 0.00% 25 45 0.00% 26 63 0.00% 27 40 0.00% 28 63 0.00% 29 70 0.00% 30 68 0.00% 31 44 0.00% 32 80 0.00% 33 73 0.00% 34 81 0.00% 35 81 0.00% 36 85 0.00% 37 71 0.00% 38 79 0.00% 39 87 0.00% 40 94 0.00% 41 109 0.00% 42 91 0.00% 43 91 0.00% 44 107 0.00% 45 133 0.00% 46 155 0.00% 47 112 0.00% 48 165 0.00% 49 170 0.00% 50 209 0.00% 51 233 0.00% 52 241 0.00% 53 201 0.00% 54 264 0.00% 55 294 0.00% 56 314 0.00% 57 346 0.00% 58 418 0.00% 59 439 0.00% 60 559 0.00% 61 584 0.00% 62 687 0.00% 63 714 0.00% 64 813 0.00% 65 858 0.00% 66 955 0.00% 67 1074 0.00% 68 1196 0.00% 69 1459 0.00% 70 1623 0.00% 71 1747 0.01% 72 2128 0.01% 73 2362 0.01% 74 2601 0.01% 75 3022 0.01% 76 3138 0.01% 77 3551 0.01% 78 4090 0.01% 79 4542 0.01% 80 5130 0.01% 81 5847 0.02% 82 6568 0.02% 83 7063 0.02% 84 7817 0.02% 85 8723 0.03% 86 9407 0.03% 87 10315 0.03% 88 11373 0.03% 89 12516 0.04% 90 13445 0.04% 91 14982 0.04% 92 16333 0.05% 93 17648 0.05% 94 19278 0.06% 95 20572 0.06% 96 21808 0.06% 97 23432 0.07% 98 24441 0.07% 99 26281 0.08% 100 28257 0.08% 101 29833 0.09% 102 31874 0.09% 103 33705 0.10% 104 35868 0.10% 105 36541 0.11% 106 39241 0.11% 107 39944 0.12% 108 41419 0.12% 109 44048 0.13% 110 45298 0.13% 111 47719 0.14% 112 49993 0.14% 113 52703 0.15% 114 54646 0.16% 115 56450 0.16% 116 57345 0.17% 117 59695 0.17% 118 60604 0.17% 119 61801 0.18% 120 64459 0.19% 121 65576 0.19% 122 66832 0.19% 123 70685 0.20% 124 72773 0.21% 125 74903 0.22% 126 76472 0.22% 127 77438 0.22% 128 78753 0.23% 129 81136 0.23% 130 81728 0.24% 131 83726 0.24% 132 86410 0.25% 133 88497 0.26% 134 90588 0.26% 135 93265 0.27% 136 93378 0.27% 137 93771 0.27% 138 95240 0.27% 139 97453 0.28% 140 97569 0.28% 141 100262 0.29% 142 103038 0.30% 143 104660 0.30% 144 108294 0.31% 145 109455 0.32% 146 110397 0.32% 147 113459 0.33% 148 112625 0.32% 149 112352 0.32% 150 113880 0.33% 151 30602684 88.31% 34654835 reads passed initial QC criterion=sequence-density sequence-density=1.07 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=23 prefix-density=1.13 prefix-fanout=2.6 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCATCATAGTACCCAGGGGAGCTGTTGTGCTCGCGGAAGACGAAGCCGACCTTGCTGAACTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=12.22 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=1.7 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=22 prefix-density=0.90 prefix-fanout=2.6 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCGGGCAGCCCGTGGTACGGCTCCGACCGCGTGTTGTACCTCGGCCCGCTCTCCGGCGAACCCCCGAGCTACCTGACCGGTGAGTTCCCCGGCGATTACGGGTGGGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=85.90 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=2.3 sequence=CAACAACCACAAAGCAATTAAGCAAAAGCAATGGCCTCCCAGCTCTCCGCCATGGCCTCCGTGCCGCAGTTCCACGGCCTCCGGAGCTACTCGGCGCCGAGGTCATCCATGGCGATGCTGCCAACGCTTAGAGCGTCCAGGAAGAGGTCCCAGGGCATCCGGTGCGACTTCATCGGCTCCTCCACCAACCTCATCATGGTGACGACGACGA SRR7814848 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:29:03 Started mapping on | Dec 06 12:29:03 Finished on | Dec 06 12:34:20 Mapping speed, Million of reads per hour | 393.56 Number of input reads | 34654835 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 32136019 Uniquely mapped reads % | 92.73% Average mapped length | 294.89 Number of splices: Total | 31669018 Number of splices: Annotated (sjdb) | 30034748 Number of splices: GT/AG | 31210446 Number of splices: GC/AG | 385220 Number of splices: AT/AC | 9438 Number of splices: Non-canonical | 63914 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.02% Deletion average length | 3.02 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 470785 % of reads mapped to multiple loci | 1.36% Number of reads mapped to too many loci | 42657 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.04% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2048031 2048031 2048031 N_multimapping 470785 470785 470785 N_noFeature 961967 31138746 1201161 N_ambiguous 947369 4111 189588 UnstrandedReadsAssigned:30226683 PositiveStrandReadsAssigned:993162 NegativeStrandReadsAssigned:30745270 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814848 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814848-trimmed-pair1.fastq SRR7814848-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,654,835 reads, 31,027,236 reads pseudoaligned [quant] estimated average fragment length: 260.476 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 SRR7814848.ke.tsv 35125 SRR7814848.se.tsv 88098 total ==> SRR7814848.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 677.091 0 0 PNS24247 1044 784.524 44.7537 2.32352 PNS24249 1928 1668.52 120.848 2.95006 PNS24246 1044 784.524 44.7537 2.32352 PNS24248 1044 784.524 44.7537 2.32352 PNS24244 1471 1211.52 58.8905 1.97987 PNS24243 293 97.4212 0 0 KQK14069 1603 1343.52 372.085 11.2803 KQK14071 474 237.584 4.71365 0.808097 ==> SRR7814848.se.tsv <== BRADI_1g14170v3 389 BRADI_1g53295v3 1137 BRADI_1g59795v3 263 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 704 BRADI_1g74790v3 275 BRADI_1g09890v3 0 BRADI_1g77505v3 407 BRADI_1g48960v3 0 SRR7814848 completed mapping pipeline successfully