Starting /dee2/code/volunteer_pipeline.sh SRR7814849 current disk space = 1551068307456 free memory = 1599018648 SRR7814849 SRAfilesize 248840bda6a0cee77ff02fe36e8778ec SRR7814849.sra SRR7814849.sra file validated SRR7814849 is paired end SRR7814849 is conventional basespace SRR7814849 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814849_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46925 37.0 37.0 37.0 37.0 37.0 2 36.488 37.0 37.0 37.0 37.0 37.0 3 36.542 37.0 37.0 37.0 37.0 37.0 4 36.55 37.0 37.0 37.0 37.0 37.0 5 36.5625 37.0 37.0 37.0 37.0 37.0 6 36.52 37.0 37.0 37.0 37.0 37.0 7 36.4765 37.0 37.0 37.0 37.0 37.0 8 36.566 37.0 37.0 37.0 37.0 37.0 9 36.6125 37.0 37.0 37.0 37.0 37.0 10-14 36.604699999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.535900000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5168 37.0 37.0 37.0 37.0 37.0 25-29 36.5048 37.0 37.0 37.0 37.0 37.0 30-34 36.3072 37.0 37.0 37.0 37.0 37.0 35-39 36.291 37.0 37.0 37.0 37.0 37.0 40-44 36.197500000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.3326 37.0 37.0 37.0 37.0 37.0 50-54 36.3609 37.0 37.0 37.0 37.0 37.0 55-59 36.271100000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.2653 37.0 37.0 37.0 37.0 37.0 65-69 36.1906 37.0 37.0 37.0 37.0 37.0 70-74 36.121 37.0 37.0 37.0 37.0 37.0 75-79 36.0984 37.0 37.0 37.0 37.0 37.0 80-84 36.076699999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.0996 37.0 37.0 37.0 37.0 37.0 90-94 36.01370000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.728300000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.4089 37.0 37.0 37.0 34.6 37.0 105-109 35.5998 37.0 37.0 37.0 37.0 37.0 110-114 35.702099999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.52850000000001 37.0 37.0 37.0 37.0 37.0 120-124 34.897000000000006 37.0 37.0 37.0 25.0 37.0 125-129 34.6556 37.0 37.0 37.0 25.0 37.0 130-134 35.208800000000004 37.0 37.0 37.0 29.8 37.0 135-139 35.0016 37.0 37.0 37.0 25.0 37.0 140-144 35.0994 37.0 37.0 37.0 27.4 37.0 145-149 35.0829 37.0 37.0 37.0 27.4 37.0 150-151 34.333749999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 2.0 26 5.0 27 14.0 28 19.0 29 31.0 30 27.0 31 47.0 32 82.0 33 143.0 34 257.0 35 562.0 36 2599.0 37 210.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 50.03752814610958 12.284213159869903 4.978734050537904 32.69952464348261 2 26.174999999999997 13.200000000000001 31.624999999999996 28.999999999999996 3 21.9 19.75 24.2 34.150000000000006 4 29.075 24.9 20.424999999999997 25.6 5 26.900000000000002 30.125 20.775 22.2 6 21.25 33.825 22.925 22.0 7 18.175 22.725 38.2 20.9 8 20.275000000000002 23.575 29.099999999999998 27.05 9 20.05 20.599999999999998 32.425 26.924999999999997 10-14 23.665 26.33 24.12 25.885 15-19 23.565 25.319999999999997 25.06 26.055 20-24 23.674999999999997 25.21 24.85 26.265 25-29 24.195 25.27 24.435000000000002 26.1 30-34 23.555 25.2 24.55 26.695 35-39 23.825 24.785 25.055 26.334999999999997 40-44 24.240000000000002 24.62 25.074999999999996 26.064999999999998 45-49 24.22 24.36 24.740000000000002 26.68 50-54 24.165 25.155 24.55 26.13 55-59 23.315 24.97 25.285000000000004 26.43 60-64 24.075 25.255 24.645 26.025 65-69 23.830000000000002 25.47 25.035 25.665 70-74 24.654999999999998 24.935 23.880000000000003 26.529999999999998 75-79 24.3 24.665 24.8 26.235000000000003 80-84 23.935000000000002 24.68 25.09 26.295 85-89 24.675 24.69 24.29 26.345000000000002 90-94 24.555 24.73 24.51 26.205000000000002 95-99 24.205 24.32 25.03 26.445 100-104 25.074999999999996 24.45 24.65 25.825 105-109 25.3 25.05 23.655 25.995 110-114 25.105 25.374999999999996 23.94 25.580000000000002 115-119 25.055 24.955 23.64 26.35 120-124 25.430000000000003 24.135 24.279999999999998 26.155 125-129 24.474999999999998 25.380000000000003 24.13 26.015 130-134 25.205 24.565 24.235 25.995 135-139 24.865000000000002 24.4 24.235 26.5 140-144 24.92 24.785 23.505000000000003 26.790000000000003 145-149 25.445 24.505 23.630000000000003 26.419999999999998 150-151 25.2125 24.05 24.15 26.5875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.5 28 3.0 29 2.5 30 6.5 31 10.0 32 8.0 33 14.0 34 22.0 35 28.5 36 43.5 37 60.5 38 75.5 39 106.5 40 128.5 41 140.0 42 152.5 43 165.0 44 191.5 45 196.0 46 173.5 47 167.0 48 180.5 49 181.5 50 170.0 51 153.5 52 138.5 53 120.5 54 109.5 55 103.0 56 95.0 57 91.0 58 74.5 59 72.0 60 69.5 61 55.0 62 66.5 63 68.5 64 56.5 65 59.0 66 54.5 67 53.0 68 55.5 69 52.0 70 41.0 71 22.5 72 21.5 73 25.5 74 25.0 75 24.0 76 17.0 77 12.0 78 8.5 79 5.5 80 5.0 81 6.5 82 3.5 83 2.0 84 2.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.725 #Duplication Level Percentage of deduplicated Percentage of total 1 90.16439119531903 80.9 2 8.609640568403455 15.45 3 1.0309278350515463 2.775 4 0.13931457230426303 0.5 5 0.02786291446085261 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02786291446085261 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTCAGTTATCTCGTAT 10 0.25 TruSeq Adapter, Index 23 (97% over 37bp) GTAGAATGCTAGTTCAGCAGGCATAGCTTTTACGTATACAGTAACATGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0125 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.0625 0.0 0.0 0.025 0.0 78-79 0.075 0.0 0.0 0.025 0.0 80-81 0.0875 0.0 0.0 0.025 0.0 82-83 0.125 0.0 0.0 0.025 0.0 84-85 0.2375 0.0 0.0 0.025 0.0 86-87 0.25 0.0 0.0 0.025 0.0 88-89 0.275 0.0 0.0 0.025 0.0 90-91 0.325 0.0 0.0 0.025 0.0 92-93 0.5125 0.0 0.0 0.025 0.0 94-95 0.6125 0.0 0.0 0.025 0.0 96-97 0.75 0.0 0.0 0.025 0.0 98-99 0.95 0.0 0.0 0.025 0.0 100-101 0.9875 0.0 0.0 0.025 0.0 102-103 1.15 0.0 0.0 0.025 0.0 104-105 1.3 0.0 0.0 0.025 0.0 106-107 1.5 0.0 0.0 0.025 0.0 108-109 1.7374999999999998 0.0 0.0 0.025 0.0 110-111 2.025 0.0 0.0 0.025 0.0 112-113 2.2249999999999996 0.0 0.0 0.025 0.0 114-115 2.6125 0.0 0.0 0.025 0.0 116-117 2.875 0.0 0.0 0.025 0.0 118-119 3.25 0.0 0.0 0.025 0.0 120-121 3.6500000000000004 0.0 0.0 0.025 0.0 122-123 4.0625 0.0 0.0 0.025 0.0 124-125 4.525 0.0 0.0 0.025 0.0 126-127 5.025 0.0 0.0 0.025 0.0 128-129 5.475 0.0 0.0 0.025 0.0 130-131 5.85 0.0 0.0 0.025 0.0 132-133 6.15 0.0 0.0 0.025 0.0 134-135 6.575 0.0 0.0 0.025 0.0 136-137 7.025 0.0 0.0 0.025 0.0 138-139 7.550000000000001 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814849 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814849_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8435 37.0 37.0 37.0 37.0 37.0 2 35.5115 37.0 37.0 37.0 37.0 37.0 3 35.535 37.0 37.0 37.0 37.0 37.0 4 35.5305 37.0 37.0 37.0 37.0 37.0 5 35.5765 37.0 37.0 37.0 37.0 37.0 6 35.3915 37.0 37.0 37.0 37.0 37.0 7 35.2265 37.0 37.0 37.0 37.0 37.0 8 35.4295 37.0 37.0 37.0 37.0 37.0 9 35.6165 37.0 37.0 37.0 37.0 37.0 10-14 35.5634 37.0 37.0 37.0 37.0 37.0 15-19 35.13000000000001 37.0 37.0 37.0 29.8 37.0 20-24 35.3406 37.0 37.0 37.0 32.2 37.0 25-29 35.2438 37.0 37.0 37.0 32.2 37.0 30-34 34.96079999999999 37.0 37.0 37.0 25.0 37.0 35-39 34.9944 37.0 37.0 37.0 27.4 37.0 40-44 34.643800000000006 37.0 37.0 37.0 25.0 37.0 45-49 34.6611 37.0 37.0 37.0 25.0 37.0 50-54 33.9812 37.0 37.0 37.0 25.0 37.0 55-59 33.8979 37.0 37.0 37.0 25.0 37.0 60-64 34.2645 37.0 37.0 37.0 25.0 37.0 65-69 34.202 37.0 37.0 37.0 25.0 37.0 70-74 33.7136 37.0 37.0 37.0 25.0 37.0 75-79 33.5906 37.0 37.0 37.0 22.2 37.0 80-84 33.529399999999995 37.0 37.0 37.0 22.2 37.0 85-89 33.9012 37.0 37.0 37.0 22.2 37.0 90-94 33.5104 37.0 37.0 37.0 22.2 37.0 95-99 32.5118 37.0 37.0 37.0 11.0 37.0 100-104 32.973 37.0 37.0 37.0 11.0 37.0 105-109 32.421299999999995 37.0 34.6 37.0 11.0 37.0 110-114 32.91760000000001 37.0 37.0 37.0 13.8 37.0 115-119 32.95029999999999 37.0 37.0 37.0 16.6 37.0 120-124 32.1779 37.0 32.2 37.0 11.0 37.0 125-129 32.393899999999995 37.0 34.6 37.0 11.0 37.0 130-134 31.818900000000003 37.0 27.4 37.0 11.0 37.0 135-139 31.815199999999997 37.0 29.8 37.0 11.0 37.0 140-144 32.0603 37.0 29.8 37.0 11.0 37.0 145-149 31.682799999999997 37.0 27.4 37.0 11.0 37.0 150-151 31.1265 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 2.0 16 5.0 17 5.0 18 7.0 19 0.0 20 5.0 21 11.0 22 18.0 23 47.0 24 51.0 25 84.0 26 92.0 27 104.0 28 102.0 29 142.0 30 128.0 31 156.0 32 182.0 33 235.0 34 380.0 35 794.0 36 1417.0 37 30.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.85 18.125 6.950000000000001 30.075000000000003 2 29.025000000000002 22.875 27.425 20.674999999999997 3 24.0 24.099999999999998 27.650000000000002 24.25 4 27.55 30.025000000000002 20.1 22.325 5 28.225 32.95 17.825 21.0 6 23.425 33.900000000000006 20.325 22.35 7 21.725 19.375 33.675 25.224999999999998 8 23.474999999999998 23.1 23.525 29.9 9 24.55 21.425 25.724999999999998 28.299999999999997 10-14 26.674999999999997 25.46 22.765 25.1 15-19 25.485000000000003 25.929999999999996 23.0 25.585 20-24 25.624999999999996 25.8 23.44 25.135 25-29 26.125 24.82 23.494999999999997 25.56 30-34 25.785000000000004 25.365 23.605 25.245 35-39 25.095 25.715 23.71 25.480000000000004 40-44 25.629999999999995 25.105 23.435 25.83 45-49 25.965 24.68 24.505 24.85 50-54 26.165 25.515 24.03 24.29 55-59 26.700000000000003 25.55 23.425 24.325 60-64 26.365 25.064999999999998 23.47 25.1 65-69 25.89 25.52 24.135 24.455 70-74 25.96 25.865 23.655 24.52 75-79 25.715 25.365 23.785 25.135 80-84 26.055 26.25 23.599999999999998 24.095 85-89 26.179999999999996 25.779999999999998 23.22 24.82 90-94 26.340000000000003 25.740000000000002 23.419999999999998 24.5 95-99 25.825 26.939999999999998 23.525 23.71 100-104 26.43 25.985000000000003 23.43 24.154999999999998 105-109 25.77 26.305 24.16 23.765 110-114 26.36 26.045 23.755000000000003 23.84 115-119 26.884999999999998 26.035000000000004 22.939999999999998 24.14 120-124 26.595000000000002 26.795 23.415 23.195 125-129 25.7 27.125 23.425 23.75 130-134 26.43 27.1 23.335 23.135 135-139 26.740000000000002 27.52 23.025000000000002 22.715 140-144 27.16 26.810000000000002 23.39 22.64 145-149 27.125 27.229999999999997 22.745 22.900000000000002 150-151 27.325 26.737499999999997 23.2875 22.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 1.0 14 1.5 15 1.0 16 1.5 17 1.0 18 0.0 19 0.5 20 2.0 21 1.5 22 0.5 23 0.5 24 2.0 25 3.0 26 4.0 27 5.5 28 6.0 29 10.5 30 10.5 31 10.0 32 15.5 33 12.5 34 23.5 35 36.0 36 43.0 37 68.5 38 78.5 39 82.0 40 100.5 41 126.5 42 145.5 43 155.5 44 166.5 45 181.0 46 185.0 47 170.5 48 167.0 49 161.5 50 139.0 51 133.0 52 124.0 53 112.5 54 115.0 55 109.5 56 109.0 57 103.5 58 81.0 59 74.5 60 76.0 61 64.5 62 67.0 63 77.5 64 63.5 65 57.5 66 65.0 67 62.5 68 56.0 69 44.0 70 40.5 71 42.5 72 39.5 73 35.0 74 27.5 75 19.5 76 14.5 77 10.5 78 8.5 79 8.5 80 6.0 81 2.0 82 2.5 83 4.5 84 2.5 85 0.5 86 1.0 87 1.0 88 2.0 89 2.5 90 2.0 91 1.0 92 0.0 93 1.0 94 1.0 95 0.0 96 0.5 97 1.0 98 1.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.68952276467361 83.575 2 7.185957213384531 13.100000000000001 3 0.9599561162918266 2.625 4 0.10970927043335163 0.4 5 0.0 0.0 6 0.054854635216675815 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCCGTTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 6 0.15 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.9125000000000001 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.6875 0.0 0.0 0.0 0.0 124-125 4.1 0.0 0.0 0.0 0.0 126-127 4.45 0.0 0.0 0.0 0.0 128-129 4.7875 0.0 0.0 0.0 0.0 130-131 5.112500000000001 0.0 0.0 0.0 0.0 132-133 5.362500000000001 0.0 0.0 0.0 0.0 134-135 5.775 0.0 0.0 0.0 0.0 136-137 6.125 0.0 0.0 0.0 0.0 138-139 6.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564787 spots for SRR7814849.sra Written 1564787 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra Read 1564781 spots for SRR7814849.sra Written 1564781 spots for SRR7814849.sra SRR ids: ['SRR7814849.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qi5ih9s_ SRR7814849.sra spots: 31295626 blocks: [[1, 1564781], [1564782, 3129562], [3129563, 4694343], [4694344, 6259124], [6259125, 7823905], [7823906, 9388686], [9388687, 10953467], [10953468, 12518248], [12518249, 14083029], [14083030, 15647810], [15647811, 17212591], [17212592, 18777372], [18777373, 20342153], [20342154, 21906934], [21906935, 23471715], [23471716, 25036496], [25036497, 26601277], [26601278, 28166058], [28166059, 29730839], [29730840, 31295626]] SRR7814849 file size 10583360 SRR7814849 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814849 SRR7814849_1.fastq SRR7814849_2.fastq Input file: SRR7814849_1.fastq Paired file: SRR7814849_2.fastq trimmed: SRR7814849-trimmed-pair1.fastq, SRR7814849-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:29:20 2024 >> started Fri Dec 6 12:29:55 2024 >> done (35.268s) 31295626 read pairs processed; of these: 276 ( 0.00%) short read pairs filtered out after trimming by size control 77676 ( 0.25%) empty read pairs filtered out after trimming by size control 31217674 (99.75%) read pairs available; of these: 3327279 (10.66%) trimmed read pairs available after processing 27890395 (89.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 19 0.00% 20 17 0.00% 21 20 0.00% 22 26 0.00% 23 35 0.00% 24 33 0.00% 25 36 0.00% 26 42 0.00% 27 54 0.00% 28 53 0.00% 29 70 0.00% 30 70 0.00% 31 67 0.00% 32 73 0.00% 33 54 0.00% 34 67 0.00% 35 98 0.00% 36 80 0.00% 37 99 0.00% 38 88 0.00% 39 106 0.00% 40 102 0.00% 41 124 0.00% 42 148 0.00% 43 107 0.00% 44 128 0.00% 45 118 0.00% 46 127 0.00% 47 162 0.00% 48 162 0.00% 49 236 0.00% 50 206 0.00% 51 240 0.00% 52 277 0.00% 53 249 0.00% 54 289 0.00% 55 307 0.00% 56 316 0.00% 57 340 0.00% 58 380 0.00% 59 493 0.00% 60 520 0.00% 61 630 0.00% 62 653 0.00% 63 711 0.00% 64 666 0.00% 65 750 0.00% 66 864 0.00% 67 981 0.00% 68 1085 0.00% 69 1305 0.00% 70 1468 0.00% 71 1635 0.01% 72 1824 0.01% 73 2146 0.01% 74 2328 0.01% 75 2547 0.01% 76 2741 0.01% 77 3142 0.01% 78 3448 0.01% 79 4028 0.01% 80 4381 0.01% 81 4867 0.02% 82 5502 0.02% 83 6179 0.02% 84 6909 0.02% 85 7597 0.02% 86 8174 0.03% 87 8959 0.03% 88 9741 0.03% 89 10607 0.03% 90 11611 0.04% 91 12881 0.04% 92 13988 0.04% 93 15366 0.05% 94 16423 0.05% 95 17781 0.06% 96 18752 0.06% 97 20444 0.07% 98 20869 0.07% 99 22242 0.07% 100 24100 0.08% 101 25565 0.08% 102 26951 0.09% 103 28523 0.09% 104 29894 0.10% 105 31598 0.10% 106 32664 0.10% 107 34109 0.11% 108 34807 0.11% 109 36909 0.12% 110 37687 0.12% 111 39358 0.13% 112 41559 0.13% 113 43274 0.14% 114 44182 0.14% 115 46500 0.15% 116 47546 0.15% 117 49198 0.16% 118 50079 0.16% 119 51113 0.16% 120 52368 0.17% 121 53958 0.17% 122 55112 0.18% 123 57365 0.18% 124 59363 0.19% 125 60893 0.20% 126 61829 0.20% 127 63133 0.20% 128 63752 0.20% 129 65286 0.21% 130 65996 0.21% 131 67449 0.22% 132 69394 0.22% 133 71607 0.23% 134 73369 0.24% 135 74604 0.24% 136 76094 0.24% 137 75781 0.24% 138 76828 0.25% 139 78808 0.25% 140 80002 0.26% 141 80833 0.26% 142 82755 0.27% 143 83919 0.27% 144 86587 0.28% 145 89074 0.29% 146 90674 0.29% 147 93446 0.30% 148 92429 0.30% 149 92503 0.30% 150 93971 0.30% 151 27890395 89.34% 31217674 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=31 prefix-density=0.42 prefix-fanout=2.1 sequence=GCAAGACATCTTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=108.16 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=17.0 sequence=GCAGCAGCAGCAATGGCGAGCGTGCCAAGAAGCAGGAGGAGGAG criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=30 prefix-density=0.85 prefix-fanout=2.2 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=693.47 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=22.6 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR7814849 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:30:46 Started mapping on | Dec 06 12:30:46 Finished on | Dec 06 12:36:22 Mapping speed, Million of reads per hour | 334.48 Number of input reads | 31217674 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 29025238 Uniquely mapped reads % | 92.98% Average mapped length | 294.77 Number of splices: Total | 27586301 Number of splices: Annotated (sjdb) | 25696964 Number of splices: GT/AG | 27180675 Number of splices: GC/AG | 315979 Number of splices: AT/AC | 19821 Number of splices: Non-canonical | 69826 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.03% Deletion average length | 3.28 Insertion rate per base | 0.03% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 471153 % of reads mapped to multiple loci | 1.51% Number of reads mapped to too many loci | 17113 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.12% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1721283 1721283 1721283 N_multimapping 471153 471153 471153 N_noFeature 968110 28044689 1421343 N_ambiguous 613224 3895 85515 UnstrandedReadsAssigned:27443904 PositiveStrandReadsAssigned:976654 NegativeStrandReadsAssigned:27518380 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814849 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814849-trimmed-pair1.fastq SRR7814849-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,217,674 reads, 28,063,167 reads pseudoaligned [quant] estimated average fragment length: 259.033 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52973 SRR7814849.ke.tsv 35125 SRR7814849.se.tsv 88098 total ==> SRR7814849.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.551 0 0 PNS24247 1044 785.967 103.478 6.58174 PNS24249 1928 1669.97 407.309 12.1931 PNS24246 1044 785.967 103.478 6.58174 PNS24248 1044 785.967 103.478 6.58174 PNS24244 1471 1212.97 118.256 4.87384 PNS24243 293 94.3196 1 0.530023 KQK14069 1603 1344.97 17557.9 652.617 KQK14071 474 234.962 142.898 30.4036 ==> SRR7814849.se.tsv <== BRADI_1g14170v3 18361 BRADI_1g53295v3 2802 BRADI_1g59795v3 140 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 711 BRADI_1g74790v3 302 BRADI_1g09890v3 1 BRADI_1g77505v3 611 BRADI_1g48960v3 1 SRR7814849 completed mapping pipeline successfully