Starting /dee2/code/volunteer_pipeline.sh SRR7814850 current disk space = 1551213842432 free memory = 1601350396 SRR7814850 SRAfilesize 1e9d27991c92151d4270a8fa54b075ef SRR7814850.sra SRR7814850.sra file validated SRR7814850 is paired end SRR7814850 is conventional basespace SRR7814850 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814850_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4245 37.0 37.0 37.0 37.0 37.0 2 36.3675 37.0 37.0 37.0 37.0 37.0 3 36.5255 37.0 37.0 37.0 37.0 37.0 4 36.567 37.0 37.0 37.0 37.0 37.0 5 36.5705 37.0 37.0 37.0 37.0 37.0 6 36.4995 37.0 37.0 37.0 37.0 37.0 7 36.4935 37.0 37.0 37.0 37.0 37.0 8 36.6005 37.0 37.0 37.0 37.0 37.0 9 36.4595 37.0 37.0 37.0 37.0 37.0 10-14 36.5772 37.0 37.0 37.0 37.0 37.0 15-19 36.534800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.557500000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.468 37.0 37.0 37.0 37.0 37.0 30-34 36.3936 37.0 37.0 37.0 37.0 37.0 35-39 36.4289 37.0 37.0 37.0 37.0 37.0 40-44 36.401599999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.3785 37.0 37.0 37.0 37.0 37.0 50-54 36.3662 37.0 37.0 37.0 37.0 37.0 55-59 36.3316 37.0 37.0 37.0 37.0 37.0 60-64 36.338100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.287400000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3271 37.0 37.0 37.0 37.0 37.0 75-79 36.259699999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.2114 37.0 37.0 37.0 37.0 37.0 85-89 36.2335 37.0 37.0 37.0 37.0 37.0 90-94 36.2312 37.0 37.0 37.0 37.0 37.0 95-99 36.260999999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.180400000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.1406 37.0 37.0 37.0 37.0 37.0 110-114 36.1485 37.0 37.0 37.0 37.0 37.0 115-119 36.0778 37.0 37.0 37.0 37.0 37.0 120-124 35.97189999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.959700000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.89280000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.9519 37.0 37.0 37.0 37.0 37.0 140-144 35.8071 37.0 37.0 37.0 37.0 37.0 145-149 35.8711 37.0 37.0 37.0 37.0 37.0 150-151 35.156 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 1.0 27 9.0 28 12.0 29 21.0 30 29.0 31 42.0 32 51.0 33 85.0 34 133.0 35 325.0 36 2827.0 37 463.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.85699949824385 11.364776718514802 6.472654290015052 37.305569493226294 2 26.025 14.299999999999999 30.225 29.45 3 23.200000000000003 17.625 22.375 36.8 4 27.450000000000003 25.874999999999996 20.9 25.775 5 27.200000000000003 29.625 21.775 21.4 6 23.575 31.724999999999998 21.575 23.125 7 19.15 22.925 38.074999999999996 19.85 8 21.2 21.775 29.425 27.6 9 22.225 21.3 30.675 25.8 10-14 24.185000000000002 25.345000000000002 23.895 26.575 15-19 24.255 24.625 24.43 26.69 20-24 24.52 25.180000000000003 23.715 26.584999999999997 25-29 25.009999999999998 24.115000000000002 24.335 26.540000000000003 30-34 24.3 24.705 24.58 26.415 35-39 24.855 23.955000000000002 24.64 26.55 40-44 25.575 24.21 23.925 26.290000000000003 45-49 24.490000000000002 24.755 23.59 27.165 50-54 24.67 24.27 24.08 26.979999999999997 55-59 25.285000000000004 24.19 24.07 26.455000000000002 60-64 25.135 24.085 23.91 26.87 65-69 24.665 24.22 24.47 26.645000000000003 70-74 25.240000000000002 24.015 23.76 26.985 75-79 25.19 23.71 23.98 27.12 80-84 25.264999999999997 23.76 23.849999999999998 27.125 85-89 25.135 23.755000000000003 24.13 26.979999999999997 90-94 25.185000000000002 24.0 23.95 26.865 95-99 25.81 23.745 23.465 26.979999999999997 100-104 25.2 24.69 23.325000000000003 26.784999999999997 105-109 25.580000000000002 24.38 23.645 26.395000000000003 110-114 25.16 24.445 23.605 26.790000000000003 115-119 25.955000000000002 24.044999999999998 24.055 25.945 120-124 25.6 24.16 23.11 27.13 125-129 25.46 24.395 23.27 26.875 130-134 26.08 24.495 23.07 26.355 135-139 25.745 24.740000000000002 23.435 26.08 140-144 25.785000000000004 24.065 22.95 27.200000000000003 145-149 25.990000000000002 24.075 22.88 27.055 150-151 26.85 23.9125 23.65 25.587500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.0 27 1.5 28 5.5 29 7.0 30 6.0 31 4.5 32 6.0 33 17.5 34 25.0 35 27.0 36 38.5 37 49.5 38 60.5 39 69.0 40 93.0 41 132.5 42 153.0 43 161.0 44 170.0 45 185.5 46 171.0 47 151.5 48 160.0 49 155.0 50 144.5 51 133.5 52 120.0 53 109.5 54 100.5 55 92.0 56 95.5 57 99.0 58 91.0 59 99.5 60 99.0 61 92.5 62 86.5 63 76.5 64 74.5 65 75.5 66 80.0 67 70.5 68 70.0 69 71.5 70 55.0 71 46.5 72 42.5 73 30.0 74 23.0 75 21.5 76 16.0 77 9.5 78 5.5 79 4.5 80 3.5 81 3.5 82 2.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.325 #Duplication Level Percentage of deduplicated Percentage of total 1 91.65069805639202 83.7 2 7.363810566657541 13.450000000000001 3 0.8486175745962223 2.325 4 0.10949904188338351 0.4 5 0.027374760470845878 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGGACAATCAATCAGGCACCAAACACCCGCAAACCACACTTTCACAAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.4874999999999998 0.0 0.0 0.0 0.0 108-109 1.7999999999999998 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.4 0.0 0.0 0.0 0.0 116-117 2.7249999999999996 0.0 0.0 0.0 0.0 118-119 2.9000000000000004 0.0 0.0 0.0 0.0 120-121 3.075 0.0 0.0 0.0 0.0 122-123 3.475 0.0 0.0 0.0 0.0 124-125 3.85 0.0 0.0 0.0 0.0 126-127 4.35 0.0 0.0 0.0 0.0 128-129 4.7875 0.0 0.0 0.0 0.0 130-131 5.275 0.0 0.0 0.0 0.0 132-133 5.737500000000001 0.0 0.0 0.0 0.0 134-135 6.2125 0.0 0.0 0.0 0.0 136-137 6.775 0.0 0.0 0.0 0.0 138-139 7.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATATT 10 0.006830828 145.0 7 TTGAAGT 10 0.006830828 145.0 6 >>END_MODULE SRR7814850 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814850_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2875 37.0 37.0 37.0 37.0 37.0 2 36.0815 37.0 37.0 37.0 37.0 37.0 3 36.0145 37.0 37.0 37.0 37.0 37.0 4 36.0365 37.0 37.0 37.0 37.0 37.0 5 36.1335 37.0 37.0 37.0 37.0 37.0 6 36.0655 37.0 37.0 37.0 37.0 37.0 7 36.012 37.0 37.0 37.0 37.0 37.0 8 36.1265 37.0 37.0 37.0 37.0 37.0 9 36.009 37.0 37.0 37.0 37.0 37.0 10-14 36.1038 37.0 37.0 37.0 37.0 37.0 15-19 36.0323 37.0 37.0 37.0 37.0 37.0 20-24 36.02760000000001 37.0 37.0 37.0 37.0 37.0 25-29 35.922399999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.9236 37.0 37.0 37.0 37.0 37.0 35-39 35.9164 37.0 37.0 37.0 37.0 37.0 40-44 35.922200000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.886300000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.892100000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.7807 37.0 37.0 37.0 37.0 37.0 60-64 35.79260000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.7626 37.0 37.0 37.0 37.0 37.0 70-74 35.7484 37.0 37.0 37.0 37.0 37.0 75-79 35.6956 37.0 37.0 37.0 37.0 37.0 80-84 35.6647 37.0 37.0 37.0 37.0 37.0 85-89 35.5733 37.0 37.0 37.0 37.0 37.0 90-94 35.5774 37.0 37.0 37.0 37.0 37.0 95-99 35.532399999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.541199999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.5833 37.0 37.0 37.0 37.0 37.0 110-114 35.4916 37.0 37.0 37.0 37.0 37.0 115-119 35.3082 37.0 37.0 37.0 37.0 37.0 120-124 35.31609999999999 37.0 37.0 37.0 34.6 37.0 125-129 35.2839 37.0 37.0 37.0 32.2 37.0 130-134 35.3074 37.0 37.0 37.0 34.6 37.0 135-139 35.096900000000005 37.0 37.0 37.0 29.8 37.0 140-144 34.900400000000005 37.0 37.0 37.0 25.0 37.0 145-149 34.8557 37.0 37.0 37.0 25.0 37.0 150-151 34.056250000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 1.0 15 4.0 16 2.0 17 4.0 18 3.0 19 3.0 20 2.0 21 6.0 22 7.0 23 9.0 24 7.0 25 13.0 26 14.0 27 12.0 28 16.0 29 23.0 30 29.0 31 56.0 32 87.0 33 130.0 34 253.0 35 629.0 36 2495.0 37 192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.5 17.2 8.55 30.75 2 31.525 21.55 25.025 21.9 3 24.375 23.674999999999997 27.224999999999998 24.725 4 27.825 28.65 19.05 24.474999999999998 5 29.275000000000002 30.975 18.2 21.55 6 25.05 33.825 18.4 22.725 7 22.875 17.45 33.95 25.724999999999998 8 23.549999999999997 22.725 21.875 31.85 9 24.025 21.45 26.674999999999997 27.85 10-14 26.31 24.94 21.735 27.015 15-19 26.555 24.325 22.915 26.205000000000002 20-24 26.584999999999997 23.925 22.689999999999998 26.8 25-29 26.515 24.355 22.915 26.215 30-34 26.575 23.96 23.09 26.375 35-39 25.869999999999997 24.125 23.51 26.495 40-44 26.71 23.974999999999998 23.02 26.295 45-49 26.545 24.245 22.96 26.25 50-54 26.8 23.865 22.745 26.590000000000003 55-59 26.745 23.79 22.74 26.724999999999998 60-64 26.584999999999997 23.96 22.91 26.545 65-69 26.974999999999998 24.279999999999998 22.869999999999997 25.874999999999996 70-74 26.284999999999997 24.11 22.84 26.765 75-79 26.450000000000003 23.965 23.05 26.534999999999997 80-84 26.045 24.285 23.26 26.41 85-89 26.779999999999998 23.89 22.655 26.674999999999997 90-94 27.700000000000003 23.575 22.67 26.055 95-99 27.255000000000003 23.61 23.46 25.674999999999997 100-104 27.165 23.825 22.985 26.025 105-109 26.834999999999997 23.919999999999998 23.415 25.83 110-114 27.22 24.555 22.675 25.55 115-119 27.61 24.565 22.400000000000002 25.424999999999997 120-124 27.455000000000002 24.9 22.325 25.319999999999997 125-129 28.299999999999997 24.265 22.355 25.080000000000002 130-134 28.125 23.84 23.18 24.855 135-139 28.410000000000004 24.445 23.085 24.060000000000002 140-144 28.035 24.58 22.869999999999997 24.515 145-149 29.205 25.080000000000002 21.715 24.0 150-151 29.125 25.3 22.6875 22.8875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.5 17 1.0 18 1.0 19 1.0 20 0.5 21 0.0 22 0.5 23 1.5 24 1.5 25 2.5 26 3.5 27 2.5 28 2.5 29 5.0 30 8.5 31 11.0 32 13.0 33 12.0 34 15.5 35 24.0 36 33.5 37 42.5 38 54.0 39 69.0 40 82.5 41 104.5 42 132.5 43 140.5 44 136.0 45 144.0 46 151.5 47 155.0 48 153.0 49 141.0 50 124.5 51 118.5 52 114.0 53 105.5 54 105.5 55 100.5 56 100.5 57 103.5 58 99.0 59 108.0 60 114.5 61 103.0 62 92.0 63 92.0 64 90.0 65 87.5 66 92.5 67 79.0 68 61.5 69 73.5 70 77.0 71 61.0 72 53.0 73 47.5 74 36.5 75 30.5 76 25.0 77 14.0 78 11.0 79 8.0 80 4.5 81 4.0 82 3.0 83 1.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 1.0 94 1.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.725 #Duplication Level Percentage of deduplicated Percentage of total 1 91.18214384127859 82.72500000000001 2 7.7156241388812346 14.000000000000002 3 0.8266740148801324 2.25 4 0.2480022044640397 0.8999999999999999 5 0.027555800496004413 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAGCCGTGGTGCTTTAACTAGGGGAGGCTACTAGTTGCGGTTATGGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5875 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.0875 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 2.8 0.0 0.0 0.0 0.0 120-121 2.975 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.75 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.637499999999999 0.0 0.0 0.0 0.0 130-131 5.125 0.0 0.0 0.0 0.0 132-133 5.5875 0.0 0.0 0.0 0.0 134-135 6.0625 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 7.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACATG 10 0.006830828 145.0 4 >>END_MODULE Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873473 spots for SRR7814850.sra Written 2873473 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra Read 2873458 spots for SRR7814850.sra Written 2873458 spots for SRR7814850.sra SRR ids: ['SRR7814850.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zucidm2e SRR7814850.sra spots: 57469175 blocks: [[1, 2873458], [2873459, 5746916], [5746917, 8620374], [8620375, 11493832], [11493833, 14367290], [14367291, 17240748], [17240749, 20114206], [20114207, 22987664], [22987665, 25861122], [25861123, 28734580], [28734581, 31608038], [31608039, 34481496], [34481497, 37354954], [37354955, 40228412], [40228413, 43101870], [43101871, 45975328], [45975329, 48848786], [48848787, 51722244], [51722245, 54595702], [54595703, 57469175]] SRR7814850 file size 19452717 SRR7814850 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814850 SRR7814850_1.fastq SRR7814850_2.fastq Input file: SRR7814850_1.fastq Paired file: SRR7814850_2.fastq trimmed: SRR7814850-trimmed-pair1.fastq, SRR7814850-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:17:47 2024 >> started Fri Dec 6 13:19:01 2024 >> done (74.082s) 57469175 read pairs processed; of these: 246 ( 0.00%) short read pairs filtered out after trimming by size control 12895 ( 0.02%) empty read pairs filtered out after trimming by size control 57456034 (99.98%) read pairs available; of these: 6076875 (10.58%) trimmed read pairs available after processing 51379159 (89.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 15 0.00% 20 20 0.00% 21 29 0.00% 22 22 0.00% 23 33 0.00% 24 27 0.00% 25 46 0.00% 26 29 0.00% 27 28 0.00% 28 55 0.00% 29 62 0.00% 30 71 0.00% 31 69 0.00% 32 84 0.00% 33 63 0.00% 34 61 0.00% 35 75 0.00% 36 61 0.00% 37 102 0.00% 38 122 0.00% 39 123 0.00% 40 141 0.00% 41 120 0.00% 42 148 0.00% 43 136 0.00% 44 130 0.00% 45 176 0.00% 46 175 0.00% 47 170 0.00% 48 192 0.00% 49 259 0.00% 50 267 0.00% 51 305 0.00% 52 342 0.00% 53 330 0.00% 54 366 0.00% 55 475 0.00% 56 449 0.00% 57 484 0.00% 58 618 0.00% 59 705 0.00% 60 885 0.00% 61 984 0.00% 62 1118 0.00% 63 1267 0.00% 64 1338 0.00% 65 1406 0.00% 66 1574 0.00% 67 1745 0.00% 68 1974 0.00% 69 2386 0.00% 70 2627 0.00% 71 3098 0.01% 72 3488 0.01% 73 4032 0.01% 74 4433 0.01% 75 4977 0.01% 76 5494 0.01% 77 6097 0.01% 78 6931 0.01% 79 7752 0.01% 80 8661 0.02% 81 9609 0.02% 82 10904 0.02% 83 12219 0.02% 84 13535 0.02% 85 14673 0.03% 86 16208 0.03% 87 17429 0.03% 88 19025 0.03% 89 20306 0.04% 90 22345 0.04% 91 24534 0.04% 92 26909 0.05% 93 29038 0.05% 94 31224 0.05% 95 33471 0.06% 96 35569 0.06% 97 38114 0.07% 98 39477 0.07% 99 41328 0.07% 100 44161 0.08% 101 46322 0.08% 102 49448 0.09% 103 52184 0.09% 104 54680 0.10% 105 56796 0.10% 106 60670 0.11% 107 62672 0.11% 108 64332 0.11% 109 67864 0.12% 110 69367 0.12% 111 72031 0.13% 112 75396 0.13% 113 78230 0.14% 114 81678 0.14% 115 84470 0.15% 116 87088 0.15% 117 89663 0.16% 118 91091 0.16% 119 92176 0.16% 120 95565 0.17% 121 97408 0.17% 122 100588 0.18% 123 102831 0.18% 124 107102 0.19% 125 109828 0.19% 126 113458 0.20% 127 115119 0.20% 128 117411 0.20% 129 120871 0.21% 130 120933 0.21% 131 123432 0.21% 132 127332 0.22% 133 129798 0.23% 134 133085 0.23% 135 135818 0.24% 136 137882 0.24% 137 138485 0.24% 138 140333 0.24% 139 144414 0.25% 140 145693 0.25% 141 148880 0.26% 142 151033 0.26% 143 152904 0.27% 144 157656 0.27% 145 159744 0.28% 146 162906 0.28% 147 165176 0.29% 148 167635 0.29% 149 168122 0.29% 150 169733 0.30% 151 51379159 89.42% 57456034 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=12 prefix-density=0.82 prefix-fanout=3.2 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=35 fanout-score=91.68 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=5.4 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.86 fanout-score-rank=18 prefix-density=0.78 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=77.82 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=5.6 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7814850 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:19:50 Started mapping on | Dec 06 13:19:50 Finished on | Dec 06 13:25:25 Mapping speed, Million of reads per hour | 617.44 Number of input reads | 57456034 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 54005174 Uniquely mapped reads % | 93.99% Average mapped length | 295.61 Number of splices: Total | 53162785 Number of splices: Annotated (sjdb) | 50164728 Number of splices: GT/AG | 52418121 Number of splices: GC/AG | 612468 Number of splices: AT/AC | 18523 Number of splices: Non-canonical | 113673 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1196867 % of reads mapped to multiple loci | 2.08% Number of reads mapped to too many loci | 88312 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 0.98% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2253993 2253993 2253993 N_multimapping 1196867 1196867 1196867 N_noFeature 2118104 52433720 2572883 N_ambiguous 1378769 7424 263415 UnstrandedReadsAssigned:50508301 PositiveStrandReadsAssigned:1564030 NegativeStrandReadsAssigned:51168876 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814850 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814850-trimmed-pair1.fastq SRR7814850-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 57,456,034 reads, 51,646,232 reads pseudoaligned [quant] estimated average fragment length: 266.556 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52973 SRR7814850.ke.tsv 35125 SRR7814850.se.tsv 88098 total ==> SRR7814850.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.077 0 0 PNS24247 1044 778.444 156.804 5.08884 PNS24249 1928 1662.44 411.25 6.24952 PNS24246 1044 778.444 156.804 5.08884 PNS24248 1044 778.444 156.804 5.08884 PNS24244 1471 1205.44 189.337 3.96806 PNS24243 293 95.6946 2 0.527997 KQK14069 1603 1337.44 33695.7 636.484 KQK14071 474 233.442 962.13 104.122 ==> SRR7814850.se.tsv <== BRADI_1g14170v3 39380 BRADI_1g53295v3 3475 BRADI_1g59795v3 390 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 1488 BRADI_1g74790v3 2117 BRADI_1g09890v3 0 BRADI_1g77505v3 751 BRADI_1g48960v3 0 SRR7814850 completed mapping pipeline successfully