Starting /dee2/code/volunteer_pipeline.sh SRR7814851 current disk space = 1551383281664 free memory = 1604560556 SRR7814851 SRAfilesize 4e3dea5093ac5d98c84e196b14905fec SRR7814851.sra SRR7814851.sra file validated SRR7814851 is paired end SRR7814851 is conventional basespace SRR7814851 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814851_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.48175 37.0 37.0 37.0 37.0 37.0 2 36.353 37.0 37.0 37.0 37.0 37.0 3 36.5465 37.0 37.0 37.0 37.0 37.0 4 36.581 37.0 37.0 37.0 37.0 37.0 5 36.605 37.0 37.0 37.0 37.0 37.0 6 36.498 37.0 37.0 37.0 37.0 37.0 7 36.5205 37.0 37.0 37.0 37.0 37.0 8 36.567 37.0 37.0 37.0 37.0 37.0 9 36.562 37.0 37.0 37.0 37.0 37.0 10-14 36.5745 37.0 37.0 37.0 37.0 37.0 15-19 36.507799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5355 37.0 37.0 37.0 37.0 37.0 25-29 36.4785 37.0 37.0 37.0 37.0 37.0 30-34 36.3218 37.0 37.0 37.0 37.0 37.0 35-39 36.2362 37.0 37.0 37.0 37.0 37.0 40-44 36.172000000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.2992 37.0 37.0 37.0 37.0 37.0 50-54 36.3291 37.0 37.0 37.0 37.0 37.0 55-59 36.3073 37.0 37.0 37.0 37.0 37.0 60-64 36.3112 37.0 37.0 37.0 37.0 37.0 65-69 36.270999999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.1865 37.0 37.0 37.0 37.0 37.0 75-79 36.1199 37.0 37.0 37.0 37.0 37.0 80-84 36.125800000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.071999999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.034200000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.7599 37.0 37.0 37.0 37.0 37.0 100-104 35.4833 37.0 37.0 37.0 37.0 37.0 105-109 35.673500000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.7926 37.0 37.0 37.0 37.0 37.0 115-119 35.5726 37.0 37.0 37.0 37.0 37.0 120-124 34.953500000000005 37.0 37.0 37.0 27.4 37.0 125-129 34.7538 37.0 37.0 37.0 25.0 37.0 130-134 35.256 37.0 37.0 37.0 32.2 37.0 135-139 35.1641 37.0 37.0 37.0 27.4 37.0 140-144 35.20799999999999 37.0 37.0 37.0 29.8 37.0 145-149 35.0099 37.0 37.0 37.0 25.0 37.0 150-151 34.3845 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 3.0 24 3.0 25 4.0 26 8.0 27 4.0 28 9.0 29 25.0 30 26.0 31 51.0 32 83.0 33 127.0 34 247.0 35 584.0 36 2657.0 37 168.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.49061326658323 11.78973717146433 4.90613266583229 30.813516896120152 2 26.924999999999997 14.299999999999999 29.5 29.275000000000002 3 22.275 19.7 23.9 34.125 4 27.500000000000004 25.35 20.375 26.775 5 26.775 30.7 21.125 21.4 6 23.974999999999998 31.6 22.525000000000002 21.9 7 18.8 25.1 37.05 19.05 8 20.549999999999997 23.525 28.125 27.800000000000004 9 20.25 22.275 31.275 26.200000000000003 10-14 24.125 25.935000000000002 24.23 25.71 15-19 23.385 25.974999999999998 24.404999999999998 26.235000000000003 20-24 23.86 26.105 24.345 25.69 25-29 24.759999999999998 25.525 24.275 25.44 30-34 24.135 25.650000000000002 23.735 26.479999999999997 35-39 24.285 25.035 24.2 26.479999999999997 40-44 23.78 25.47 24.64 26.11 45-49 24.04 25.685000000000002 23.845 26.43 50-54 23.79 25.285000000000004 24.02 26.905 55-59 23.905 25.205 24.42 26.47 60-64 24.44 25.240000000000002 24.03 26.290000000000003 65-69 24.825 25.09 23.845 26.240000000000002 70-74 24.13 24.83 24.21 26.83 75-79 24.985 24.79 23.724999999999998 26.5 80-84 25.045 25.235000000000003 23.494999999999997 26.224999999999998 85-89 25.22 23.919999999999998 23.655 27.205000000000002 90-94 24.915000000000003 24.415 23.330000000000002 27.339999999999996 95-99 25.2 24.759999999999998 23.305 26.735 100-104 25.590000000000003 24.315 23.655 26.44 105-109 25.874999999999996 24.875 23.225 26.025 110-114 25.569999999999997 24.87 22.509999999999998 27.05 115-119 25.264999999999997 24.18 23.669999999999998 26.884999999999998 120-124 25.135 24.875 23.080000000000002 26.91 125-129 25.305 24.725 23.235 26.735 130-134 25.655 23.765 23.064999999999998 27.515 135-139 25.52 24.455 22.689999999999998 27.334999999999997 140-144 25.845000000000002 24.03 23.315 26.810000000000002 145-149 25.069999999999997 24.305 23.13 27.495000000000005 150-151 25.7375 23.45 23.400000000000002 27.4125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.5 28 2.5 29 2.5 30 2.0 31 6.0 32 10.0 33 16.0 34 27.0 35 39.0 36 49.0 37 56.5 38 72.5 39 97.0 40 113.0 41 124.5 42 143.5 43 151.5 44 166.0 45 174.5 46 164.5 47 166.0 48 169.0 49 162.0 50 154.5 51 154.5 52 156.5 53 140.5 54 112.0 55 101.0 56 99.0 57 92.5 58 85.0 59 89.0 60 97.0 61 87.5 62 73.5 63 67.5 64 65.5 65 65.0 66 66.0 67 53.0 68 40.0 69 47.5 70 49.5 71 41.0 72 32.0 73 28.0 74 23.5 75 17.0 76 14.0 77 11.5 78 7.5 79 5.5 80 3.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.825 #Duplication Level Percentage of deduplicated Percentage of total 1 90.0361814639577 80.875 2 8.794878931255218 15.8 3 1.0019482326746452 2.7 4 0.13915947676036738 0.5 5 0.027831895352073477 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCTCACATCTCGTAT 5 0.125 TruSeq Adapter, Index 13 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.3875000000000002 0.0 0.0 0.0 0.0 102-103 1.6125 0.0 0.0 0.0 0.0 104-105 2.125 0.0 0.0 0.0 0.0 106-107 2.3375 0.0 0.0 0.0 0.0 108-109 2.5625 0.0 0.0 0.0 0.0 110-111 2.775 0.0 0.0 0.0 0.0 112-113 3.025 0.0 0.0 0.0 0.0 114-115 3.3125 0.0 0.0 0.0 0.0 116-117 3.7125 0.0 0.0 0.0 0.0 118-119 4.05 0.0 0.0 0.0 0.0 120-121 4.4 0.0 0.0 0.0 0.0 122-123 4.675000000000001 0.0 0.0 0.0 0.0 124-125 4.925 0.0 0.0 0.0 0.0 126-127 5.45 0.0 0.0 0.0 0.0 128-129 5.85 0.0 0.0 0.0 0.0 130-131 6.45 0.0 0.0 0.0 0.0 132-133 6.987500000000001 0.0 0.0 0.0 0.0 134-135 7.4625 0.0 0.0 0.0 0.0 136-137 7.987500000000001 0.0 0.0 0.0 0.0 138-139 8.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814851 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814851_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.99 37.0 37.0 37.0 37.0 37.0 2 35.7405 37.0 37.0 37.0 37.0 37.0 3 35.656 37.0 37.0 37.0 37.0 37.0 4 35.765 37.0 37.0 37.0 37.0 37.0 5 35.636 37.0 37.0 37.0 37.0 37.0 6 35.4705 37.0 37.0 37.0 37.0 37.0 7 35.4475 37.0 37.0 37.0 37.0 37.0 8 35.537 37.0 37.0 37.0 37.0 37.0 9 35.7025 37.0 37.0 37.0 37.0 37.0 10-14 35.642199999999995 37.0 37.0 37.0 37.0 37.0 15-19 35.147400000000005 37.0 37.0 37.0 32.2 37.0 20-24 35.3631 37.0 37.0 37.0 34.6 37.0 25-29 35.30800000000001 37.0 37.0 37.0 34.6 37.0 30-34 34.9964 37.0 37.0 37.0 27.4 37.0 35-39 35.0675 37.0 37.0 37.0 27.4 37.0 40-44 34.717 37.0 37.0 37.0 27.4 37.0 45-49 34.9107 37.0 37.0 37.0 25.0 37.0 50-54 34.2329 37.0 37.0 37.0 25.0 37.0 55-59 34.060199999999995 37.0 37.0 37.0 25.0 37.0 60-64 34.4137 37.0 37.0 37.0 25.0 37.0 65-69 34.3626 37.0 37.0 37.0 25.0 37.0 70-74 33.96040000000001 37.0 37.0 37.0 25.0 37.0 75-79 33.813900000000004 37.0 37.0 37.0 22.2 37.0 80-84 33.7273 37.0 37.0 37.0 22.2 37.0 85-89 34.1263 37.0 37.0 37.0 25.0 37.0 90-94 33.611000000000004 37.0 37.0 37.0 22.2 37.0 95-99 32.759899999999995 37.0 37.0 37.0 11.0 37.0 100-104 33.0506 37.0 37.0 37.0 13.8 37.0 105-109 32.6981 37.0 37.0 37.0 11.0 37.0 110-114 33.0982 37.0 37.0 37.0 11.0 37.0 115-119 33.1804 37.0 37.0 37.0 19.4 37.0 120-124 32.4182 37.0 34.6 37.0 11.0 37.0 125-129 32.5873 37.0 37.0 37.0 11.0 37.0 130-134 31.960900000000002 37.0 29.8 37.0 11.0 37.0 135-139 32.1245 37.0 29.8 37.0 11.0 37.0 140-144 32.1884 37.0 34.6 37.0 11.0 37.0 145-149 31.7631 37.0 27.4 37.0 11.0 37.0 150-151 31.272 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 6.0 16 2.0 17 5.0 18 4.0 19 7.0 20 7.0 21 15.0 22 38.0 23 39.0 24 69.0 25 68.0 26 85.0 27 71.0 28 96.0 29 103.0 30 125.0 31 137.0 32 167.0 33 231.0 34 335.0 35 733.0 36 1612.0 37 40.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.35 18.975 6.7 27.975 2 30.25 21.725 24.975 23.05 3 25.6 24.875 25.275 24.25 4 29.575000000000003 30.425 17.8 22.2 5 29.2 32.324999999999996 17.5 20.974999999999998 6 25.25 32.475 19.275000000000002 23.0 7 23.674999999999997 19.85 31.25 25.224999999999998 8 23.95 22.15 23.3 30.599999999999998 9 25.8 22.025 23.375 28.799999999999997 10-14 27.389999999999997 24.88 21.58 26.150000000000002 15-19 27.11 24.65 22.805 25.435000000000002 20-24 26.669999999999998 25.064999999999998 22.21 26.055 25-29 26.450000000000003 24.779999999999998 22.939999999999998 25.83 30-34 26.400000000000002 24.490000000000002 23.095 26.015 35-39 26.700000000000003 24.915000000000003 22.36 26.025 40-44 27.134999999999998 24.265 23.005 25.595000000000002 45-49 26.939999999999998 23.974999999999998 23.195 25.89 50-54 25.590000000000003 24.605 23.43 26.375 55-59 26.96 24.605 22.735 25.7 60-64 26.595000000000002 24.545 23.044999999999998 25.814999999999998 65-69 27.18 24.585 22.95 25.285000000000004 70-74 26.740000000000002 24.355 23.18 25.724999999999998 75-79 26.924999999999997 24.57 22.865 25.64 80-84 27.12 24.725 23.315 24.84 85-89 27.334999999999997 24.169999999999998 22.689999999999998 25.805 90-94 26.825 25.1 23.21 24.865000000000002 95-99 26.3 25.94 23.32 24.44 100-104 26.8 25.44 23.415 24.345 105-109 26.97 25.835 22.34 24.855 110-114 27.32 25.765 22.46 24.455 115-119 26.83 25.629999999999995 22.93 24.610000000000003 120-124 26.6 26.645000000000003 22.795 23.96 125-129 26.715 26.415 22.435 24.435000000000002 130-134 26.484999999999996 26.815 23.085 23.615 135-139 27.865000000000002 26.484999999999996 22.55 23.1 140-144 27.685 26.095000000000002 22.64 23.580000000000002 145-149 28.310000000000002 27.045 22.075 22.57 150-151 29.025000000000002 26.3625 22.325 22.287499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 0.5 13 1.0 14 1.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.0 21 0.0 22 1.0 23 2.5 24 3.0 25 3.0 26 2.0 27 3.0 28 4.5 29 3.0 30 4.5 31 8.5 32 10.0 33 13.5 34 17.0 35 20.5 36 33.5 37 50.0 38 62.5 39 69.5 40 82.0 41 103.0 42 114.5 43 130.0 44 152.0 45 158.5 46 173.0 47 166.5 48 151.0 49 147.0 50 128.5 51 120.5 52 124.5 53 124.0 54 134.5 55 140.0 56 117.0 57 102.5 58 101.5 59 96.5 60 93.5 61 100.0 62 104.5 63 87.0 64 71.0 65 72.5 66 70.5 67 68.0 68 69.0 69 62.0 70 51.5 71 48.5 72 40.5 73 31.5 74 27.5 75 22.5 76 24.0 77 20.5 78 11.5 79 8.5 80 4.0 81 1.5 82 1.5 83 1.5 84 2.0 85 1.5 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 1.0 94 1.5 95 1.5 96 1.5 97 1.5 98 1.5 99 2.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.66666666666666 83.6 2 7.236842105263158 13.200000000000001 3 0.9320175438596491 2.55 4 0.1370614035087719 0.5 5 0.0 0.0 6 0.027412280701754384 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.925 0.0 0.0 0.0 0.0 106-107 2.1375 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.475 0.0 0.0 0.0 0.0 112-113 2.75 0.0 0.0 0.0 0.0 114-115 3.025 0.0 0.0 0.0 0.0 116-117 3.4000000000000004 0.0 0.0 0.0 0.0 118-119 3.6500000000000004 0.0 0.0 0.0 0.0 120-121 4.0 0.0 0.0 0.0 0.0 122-123 4.25 0.0 0.0 0.0 0.0 124-125 4.5125 0.0 0.0 0.0 0.0 126-127 5.0 0.0 0.0 0.0 0.0 128-129 5.4 0.0 0.0 0.0 0.0 130-131 5.949999999999999 0.0 0.0 0.0 0.0 132-133 6.3875 0.0 0.0 0.0 0.0 134-135 6.7875 0.0 0.0 0.0 0.0 136-137 7.2125 0.0 0.0 0.0 0.0 138-139 7.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGATG 10 0.006830828 145.0 3 >>END_MODULE Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra Read 1187771 spots for SRR7814851.sra Written 1187771 spots for SRR7814851.sra Read 1187753 spots for SRR7814851.sra Written 1187753 spots for SRR7814851.sra SRR ids: ['SRR7814851.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uqpq12cy SRR7814851.sra spots: 23755078 blocks: [[1, 1187753], [1187754, 2375506], [2375507, 3563259], [3563260, 4751012], [4751013, 5938765], [5938766, 7126518], [7126519, 8314271], [8314272, 9502024], [9502025, 10689777], [10689778, 11877530], [11877531, 13065283], [13065284, 14253036], [14253037, 15440789], [15440790, 16628542], [16628543, 17816295], [17816296, 19004048], [19004049, 20191801], [20191802, 21379554], [21379555, 22567307], [22567308, 23755078]] SRR7814851 file size 8028116 SRR7814851 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814851 SRR7814851_1.fastq SRR7814851_2.fastq Input file: SRR7814851_1.fastq Paired file: SRR7814851_2.fastq trimmed: SRR7814851-trimmed-pair1.fastq, SRR7814851-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:38:47 2024 >> started Fri Dec 6 12:39:15 2024 >> done (27.287s) 23755078 read pairs processed; of these: 144 ( 0.00%) short read pairs filtered out after trimming by size control 24001 ( 0.10%) empty read pairs filtered out after trimming by size control 23730933 (99.90%) read pairs available; of these: 2995580 (12.62%) trimmed read pairs available after processing 20735353 (87.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 16 0.00% 20 9 0.00% 21 15 0.00% 22 22 0.00% 23 22 0.00% 24 24 0.00% 25 25 0.00% 26 27 0.00% 27 33 0.00% 28 40 0.00% 29 45 0.00% 30 37 0.00% 31 66 0.00% 32 59 0.00% 33 67 0.00% 34 54 0.00% 35 64 0.00% 36 62 0.00% 37 70 0.00% 38 86 0.00% 39 92 0.00% 40 103 0.00% 41 112 0.00% 42 119 0.00% 43 101 0.00% 44 126 0.00% 45 146 0.00% 46 165 0.00% 47 166 0.00% 48 192 0.00% 49 217 0.00% 50 264 0.00% 51 281 0.00% 52 270 0.00% 53 313 0.00% 54 305 0.00% 55 374 0.00% 56 398 0.00% 57 433 0.00% 58 459 0.00% 59 604 0.00% 60 688 0.00% 61 753 0.00% 62 844 0.00% 63 980 0.00% 64 1026 0.00% 65 1109 0.00% 66 1186 0.00% 67 1370 0.01% 68 1459 0.01% 69 1707 0.01% 70 2066 0.01% 71 2211 0.01% 72 2628 0.01% 73 2959 0.01% 74 3175 0.01% 75 3572 0.02% 76 3773 0.02% 77 4158 0.02% 78 4561 0.02% 79 5045 0.02% 80 5627 0.02% 81 6311 0.03% 82 7332 0.03% 83 8124 0.03% 84 8928 0.04% 85 9541 0.04% 86 10336 0.04% 87 11053 0.05% 88 11631 0.05% 89 12489 0.05% 90 13557 0.06% 91 14752 0.06% 92 16158 0.07% 93 17528 0.07% 94 18912 0.08% 95 19838 0.08% 96 21011 0.09% 97 22281 0.09% 98 22778 0.10% 99 24100 0.10% 100 25156 0.11% 101 26476 0.11% 102 27635 0.12% 103 29745 0.13% 104 30637 0.13% 105 31719 0.13% 106 33210 0.14% 107 33540 0.14% 108 34276 0.14% 109 35497 0.15% 110 36301 0.15% 111 37431 0.16% 112 39072 0.16% 113 40279 0.17% 114 42187 0.18% 115 43678 0.18% 116 44013 0.19% 117 45415 0.19% 118 45600 0.19% 119 46404 0.20% 120 46942 0.20% 121 48111 0.20% 122 49051 0.21% 123 50347 0.21% 124 52681 0.22% 125 52988 0.22% 126 54825 0.23% 127 55209 0.23% 128 55604 0.23% 129 56988 0.24% 130 57099 0.24% 131 57659 0.24% 132 59885 0.25% 133 61461 0.26% 134 61828 0.26% 135 63522 0.27% 136 63690 0.27% 137 64853 0.27% 138 65096 0.27% 139 66068 0.28% 140 66481 0.28% 141 67077 0.28% 142 68860 0.29% 143 69084 0.29% 144 70804 0.30% 145 72715 0.31% 146 73298 0.31% 147 74429 0.31% 148 75438 0.32% 149 74894 0.32% 150 76671 0.32% 151 20735353 87.38% 23730933 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=28 prefix-density=0.52 prefix-fanout=2.3 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=73.96 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=8.3 sequence=GCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=25 prefix-density=0.35 prefix-fanout=2.0 sequence=GGGTGCACCGACGCCAC criterion=fanout-score sequence-density=0.13 sequence-density-rank=18 fanout-score=97.28 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=17.1 sequence=GCCGCCGCCGCC SRR7814851 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:40:11 Started mapping on | Dec 06 12:40:11 Finished on | Dec 06 12:43:02 Mapping speed, Million of reads per hour | 499.60 Number of input reads | 23730933 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 21829789 Uniquely mapped reads % | 91.99% Average mapped length | 293.26 Number of splices: Total | 18982480 Number of splices: Annotated (sjdb) | 17900975 Number of splices: GT/AG | 18718211 Number of splices: GC/AG | 209522 Number of splices: AT/AC | 8939 Number of splices: Non-canonical | 45808 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 3.05 Insertion rate per base | 0.03% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338282 % of reads mapped to multiple loci | 1.43% Number of reads mapped to too many loci | 31401 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.61% % of reads unmapped: other | 0.84% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1562862 1562862 1562862 N_multimapping 338282 338282 338282 N_noFeature 492087 21177863 681559 N_ambiguous 536952 2555 74908 UnstrandedReadsAssigned:20800750 PositiveStrandReadsAssigned:649371 NegativeStrandReadsAssigned:21073322 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814851 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814851-trimmed-pair1.fastq SRR7814851-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,730,933 reads, 21,562,737 reads pseudoaligned [quant] estimated average fragment length: 252.117 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,304 rounds 52973 SRR7814851.ke.tsv 35125 SRR7814851.se.tsv 88098 total ==> SRR7814851.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 685.111 0 0 PNS24247 1044 792.883 27.6907 2.08274 PNS24249 1928 1676.88 87.6153 3.11593 PNS24246 1044 792.883 27.6907 2.08274 PNS24248 1044 792.883 27.6907 2.08274 PNS24244 1471 1219.88 163.313 7.98384 PNS24243 293 98.2646 0 0 KQK14069 1603 1351.88 2597.25 114.574 KQK14071 474 240.201 45.4269 11.2784 ==> SRR7814851.se.tsv <== BRADI_1g14170v3 2736 BRADI_1g53295v3 374 BRADI_1g59795v3 105 BRADI_1g07683v3 0 BRADI_1g00485v3 89 BRADI_1g20270v3 5249 BRADI_1g74790v3 148 BRADI_1g09890v3 26 BRADI_1g77505v3 317 BRADI_1g48960v3 3 SRR7814851 completed mapping pipeline successfully